SiRNA for inhibiting expression of lfTSLP gene and composition thereof

CN121712893APending Publication Date: 2026-03-20CHANGCHUN GENESCIENCE PHARM CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202480051792.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-08-18
Filing Date
2024-08-16
Publication Date
2026-03-20

AI Technical Summary

Technical Problem

The prior art is difficult to effectively inhibit the expression of long subtype thymus stromal lymphopoietin (lfTSLP), which makes it difficult to effectively treat related diseases such as asthma and chronic sinusitis.

Method used

A small interfering RNA (siRNA) was designed that specifically inhibits the expression of the lfTSLP gene and reduces its expression level by complementing the specific sequences targeting the lfTSLP mRNA.

Benefits of technology

By inhibiting the expression of lfTSLP, siRNA can effectively treat related diseases caused by abnormal expression of lfTSLP, and does not affect the expression of short subtype TSLP (sfTSLP), and has good stability and biological activity.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention provides siRNA for inhibiting expression of the lfTSLP gene. The siRNA contains a positive-sense strand and an antisense strand. The provided siRNA can specifically target a long subtype TSLP with proinflammatory activity and inhibit the expression of mRNA and protein of the long subtype TSLP without influencing the expression of mRNA and protein of a short subtype TSLP with anti-inflammatory activity. Therefore, the method has an important clinical value in treatment of lfTSLP related diseases.
Need to check novelty before this filing date? Find Prior Art

Description

siRNA for inhibiting lfTSLP gene expression and its composition

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to Chinese patent application No. 202311047112.8 filed on August 18, 2023, the entire contents of which are incorporated herein by reference in their entirety. Technical Field

[0003] The present invention provides an siRNA for inhibiting the expression of long isoform thymic stromal lymphopoietin (lfTSLP) and a pharmaceutical composition thereof. The siRNA and the pharmaceutical composition provided by the present invention can treat diseases related to lfTSLP. Technical Background

[0004] Thymic stromal lymphopoietin (TSLP) belongs to the interleukin-2 (IL-2) family of cytokines. It is primarily expressed and secreted by epithelial cells of the lungs, skin, and intestines, with small amounts also expressed in airway smooth muscle cells, keratinocytes, stromal cells, mast cells, and other cells. TSLP is an alarm factor that, in response to external stimuli (such as allergens and viral infections), binds to its specific receptors, the thymic stromal lymphopoietin receptor (TSLPR) and the interleukin-7 receptor alpha chain (IL-7Rα), forming a ternary complex and activating downstream inflammatory signaling.

[0005] Human TSLP has two isoforms regulated by independent promoters: the long isoform of Thymic Stromal Lymphopoietin (lfTSLP) and the short isoform of Thymic Stromal Lymphopoietin (sfTSLP). The long isoform (lfTSLP) is upregulated in inflammation and has pro-inflammatory functions, while the short isoform (sfTSLP) is expressed in healthy tissues and has anti-inflammatory and antibacterial activities. Under pathological conditions, abnormal activation of lfTSLP signaling is closely associated with the development of various diseases, such as asthma, chronic sinusitis, atopic dermatitis, eosinophilic esophagitis, chronic obstructive pulmonary disease, and idiopathic pulmonary fibrosis. Research data show that in asthmatic patients, the expression level of lfTSLP is positively correlated with the severity of the disease.

[0006] To date, only one antibody drug targeting TSLP has been approved by the FDA for marketing, namely Tezspire (Tezepeluma), which is used as an additional maintenance treatment for severe asthma patients aged 12 years and above without phenotypic restrictions. It requires subcutaneous injection once every four weeks. Its mechanism of action is to bind to TSLP protein and inhibit its binding to TSLPR receptor, thereby inhibiting the occurrence of downstream inflammatory cascade reactions and achieving the purpose of treating asthma.

[0007] siRNAs targeting the human long isoform TSLP gene can be designed to inhibit lfTSLP protein expression in a sequence-specific manner at the mRNA level, thereby treating diseases caused by abnormal lfTSLP expression without affecting sfTSLP expression. However, to date, no siRNA drugs targeting lfTSLP have been used clinically. Therefore, there is an urgent need to develop siRNA drugs with potential clinical application value, good stability and good biological activity.

[0008] Summary of the Invention

[0009] The present invention provides siRNA that can effectively inhibit lfTSLP gene expression, and thereby provides drugs and methods for preventing and / or treating lfTSLP-related diseases.

[0010] siRNA

[0011] In one aspect, the present invention provides a small interfering RNA (siRNA) for inhibiting the expression of the long isoform TSLP (lfTSLP) gene, wherein the siRNA comprises a sense strand and an antisense strand, wherein the antisense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 164 by no more than 4 (e.g., 0, 1, 2, 3 or 4) nucleotides, and the sense strand is at least partially complementary to the antisense strand.

[0012] The at least partially complementary means that the two sequences can be fully complementary, or generally have no more than 6, 5, 4, 3, 2 or 1 mismatched base pairings, while retaining the ability to hybridize under relevant conditions. Those skilled in the art can determine the conditions that are most suitable for testing the complementarity of the two sequences based on the final application of the hybridized nucleotides. Such conditions can, for example, be stringent conditions, such as 400mM NaCl, 40mM PIPES pH 6.4, 1mM EDTA, 50°C or 70°C for 12-16 hours, followed by washing. Other conditions, such as physiologically relevant conditions that may be encountered in vivo, can also be applied.

[0013] In some embodiments, the lfTSLP is a long isoform TSLP, such as an mRNA having a sequence as shown in Genbank: NM_033035.5. In some embodiments, the siRNA of the present invention targets the sequence as shown in SEQ ID NO: 727. In some embodiments, the siRNA of the present invention targets lfTSLP and does not affect the expression of the short isoform TSLP (sfTSLP).

[0014] In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides that differ by 0 or 1 nucleotide from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 164.

[0015] In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 164 by no more than 4 (e.g., 0, 1, 2, 3, or 4) nucleotides. In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 164 by no more than 3 (e.g., 0, 1, 2, or 3) nucleotides. In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 164 by no more than 2 (e.g., 0, 1, or 2) nucleotides. In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ by no more than 1 (e.g., 0 or 1) nucleotide from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 164. In some embodiments, the antisense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) of the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 164.

[0016] In some embodiments, the antisense strand is a nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 164.

[0017] In some embodiments, the sense strand has no more than 6 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 5 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 4 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 3 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 2 nucleotide mismatches with the antisense strand. In some embodiments, the sense strand has no more than 1 nucleotide mismatch with the antisense strand. In some embodiments, the sense strand is fully complementary to the antisense strand.

[0018] In some embodiments, the sense strand and the antisense strand have at least 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides of complementarity. In some embodiments, the sense strand and the antisense strand have 14 to 19 nucleotides of complementarity.

[0019] In some embodiments, the sense strand and the antisense strand are at least 85% (eg, at least 90%, at least 95%, at least 99%) complementary or fully complementary over at least 14 consecutive nucleotides.

[0020] In some embodiments, the sense strand and the antisense strand form a duplex region of 14 to 30 nucleotide pairs in length, such as 14 to 25 nucleotide pairs, 14 to 23 nucleotide pairs, 14 to 21 nucleotide pairs, 15 to 25 nucleotide pairs, 15 to 23 nucleotide pairs, 15 to 21 nucleotide pairs, 17 to 25 nucleotide pairs, 17 to 23 nucleotide pairs, or 17 to 21 nucleotide pairs, such as 14, 15, 16, 17, 18, 19, 20, or 21 nucleotide pairs. In some embodiments, the sense strand and the antisense strand form a duplex region of 14 to 19 nucleotide pairs in length.

[0021] In some embodiments, the antisense strand is 14-30 (e.g., 14-29, 14-28, 14-27, 19-30, 19-29, 19-28, 19-27, 19-25, 19-23, 21-25, 21-23) nucleotides in length and the sense strand is 14-30 (e.g., 14-29, 14-28, 14-27, 14-26, 14-25, 14-21, 19-21) nucleotides in length.

[0022] In some embodiments, the antisense strand is 16 to 25 nucleotides in length; and the sense strand is 14 to 23 nucleotides in length.

[0023] In some embodiments, the antisense strand is 21 to 23 nucleotides in length; and the sense strand is 19 to 21 nucleotides in length.

[0024] In some embodiments, the antisense strand is 21 nucleotides in length and the sense strand is 19 nucleotides in length.

[0025] In some embodiments, the siRNA comprises blunt ends and / or overhangs.

[0026] In some embodiments, the siRNA comprises one or more single-stranded nucleotide overhangs. For example, an overhang of 1, 2, 3, or 4 nucleotides. In some embodiments, the overhang can be on the sense strand, the antisense strand, or any combination thereof. In some embodiments, the overhang is present on the 5' end, the 3' end, or both ends of the siRNA antisense strand or the sense strand.

[0027] In some embodiments, the 3' end of the antisense strand of the siRNA has a 2-nucleotide overhang. In some embodiments, the 3' end of the sense strand of the siRNA is blunt-ended.

[0028] In some embodiments, the sense strand of the siRNA comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 165 to SEQ ID NO: 328 by no more than 4 (e.g., 0, 1, 2, 3, or 4) nucleotides. The at least 14 consecutive nucleotides comprised by the sense and antisense strands of the siRNA form a duplex region. In some embodiments, the sense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 165 to SEQ ID NO: 328 by no more than 3 (e.g., 0, 1, 2, or 3) nucleotides. In some embodiments, the sense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 165 to SEQ ID NO: 328 by no more than 2 (e.g., 0, 1, or 2) nucleotides. In some embodiments, the sense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) that differ from the nucleotide sequence shown in any one of SEQ ID NO: 165 to SEQ ID NO: 328 by no more than 1 (e.g., 0 or 1) nucleotides. In some embodiments, the sense strand has a region of at least 85% (e.g., at least 90%, at least 95%, at least 99%) complementarity or complete complementarity to the antisense strand within the 14 consecutive nucleotides. In some embodiments, the sense strand comprises at least 14 consecutive nucleotides (e.g., at least 15, at least 16, or at least 17 consecutive nucleotides) of the nucleotide sequence shown in any one of SEQ ID NO: 165 to SEQ ID NO: 328. In some embodiments, the sense strand is the nucleotide sequence shown in any one of SEQ ID NO: 165 to SEQ ID NO: 328.

[0029] In some embodiments, the antisense strand of the siRNA comprises the antisense strand sequence of any one of the GPSZT082UM to GPSZT245UM duplexes provided in Table 1 or a portion thereof (e.g., at least 14 consecutive nucleotides thereof), and the sense strand of the siRNA comprises the sense strand sequence of the duplex or a portion thereof (e.g., at least 14 consecutive nucleotides thereof).

[0030] In some embodiments, the antisense strand of the siRNA comprises the antisense strand sequence of any duplex provided in Table 5 or a portion thereof (e.g., at least 14 consecutive nucleotides thereof). Preferably, the sense strand of the siRNA comprises the sense strand sequence of the duplex or a portion thereof (e.g., at least 14 consecutive nucleotides thereof).

[0031] In some embodiments, the antisense strand of the siRNA comprises the antisense strand sequence or a portion thereof (e.g., at least 14 consecutive nucleotides thereof) of any duplex of GPSZT086UM, GPSZT091UM, GPSZT095UM, GPSZT082UM, GPSZT089UM, GPSZT083UM, GPSZT098UM, GPSZT097UM, GPSZT099UM, or GPSZT085UM provided in Table 1. Preferably, the sense strand of the siRNA comprises the sense strand sequence or a portion thereof (e.g., at least 14 consecutive nucleotides thereof) of the duplex.

[0032] In some embodiments, the antisense strand of the siRNA comprises GPSZT084UM, GPSZT122UM, GPSZT150UM, GPSZT090UM, GPSZT094UM, GPSZT123UM, GPSZT175UM, GPSZT153UM, GPSZT207UM, GPSZT092UM, GPSZT111UM, GPSZT231UM, GPSZT155UM, GPSZT112UM, GPSZT208UM, GPSZT174UM, GPSZT120 ... Preferably, the sense strand of the siRNA comprises the antisense strand sequence of any duplex of GPSZT177UM, GPSZT121UM, GPSZT220UM, GPSZT176UM, GPSZT223UM, GPSZT213UM, GPSZT148UM, GPSZT233UM, GPSZT191UM, GPSZT232UM, GPSZT160UM, GPSZT230UM, GPSZT188UM, GPSZT128UM, GPSZT221UM, GPSZT130UM, or GPSZT149UM, or a portion thereof (e.g., at least 14 consecutive nucleotides thereof).

[0033] In some embodiments, the antisense strand of the siRNA comprises GPSZT084UM, GPSZT122UM, GPSZT150UM, GPSZT090UM, GPSZT094UM, GPSZT123UM, GPSZT175UM, GPSZT153UM, GPSZT092UM, GPSZT111UM, GPSZT231UM, GPSZT112UM, GPSZT174UM, GPSZT12 Preferably, the sense strand of the siRNA comprises the antisense strand sequence of any duplex of GPSZT101UM, GPSZT177UM, GPSZT121UM, GPSZT220UM, GPSZT176UM, GPSZT223UM, GPSZT213UM, GPSZT233UM, GPSZT191UM, GPSZT232UM, GPSZT230UM, GPSZT128UM, GPSZT221UM or GPSZT149UM, or a portion thereof (e.g., at least 14 consecutive nucleotides thereof). Preferably, the sense strand of the siRNA comprises the sense strand sequence of the duplex or a portion thereof (e.g., at least 14 consecutive nucleotides thereof).

[0034] In some embodiments, the antisense strand of the siRNA comprises GPSZT082UM, GPSZT083UM, GPSZT086UM, GPSZT089UM, GPSZT090UM, GPSZT091UM, GPSZT092UM, GPSZT094UM, GPSZT095UM, GPSZT098UM, GPSZT099UM, GPSZT112UM, GPSZT121UM, GPSZT122UM, GPSZT12 Preferably, the sense strand of the siRNA comprises the antisense strand sequence of any duplex of GPSZT13UM, GPSZT128UM, GPSZT149UM, GPSZT150UM, GPSZT153UM, GPSZT174UM, GPSZT175UM, GPSZT176UM, GPSZT177UM, GPSZT191UM, GPSZT220UM, GPSZT221UM, GPSZT223UM, GPSZT226UM or GPSZT231UM, or a portion thereof (e.g., at least 14 consecutive nucleotides thereof).

[0035] Modification

[0036] The siRNA of the present invention can be modified in nucleoside base structure or in ribose-phosphate backbone structure, reduce the effect of missing the target, and / or increase the biological stability of the molecule, or increase the physical stability of the duplex formed between antisense and sense nucleic acid. Therefore, the siRNA sequence comprising any modification is also encompassed within the scope of the present invention. The siRNA molecule comprising ribonucleoside analogs or derivatives must maintain the ability to form duplexes and allow or mediate the specific degradation of the target RNA via the RISC approach.

[0037] In some embodiments, the siRNA contains at least one modified nucleotide. The modification need not be identical for each of the plurality of modified ribonucleosides in the siRNA.

[0038] In some embodiments, all nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides or nucleotide analogs. In some embodiments, all nucleotides in the sense strand of the siRNA are modified nucleotides or nucleotide analogs, and all nucleotides in the antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

[0039] In some embodiments, the siRNA comprises 2'-modified nucleotides.

[0040] In some embodiments, the modified nucleotide or nucleotide analog is selected from 2'-methoxy nucleotides, 2'-fluoro nucleotides, 2'-deoxyribonucleotides, 2',3'-split nucleotide analogs, 2'-fluoroarabinonucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 3'-methoxy nucleotides, 2'-allyl modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphates, nucleotides containing 5'-phosphate mimetics, diol-modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleic acids (LNA), unlocked nucleic acids (UNA) or glycerol nucleotides (GNA), but the present invention is not limited thereto.

[0041] In some embodiments, the modified nucleotides or nucleotide analogs are selected from 2'-methoxy nucleotides, 2'-fluoro nucleotides, 2'-deoxyribonucleotides, nucleotides comprising thiophosphate groups, nucleotides comprising 5'-phosphate mimetics, locked nucleic acids, or at least one thereof. In some embodiments, the sense strand comprises at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, or a combination thereof. In some embodiments, the sense strand comprises at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, or a combination thereof. In some embodiments, the sense strand comprises at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, or a combination thereof. In some embodiments, the sense strand comprises at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, or a combination thereof. In some embodiments, the antisense strand comprises at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, or a combination thereof. In some embodiments, the antisense strand comprises at least one of 2'-methoxy nucleotides, 2'-fluoro nucleotides, or a combination thereof. In some embodiments, the sense strand comprises at least one locked nucleic acid. In some embodiments, the sense strand comprises at least one 2'-deoxyribonucleotide. In some embodiments, the antisense strand comprises at least one 2'-deoxyribonucleotide. In some embodiments, the sense strand comprises at least one nucleotide comprising a phosphorothioate group. In some embodiments, the antisense strand comprises at least one nucleotide comprising a phosphorothioate group. In some embodiments, the antisense strand comprises at least one nucleotide comprising a 5'-phosphate mimic. In some embodiments, the nucleotide comprising a 5'-phosphate mimic is at position 1 of the antisense strand.

[0042] In some embodiments, the nucleotides in the sense strand are selected from at least two of 2'-methoxy nucleotides, 2'-fluoro nucleotides, 2'-deoxyribonucleotides, or locked nucleic acids, and / or the nucleotides in the antisense strand are selected from at least two of 2'-methoxy nucleotides, 2'-fluoro nucleotides, 2'-deoxyribonucleotides, glycerol nucleotides, nucleotides containing 5'-phosphate, or nucleotides containing 5'-phosphate mimetics.

[0043] In some embodiments, the siRNA of the present invention comprises a modified internucleoside linkage or a modified backbone. Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate, 2'-O methoxyethyl (MOE), 2'-fluoro, alkyl phosphates, phosphorodithioates, alkyl phosphorothioates, phosphoramidates, carbamates, carbonates, phosphotriesters, acetamidates, carboxymethyl esters, and combinations thereof.

[0044] In some embodiments, the modified nucleotide is a nucleotide in which the phosphate group is modified with a phosphorothioate group, that is, a non-bridging oxygen atom in the phosphodiester bond is replaced with a sulfur atom, thereby replacing the phosphodiester bond with a phosphorothioate diester bond.

[0045] In some embodiments, the 5' end and / or 3' end of the sense strand independently comprises one or two phosphorothioate linkages; and / or the 5' end and / or 3' end of the antisense strand independently comprises one or two phosphorothioate linkages. In some embodiments, the 5' end of the sense strand independently comprises one or two phosphorothioate linkages, and the 5' end and / or 3' end of the antisense strand independently comprises one or two phosphorothioate linkages.

[0046] In some embodiments, the sense strand may include one or more blocking residues or moieties, referred to as "blocking residues." A "blocking residue" is a non-nucleotide compound or other moiety that can be incorporated into one or more ends of the nucleotide sequence of the siRNA. In some embodiments, the blocking residue is present at the 5' end, the 3' end, or both the 5' end and the 3' end of the sense strand.

[0047] In some embodiments, an inverted abasic residue (iab) is added as a capping residue. See F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16. In some embodiments, the 5' end and / or 3' end of the sense strand may contain more than one inverted abasic deoxyribose moiety as a capping residue.

[0048] In some embodiments, one or more inverted abasic residues (iab) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues (iab) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues are included near or at one or more ends of the siRNA sense strand.

[0049] Inverted abasic residues can be linked via phosphate, phosphorothioate, or other internucleoside linkages.

[0050] In some embodiments, the antisense strand of the siRNA is 21 nucleotides in length and comprises the following modification pattern:

[0051] (1) 5'-NmsNfsNmNfNmNfNmNfNmNfNmNmNmNfNmNfNmNfNmsNmsNm-3' (SEQ ID NO: 719);

[0052] (2) 5'-NmsNfsNmNmNmNfNmNfNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 720);

[0053] (3) 5'-NmsNfsNmNfNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 721);

[0054] (4) 5'-VPNmsNfsNmNfNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 728);

[0055] (5) 5'-VPNmsNfsNmNfNmN(GNA)NmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 729); or

[0056] (6) 5'-VPNmsNfsNmNfNmNmN(GNA)NmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 730);

[0057] Wherein, Nm is a methoxy-modified nucleotide, Nf is a fluorinated-modified nucleotide, s is a phosphorothioate linkage, VP represents a 5'-phosphate mimetic, and N(GNA) represents a glycerol nucleotide. The nucleotides may be selected from C, G, U, or A.

[0058] In some embodiments, the sense strand of the siRNA is 19 nucleotides in length and comprises the following modification pattern:

[0059] (1) 5'-NmsNmsNfNmNfNmNfNfNfNmNfNmNfNmNfNmNfNmNf-3' (SEQ ID NO: 722);

[0060] (2) 5'-NmsNmsNfNmNmNmNfNfNfNmNfNmNfNmNfNmNmNmNm-3' (SEQ ID NO: 723);

[0061] (3) 5'-NmsNmsNmNmNfNmNfNfN(d)NmNmNmNmNmNmNmNmNmNm-3' (SEQ ID NO: 724);

[0062] (4) 5'-N(LNA)sNmsNfNmNmNmNfNfNfNfNmNfNmNfNmNfNmNmNmNm-3' (SEQ ID NO: 725);

[0063] (5) 5'-NmsNmsNmNmNfNmNfNfNfNmNmNmNmNmNmNfNmNmNmNm-3' (SEQ ID NO: 726);

[0064] (6) 5'-NmsNmsNmNmNfNmN(d)NfN(d)NmNmNmNmNmNmNmNmNmNm-3' (SEQ ID NO: 731);

[0065] (7) 5'-NmsNmNfNmNfNmNfNfNfNmNfNmNfNmNfNmNfNmsNf-3' (SEQ ID NO: 732);

[0066] (8) 5'-NmsNmNfNmNmNmNfNfNfNmNfNmNfNmNfNmNmNmsNm-3' (SEQ ID NO: 733);

[0067] (9) 5'-NmsNmNmNmNfNmNfNfN(d)NmNmNmNmNmNmNmNmNmsNm-3' (SEQ ID NO: 734);

[0068] (10) 5'-N(LNA)sNmNfNmNmNmNfNfNfNfNmNfNmNfNmNfNmNmNmsNm-3' (SEQ ID NO: 735);

[0069] (11) 5'-NmsNmNmNmNfNmNfNfNfNmNmNmNmNmNfNmNmNmsNm-3' (SEQ ID NO: 736); or

[0070] (12) 5'-NmsNmNmNmNfNmN(d)NfN(d)NmNmNmNmNmNmNmNmNmsNm-3' (SEQ ID NO: 737);

[0071] Wherein, Nm is a methoxy-modified nucleotide, Nf is a fluorinated nucleotide, N(LNA) is a locked nucleic acid-modified nucleotide, N(d) is a 2'-deoxyribonucleotide, and s is a phosphorothioate linkage. The nucleotides can be selected from C, G, U, or A.

[0072] In some embodiments, the siRNA comprises a modification pattern selected from the group consisting of: SEQ ID NO: 719 and SEQ ID NO: 722; SEQ ID NO: 719 and SEQ ID NO: 723; SEQ ID NO: 719 and SEQ ID NO: 724; SEQ ID NO: 719 and SEQ ID NO: 725; SEQ ID NO: 719 and SEQ ID NO: 726; SEQ ID NO: 719 and SEQ ID NO: 731; SEQ ID NO: 719 and SEQ ID NO: 732; SEQ ID NO: 719 and SEQ ID NO: 733; SEQ ID NO: 719 and SEQ ID NO: 734; SEQ ID NO: 719 and SEQ ID NO: 735; SEQ ID NO: 719 and SEQ ID NO: 736; SEQ ID NO: 719 and SEQ ID NO: 737; SEQ ID NO: 720 and SEQ ID NO: 722; SEQ ID NO: 723; SEQ ID NO: 719 and SEQ ID NO: 724; SEQ ID NO: 719 and SEQ ID NO: 725; SEQ ID NO: 719 and SEQ ID NO: 726; NO:720 and SEQ ID NO:723; SEQ ID NO:720 and SEQ ID NO:724; SEQ ID NO:720 and SEQ ID NO:725; SEQ ID NO:720 and SEQ ID NO:726; SEQ ID NO:720 and SEQ ID NO:731; SEQ ID NO:720 and SEQ ID NO:732; SEQ ID NO:720 and SEQ ID NO:733; SEQ ID NO:720 and SEQ ID NO:734; SEQ ID NO:720 and SEQ ID NO:735; SEQ ID NO:720 and SEQ ID NO:736; SEQ ID NO:720 and SEQ ID NO:737; SEQ ID NO:721 and SEQ ID NO:722; SEQ ID NO:721 and SEQ ID NO:723; SEQ ID NO:721 and SEQ ID NO:724; SEQ ID NO:721 and SEQ ID NO:725; SEQ ID NO:726 NO:721 and SEQ ID NO:726; SEQ ID NO:721 and SEQ ID NO:731; SEQ ID NO:721 and SEQ ID NO:732; SEQ ID NO:721 and SEQ ID NO:733; SEQ ID NO:721 and SEQ ID NO:734;SEQ ID NO:721 and SEQ ID NO:735; SEQ ID NO:721 and SEQ ID NO:736; SEQ ID NO:721 and SEQ ID NO:737; SEQ ID NO:728 and SEQ ID NO:722; SEQ ID NO:728 and SEQ ID NO:723; SEQ ID NO:728 and SEQ ID NO:724; SEQ ID SEQ ID NO:728 and SEQ ID NO:725; SEQ ID NO:728 and SEQ ID NO:726; SEQ ID NO:728 and SEQ ID NO:731; SEQ ID NO:728 and SEQ ID NO:732; SEQ ID NO:728 and SEQ ID NO:733; SEQ ID NO:728 and SEQ ID NO:734; SEQ ID NO:728 and SEQ ID NO:735; SEQ ID NO:728 and SEQ ID NO:736; SEQ ID NO:728 and SEQ ID NO:737; SEQ ID NO:729 and SEQ ID NO:722; SEQ ID NO:729 and SEQ ID NO:723; SEQ ID NO:729 and SEQ ID NO:724; SEQ ID NO:729 and SEQ ID NO:725; SEQ ID NO:729 and SEQ ID NO:726; SEQ ID NO:729 and SEQ ID NO:731; SEQ ID NO:729 and SEQ ID NO:732; SEQ ID NO:729 and SEQ ID NO:733; SEQ ID NO:729 and SEQ ID NO:734; SEQ ID NO:729 and SEQ ID NO:735; SEQ ID NO:729 and SEQ ID NO:736; SEQ ID NO:729 and SEQ ID NO:737; SEQ ID NO:730 and SEQ ID NO:722; SEQ ID NO:730 and SEQ ID NO:723; SEQ ID NO:730 and SEQ ID NO:724; SEQ ID NO:731 NO:730 and SEQ ID NO:725; SEQ ID NO:730 and SEQ ID NO:726; SEQ ID NO:730 and SEQ ID NO:731; SEQ ID NO:730 and SEQ ID NO:732; SEQ ID NO:730 and SEQ ID NO:733;SEQ ID NO: 730 and SEQ ID NO: 734; SEQ ID NO: 730 and SEQ ID NO: 735; SEQ ID NO: 730 and SEQ ID NO: 736; SEQ ID NO: 730 and SEQ ID NO: 737.

[0073] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 329-523.

[0074] In some embodiments, the sense strand comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 524-718.

[0075] In some embodiments, the sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any duplex of GPSZT082S1 to GPSZT233S5 provided in Table 3.

[0076] In some embodiments, the antisense strand comprises SEQ ID NOs: 329-331, 333-337, 339, 341, 344-356, 360, 362-363, 365, 367-369, 371-378, 380-381, 383, 385-393, 395-396, 398-404, 407-408, 411-417, 419-420, 425-426, 428, 43 0-431, 433-434, 438, 440-441, 446-447, 450-456, 458-459, 463-470, 472-474, 476-477, 479-480, 482, 484-486, 488-498, 500, 502-513, 515-516, 518-521.

[0077] In some embodiments, the sense strand comprises SEQ ID NOs: 524-526, 528-532, 534, 536, 539-551, 555, 557-558, 560, 562-564, 566-573, 575-576, 578, 580-588, 590-591, 593-599, 602-603, 606-612, 614-615, 620-621, 623, 624-626 The nucleotide sequence shown in any one of 5-626, 628-629, 633, 635-636, 641-642, 645-651, 653-654, 658-665, 667-669, 671-672, 674-675, 677, 679-681, 683-693, 695, 697-708, 710-711, and 713-716.

[0078] In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the sense and antisense strand sequences of any one of the duplexes provided in Table 7.

[0079] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 330, 333-334, 336, 339, 341, 346-347, 352, 368-369, 372-373, 375, 378, 380, 386, 411-412, 414, 417, 419, 434, 450-451, 453, 456, 458, 463-464, 486, 489-490, 492-493, 495, 497-498, 503.

[0080] In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 525, 528-529, 531, 534, 536, 541-542, 547, 563-564, 567-568, 570, 573, 575, 581, 606-607, 609, 612, 614, 629, 645-655, 657, 660, 662, 667-668, 681, 684-685, 687-688, 690, 692-693, 698.

[0081] In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the group consisting of GPSZT086S4, GPSZT086S5, GPSZT095S1, GPSZT091S5, GPSZT095S2, GPSZT095S4, GPSZT095S5, GPSZT086S3, GPSZT091S2, GPSZT091S4, GPSZT091S3, GPSZT095S3, GPSZT089S5, GPSZT098S5, GPSZT098S3, GPSZT086S1, GPSZT091S5 ... The sense and antisense strand sequences of the duplex of any one of GPSZT06S2, GPSZT089S4, GPSZT083S5, GPSZT098S2, GPSZT098S4, GPSZT098S1, GPSZT089S2, GPSZT121S4, GPSZT082S2, GPSZT089S1, GPSZT099S5, GPSZT153S1, GPSZT122S2, GPSZT122S1, GPSZT092S5, GPSZT089S3, GPSZT083S1, GPSZT121S1, GPSZT122S4, GPSZT083S2, or GPSZT177S3.

[0082] In some embodiments, the antisense strand comprises SEQ ID NOs: 329, 335, 337, 344-345, 348-351, 474, 477, 482, 485, 491, 494, 500, 502, 504-510, 512, 516, 518-519, 521.

[0083] In some embodiments, the sense strand comprises SEQ ID NOs: 524, 530, 532, 539-540, 543-546, 548, 550-551, 555, 557, 560, 566, 569, 571-572, 576, 578, 580, 582-588, 590, 594, 596-599, 602-603, 608, 610-611, 615, 620- The nucleotide sequence shown in any one of 621, 623, 625-626, 633, 641-642, 647, 649-650, 654, 660-662, 664-665, 668-669, 672, 677, 680, 686, 689, 695, 697, 699-705, 707, 711, 713-714, and 716.

[0084] In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the group consisting of GPSZT153S4, GPSZT177S4, GPSZT128S5, GPSZT174S3, GPSZT177S1, GPSZT082S4, GPSZT099S4, GPSZT174S2, GPSZT153S2, GPSZT083S4, GPSZT092S2, GPSZT174S4, GPSZT099S2, GPSZT092S3, GPSZT094S2, GPSZT123S4, GPSZT177S5, GPSZT149S1, and GPSZT153S2. S3, GPSZT122S3, GPSZT174S1, GPSZT092S4, GPSZT177S2, GPSZT112S5, GPSZT094S5, GPSZT082S5, GPSZT123S2, GPSZT150S2, GPSZT082S1, GP SZT090S1, GPSZT094S4, GPSZT099S3, GPSZT153S5, GPSZT090S5, GPSZT090S2, GPSZT149S5, GPSZT112S1, GPSZT221S4, GPSZT092S1, GPSZT08 2S3, GPSZT174S5, GPSZT221S1, GPSZT221S3, GPSZT123S5, GPSZT094S3, GPSZT083S3, GPSZT090S3, GPSZT121S2, GPSZT128S4, GPSZT231S2, G PSZT221S5, GPSZT128S2, GPSZT123S1, GPSZT121S5, GPSZT149S4, GPSZT176S1, GPSZT090S4, GPSZT123S3, GPSZT150S5, GPSZT230S2, GPSZT1 The sense and antisense strand sequences of the duplex of any one of GPSZT75S5, GPSZT112S2, GPSZT149S1, GPSZT128S1, GPSZT120S1, GPSZT223S1, GPSZT231S1, GPSZT221S2, GPSZT223S5, GPSZT150S1, GPSZT231S5, GPSZT149S2, GPSZT191S4, GPSZT175S2, GPSZT223S2, GPSZT085S2, GPSZT153S3, GPSZT231S4, GPSZT226S2, or GPSZT226S5.

[0085] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 334-335, 339, 353, 356, 373-374, 376, 378, 392-393, 395, 408, 411, 417, 428, 431, 434, 446, 450-452, 463, 470, 472-473, 489, 498, 500, 509, 512-513, 516.

[0086] In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 529-530, 534, 548, 551, 568-569, 571, 573, 587-588, 590, 603, 606, 612, 623, 626, 629, 641, 645-647, 658, 665, 667-668, 684, 693, 695, 704, 707-708, 711.

[0087] In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the group consisting of GPSZT082S4, GPSZT083S3, GPSZT086S3, GPSZT086S4, GPSZT086S5, GPSZT089S1, GPSZT089S2, GPSZT089S4, GPSZT090S1, GPSZT090S2, GPSZT090S4, GPSZT092S2, GPSZT095S1, GPSZT095S2, GPSZT095S3, GPSZT095S4, and GPSZT095S5. The sense and antisense strand sequences of the duplex of any one of GPSZT191S5, GPSZT191S5, or GPSZT221S5 are described herein.

[0088] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 335, 339, 353, 356, 378, 392, 395, 411, 417, 431, 434, 450-451, 470, 473, 489, 500, 509, 512, and 516.

[0089] In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 530, 534, 548, 551, 573, 587, 590, 606, 612, 626, 629, 645-646, 665, 668, 684, 695, 704, 707, and 711.

[0090] In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the sense and antisense strand sequences of any duplex of GPSZT086S3, GPSZT086S4, GPSZT086S5, GPSZT089S4, GPSZT090S1, GPSZT095S1, GPSZT095S2, GPSZT095S3, GPSZT112S5, GPSZT174S1, GPSZT174S2, GPSZT174S3, GPSZT174S4, GPSZT174S5, GPSZT177S1, GPSZT177S2, GPSZT177S3, GPSZT177S4, GPSZT177S5, or GPSZT221S5 provided in Table 10.

[0091] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 335, 339, 353, 356, 378, 392, 395, 431, 450, 470, 473, 489, 509, and 512.

[0092] In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 530, 534, 548, 551, 573, 587, 590, 626, 645, 665, 668, 684, 704, and 707.

[0093] In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the sense and antisense strand sequences of any duplex of GPSZT086S4, GPSZT086S5, GPSZT090S1, GPSZT095S1, GPSZT095S2, GPSZT174S1, GPSZT174S2, GPSZT174S3, GPSZT174S4, GPSZT174S5, GPSZT177S1, GPSZT177S2, GPSZT177S4, or GPSZT177S5 provided in Table 11 or Table 12.

[0094] deliver

[0095] The siRNA of the present invention can be delivered or introduced by any means known in the art (e.g., delivered in vitro or introduced into cells, or delivered in vivo or introduced into patients). For example, to deliver in vivo, the siRNA can be injected into a tissue site, or systemically administered. In vivo delivery can also be carried out by a beta-glucan delivery system. In vitro introduction into cells includes methods known in the art, such as electroporation and lipofection.

[0096] In some embodiments, the delivery method includes, but is not limited to, viral delivery (retrovirus, adenovirus, lentivirus, baculovirus, AAV); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC); nanoparticles (cationic polymers, PEI); bacterial delivery (tkRNAi); chemical modification of siRNA (LNA) to increase stability; lipid nanoparticles (LNP); neutral liposomes (NL); polymer nanoparticles (low molecular weight polymers or high molecular weight polymers); double-stranded RNA binding motifs (dsRBMs); and other delivery systems known in the art to be suitable for nucleic acid or oligonucleotide delivery.

[0097] Conjugate

[0098] In one aspect, the present invention provides a conjugate comprising at least one siRNA of the present invention and a pharmaceutically acceptable targeting molecule. The conjugate of the present invention is obtained by coupling the siRNA of the present invention to a pharmaceutically acceptable targeting molecule, the conjugate comprising a pharmaceutically acceptable targeting molecule and an optional linker. The siRNA can be non-covalently coupled to the targeting molecule, or covalently coupled to the targeting molecule.

[0099] The pharmaceutically acceptable targeting molecule can be a targeting molecule conventionally used in the field of siRNA administration, which typically enhances the pharmacokinetic or biodistribution properties of the siRNA to which it is attached, and improves the cell-specific (or organ-specific) distribution and cell-specific (or organ-specific) uptake of the siRNA. Representative targeting molecules include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies or antibody fragments, antibody mimics, and the like. In some embodiments, the targeting molecules include but are not limited to one or more of the following targeting molecules or their derivatives: integrin family; lipophilic molecules, such as cholesterol, bile acid, vitamins (such as vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as membrane-permeable peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid (folate); or receptor ligands expressed by hepatic parenchymal cells, such as asialoglycoproteins, asialosugar residues, lipoproteins (such as high-density lipoproteins, low-density lipoproteins, etc.), glucagon, neurotransmitters (such as adrenaline), growth factors, transferrin, etc.

[0100] The linker can be a linker conventionally used in the field of siRNA administration, including but not limited to one or more of the following linkers or their derivatives: amide linker portion, amino linker portion, carbonyl linker portion, carbamate linker portion, urea linker portion, ether linker portion, disulfide linker portion, succinylamino linker portion, etc.

[0101] In some embodiments, the targeting molecule can be directly or indirectly connected to the siRNA of the present invention via a joint / linking group. In some embodiments, the targeting molecule is connected to the siRNA via an unstable, cleavable or reversible bond or joint. In some embodiments, the targeting molecule is connected to at least one end of the sense strand and / or antisense strand of the siRNA. In some embodiments, the targeting molecule is connected to the 5' end and / or 3' end of the sense strand. In some embodiments, the targeting molecule is connected to the 5' end and / or 3' end of the antisense strand.

[0102] Pharmaceutical composition

[0103] In one aspect, the present invention provides pharmaceutical compositions comprising at least one siRNA of the present invention.

[0104] In some embodiments, the pharmaceutical composition contains one siRNA as described above.

[0105] In other embodiments, the pharmaceutical composition contains at least two of the above-described siRNAs (for example, but not limited to, two, three, four, five, six, seven, eight, nine, ten or more) as active ingredients. Preferably, each of the at least two siRNAs targets a different target sequence in the lfTSLP gene (for example, the sequence shown in SEQ ID NO: 727), thereby enabling simultaneous action against different target sequences to produce a synergistic effect. Here, the so-called "different target sequences" refers to target sequences that do not overlap, or target sequences that overlap by less than five consecutive nucleotides (for example, the number of overlapping consecutive nucleotides is 4, 3, 2, 1, or 0). In this case, the at least two siRNAs described above may be present in any proportion. Preferably, the at least two siRNAs are present in a molar ratio of 1:100 to 100:1; more preferably, the at least two siRNAs are present in a molar ratio of 1:10 to 10:1, 1:5 to 5:1, or 1:2 to 2:1. In some embodiments, the at least two siRNAs are present in the same molar ratio.

[0106] In other embodiments, the pharmaceutical composition comprises at least one siRNA of the present invention and further comprises at least one siRNA targeting another target (e.g., a gene other than lfTSLP). In this case, the siRNA of the present invention and the siRNA targeting the other target can be present in any different ratios, for example, in a molar ratio of 1:100 to 100:1, for example, in a molar ratio of 1:10 to 10:1, 1:5 to 5:1, or 1:2 to 2:1, for example, in the same molar ratio.

[0107] In some embodiments, the pharmaceutical composition comprises an effective amount of siRNA. An "effective amount" refers to an amount of siRNA effective to produce the desired pharmacological, therapeutic, or preventive outcome. For example, if a given clinical treatment is considered effective when there is at least a 10% reduction in a measurable parameter associated with a disease or condition, then the therapeutically effective amount of the drug for treating that disease or condition is the amount required to achieve at least a 10% reduction in that parameter. For example, a therapeutically effective amount of an siRNA targeting lfTSLP can reduce lfTSLP mRNA levels by at least 10%.

[0108] In some embodiments, in the pharmaceutical composition described in any of the above embodiments, the siRNA can be linked to a targeting molecule to form a conjugate. Therefore, in some embodiments, the pharmaceutical composition comprises a conjugate of the present invention.

[0109] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0110] In some embodiments, the pharmaceutically acceptable carrier and / or excipient is a delivery vehicle. A delivery vehicle is a substance that improves the delivery of nucleic acids or oligonucleotides to cells or tissues. Such substances can be any delivery vehicle known in the art that is suitable for nucleic acid or oligonucleotide delivery, including but not limited to: viruses (retroviruses, adenoviruses, lentiviruses, baculoviruses, AAVs); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC); nanoparticles (cationic polymers, PEI); bacteria (tkRNAi); lipid nanoparticles (LNPs); neutral liposomes (NLs); polymer nanoparticles (low molecular weight polymers or high molecular weight polymers); double-stranded RNA binding motifs (dsRBMs), etc.

[0111] In some embodiments, the siRNA can be packaged by the delivery vehicle.

[0112] In some embodiments, the siRNA can be directly or indirectly connected to the delivery vector via a joint / connecting group. In some embodiments, the delivery vector is connected to the siRNA via an unstable, cleavable or reversible bond or joint. In some embodiments, the delivery vector is connected to at least one end of the sense strand and / or antisense strand of the siRNA. In some embodiments, the delivery vector is connected to the 5' end and / or 3' end of the sense strand. In some embodiments, the delivery vector is connected to the 5' end and / or 3' end of the antisense strand.

[0113] In some embodiments, the pharmaceutical composition comprises one siRNA provided by the present invention, and the siRNA is encapsulated by the delivery vector. The one siRNA can be encapsulated in the same delivery vector or in different delivery vectors.

[0114] In other embodiments, the pharmaceutical composition comprises at least two siRNAs provided herein (for example, but not limited to, two, three, four, five, six, seven, eight, nine, ten or more), wherein the siRNAs are encapsulated by the delivery vehicle. The at least two siRNAs may be encapsulated in the same delivery vehicle or in different delivery vehicles. Preferably, the at least two siRNAs each target a different target sequence in the lfTSLP gene.

[0115] In other embodiments, the pharmaceutical composition comprises at least one siRNA provided herein and an siRNA targeting another target (e.g., a gene other than lfTSLP), wherein the siRNA is encapsulated by the delivery vector. The siRNA provided herein and the siRNA targeting another target (e.g., a gene other than lfTSLP) can be encapsulated in the same delivery vector or in separate delivery vectors.

[0116] In some embodiments, the pharmaceutical composition of the present invention is formulated into a dosage form compatible with its intended route of administration, for example, it can be administered locally (such as direct injection or implantation), systemically, or subcutaneously, intravenously, intraperitoneally, or parenterally, including intracranial (such as intraventricular, intrameningeal, or intrathecal), intramuscularly, transdermally, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration.

[0117] In some embodiments, the pharmaceutical composition is administered by suction, intranasal administration, intratracheal administration or oropharyngeal inhalation. The active ingredient of the required amount can be mixed in a suitable solvent and then aseptically filtered to prepare a preparation suitable for inhalation administration. Generally, the preparation for inhalation administration is a sterile solution under physiological pH and has low viscosity. Salt can be added to the preparation to balance tension. In some cases, a surfactant or cosolvent can be added to increase the solubility of the active ingredient and improve aerosol properties. In some cases, an excipient can be added to control viscosity to ensure the size and distribution of the atomized droplets.

[0118] In other embodiments, the pharmaceutical composition can be administered by injection, such as intravenous, intramuscular, subcutaneous, intradermal, intraarticular, intraocular, intraperitoneal or topical administration. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the temporary preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, or phosphate buffered saline (PBS) and the like. The pharmaceutical composition should remain stable under production and storage conditions and should prevent contamination by microorganisms such as bacteria and fungi. For example, a sterile injection solution can be prepared by the following method: the active ingredient of the required dose is mixed in an appropriate solvent, and optionally, other desired ingredients (including but not limited to, pH regulators, surfactants, adjuvants, ionic strength enhancers, diluents, agents for maintaining osmotic pressure, agents for delayed absorption, preservatives, or any combination thereof) are mixed at the same time, followed by filtration sterilization. In addition, the sterile injection solution can be prepared as a sterile lyophilized powder (for example, by vacuum drying or freeze drying) for easy storage and use.

[0119] The siRNA of the present invention can be formulated in dosage unit form for ease of administration. Dosage unit form refers to physically discrete units suitable as unitary dosages for the subject to be treated; each unit contains a predetermined quantity of active ingredient calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.

[0120] In the present invention, the dosage regimen can be adjusted to obtain the best desired response (e.g., therapeutic or preventive response). For example, the dosage can be a single dose, multiple doses can be administered over a period of time, or the dosage can be proportionally reduced or increased according to the urgency of the treatment situation.

[0121] application

[0122] Inhibits lfTSLP expression

[0123] The siRNA of the present invention can be used to inhibit the expression of lfTSLP in vitro and / or in vivo. The lfTSLP refers to the long isoform TSLP, such as the mRNA with the sequence shown in Genbank: NM_033035.5.

[0124] In one aspect, the present invention provides a method for inhibiting lfTSLP expression in a cell, comprising introducing into the cell an siRNA, conjugate, or pharmaceutical composition of the present invention. In some embodiments, the method is performed in vitro. The siRNA of the present invention can be introduced by any nucleic acid delivery method known in the art, such as electroporation or lipofection.

[0125] The term "inhibits expression of lfTSLP" refers to at least partial suppression of lfTSLP gene expression, which can be manifested as a decrease in the amount of detectable lfTSLP mRNA. For example, the degree of inhibition can be expressed as: (mRNA in control cells) - (mRNA in treated cells) / (mRNA in control cells) * 100%. Alternatively, the degree of inhibition can be given as a decrease in a parameter functionally associated with lfTSLP gene expression, such as the amount of protein encoded by the lfTSLP gene. In principle, lfTSLP gene silencing can be measured in any cell expressing lfTSLP (constitutively or through genetic engineering) and by any suitable assay. Measurements can be made at multiple time points, before, during, and after administration of the siRNA, to determine the effect of the siRNA. lfTSLP levels or expression can be measured by evaluating mRNA (e.g., by Northern blot or PCR) or protein (e.g., by Western blot or ELISA). For example, the effect of the siRNA on lfTSLP expression can be determined by measuring the transcription rate of the lfTSLP gene (e.g., by RT-PCR). For example, the effect of siRNA on lfTSLP expression can be determined by measuring the expression level of a reporter gene (eg, luciferase) fused to the lfTSLP gene.

[0126] In some embodiments, the expression of the lfTSLP gene is suppressed by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administering the siRNA of the present invention. In some embodiments, the expression of the lfTSLP gene is suppressed by at least about 60%, 70%, or 80% by administering the siRNA of the present invention. In some embodiments, the expression of the lfTSLP gene is suppressed by at least about 85% by administering the siRNA of the present invention. In some embodiments, the expression of the lfTSLP gene is suppressed by at least about 90% by administering the siRNA of the present invention. In some embodiments, the expression of the lfTSLP gene is suppressed by at least about 95% by administering the siRNA of the present invention. In some embodiments, the expression of the lfTSLP gene is suppressed by at least about 96%, 97%, 98%, 99%, or 100% by administering the siRNA of the present invention.

[0127] In some embodiments, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (eg, siRNA targeting a different target sequence in the lfTSLP gene or siRNA targeting other targets).

[0128] In some embodiments, a single siRNA provided herein is used. The siRNA is optionally packaged in a delivery vehicle. In some embodiments, the single siRNA is packaged in the same delivery vehicle. In other embodiments, the single siRNA is packaged in separate delivery vehicles.

[0129] In other embodiments, at least two siRNAs provided herein (for example, but not limited to, two, three, four, five, six, seven, eight, nine, ten or more) are used, preferably each of the at least two siRNAs targets a different target sequence in the lfTSLP gene. The at least two siRNAs are optionally packaged in a delivery vehicle. In some embodiments, the at least two siRNAs are packaged in the same delivery vehicle. In other embodiments, the at least two siRNAs are packaged in different delivery vehicles.

[0130] In other embodiments, at least one siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than lfTSLP) are used. The siRNA provided by the present invention and the siRNA targeting other targets (e.g., other genes other than lfTSLP) are optionally packaged by a delivery vector. In some embodiments, the siRNA provided by the present invention and the siRNA targeting other targets (e.g., other genes other than lfTSLP) are packaged in the same delivery vector. In other embodiments, the siRNA provided by the present invention and the siRNA targeting other targets (e.g., other genes other than lfTSLP) are respectively packaged in different delivery vectors.

[0131] In some embodiments, the siRNA of the present invention inhibits the expression of lfTSLP and does not affect the expression of short isoform TSLP (sfTSLP).

[0132] Treatment of lfTSLP-related diseases

[0133] The siRNAs of the present invention can be used to treat diseases or conditions that would benefit from reduced levels or inhibition of expression of lfTSLP.

[0134] In one aspect, the present invention provides a method for preventing and / or treating a disease associated with lfTSLP in a subject, the method comprising administering to a subject in need thereof an effective amount of an siRNA, conjugate, or pharmaceutical composition of the present invention. The present invention also relates to the use of an siRNA, conjugate, or pharmaceutical composition of the present invention in the preparation of a medicament for treating and / or preventing a disease associated with lfTSLP.

[0135] In some embodiments, the lfTSLP-related disease involves lfTSLP overexpression. lfTSLP overexpression refers to lfTSLP levels (e.g., lfTSLP levels present in plasma or tissues of a subject, and preferably in damaged tissues) that are higher than normal lfTSLP levels (e.g., corresponding levels in healthy controls).

[0136] In some embodiments, the disease associated with lfTSLP would benefit from reduced levels or inhibition of expression of lfTSLP.

[0137] In some embodiments, the disease associated with lfTSLP is an inflammatory disease, such as an inflammatory respiratory disease, an inflammatory digestive disease, or an inflammatory skin disease.

[0138] In some embodiments, the disease associated with lfTSLP is asthma, nasal polyps, allergic rhinitis, chronic sinusitis, atopic dermatitis, eosinophilic esophagitis, chronic obstructive pulmonary disease, or idiopathic pulmonary fibrosis.

[0139] In some embodiments, if lfTSLP expression is elevated for a particular disease, treatment with an siRNA of the invention can reduce the level or expression of lfTSLP to a level that is within the range considered normal for individuals without such a disorder.

[0140] In some embodiments, the subject is a mammal, such as a human.

[0141] In some embodiments, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (e.g., siRNA targeting a different target sequence in the lfTSLP gene or siRNA targeting other targets), for example, administered simultaneously or sequentially.

[0142] In some embodiments, a single siRNA provided herein is used. The siRNA is optionally packaged in a delivery vehicle. In some embodiments, the single siRNA is packaged in the same delivery vehicle. In other embodiments, the single siRNA is packaged in separate delivery vehicles.

[0143] In other embodiments, at least two siRNAs provided herein (for example, but not limited to, two, three, four, five, six, seven, eight, nine, ten or more) are used, preferably each of the at least two siRNAs targets a different target sequence in the lfTSLP gene. The at least two siRNAs are optionally packaged in a delivery vehicle. In some embodiments, the at least two siRNAs are packaged in the same delivery vehicle. In other embodiments, the at least two siRNAs are packaged in different delivery vehicles.

[0144] In other embodiments, at least one siRNA provided by the present invention and siRNA targeting other targets (e.g., other genes other than lfTSLP) are used. The siRNA provided by the present invention and the siRNA targeting other targets (e.g., other genes other than lfTSLP) are optionally packaged by a delivery vector. In some embodiments, the siRNA provided by the present invention and the siRNA targeting other targets (e.g., other genes other than lfTSLP) are packaged in the same delivery vector. In other embodiments, the siRNA provided by the present invention and the siRNA targeting other targets (e.g., other genes other than lfTSLP) are respectively packaged in different delivery vectors.

[0145] Definition of terms

[0146] In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. At the same time, in order to better understand the present invention, the definitions and explanations of relevant terms are provided below.

[0147] As used herein, lfTSLP mRNA refers to long isoform TSLP (lfTSLP) mRNA. The long isoform TSLP (lfTSLP) mRNA sequence is well known to those skilled in the art, for example, see the mRNA sequence shown in Genbank Accession No. NM_033035.5. Furthermore, unless otherwise specified, the term "target gene" as used herein refers to a gene that can transcribe the aforementioned lfTSLP mRNA, the term "target mRNA" refers to the aforementioned lfTSLP mRNA, and the term "inhibiting the lfTSLP gene" refers to inhibiting the expression of lfTSLP.

[0148] Herein, short-chain TSLP (sfTSLP) mRNA is well known to those skilled in the art, for example, see the mRNA having the sequence shown in Genbank Accession No. NM_138551.5.

[0149] In this article, the capital letters C, G, U, A, and T represent the base composition of the nucleotide, including modified or unmodified nucleotides; the lowercase letter m indicates that the nucleotide adjacent to the left of the letter m is a methoxy-modified nucleotide; the lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a fluorine-modified nucleotide; (LNA) indicates that the nucleotide adjacent to the left of (LNA) is a locked nucleic acid-modified nucleotide; (d) indicates that the nucleotide adjacent to the left of (d) is a 2'-deoxyribonucleotide; the lowercase letter s indicates that the two nucleotides adjacent to the left and right of the letter s are connected by a thiophosphate group; VP indicates that the nucleotide adjacent to the right of VP is a phosphate mimetic at the 5' position; and (GNA) indicates that the nucleotide adjacent to the left of (GNA) is a glycerol nucleotide.

[0150] As used herein, the term "modified nucleotide" refers to a nucleotide independently having a modified ribose moiety, a modified internucleoside bond, or a modified base. Thus, the term "modified nucleotide" encompasses substitutions, additions, or removals (e.g., using functional groups or atoms) of internucleoside bonds, ribose moieties, or bases. Modifications suitable for use in the present invention include all types of modifications disclosed herein or known in the art. "Methoxy-modified nucleotides" refer to nucleotides in which the 2'-hydroxyl group of the ribose group of a nucleotide is replaced by a methoxy group. "Fluoro-modified nucleotides" refer to nucleotides in which the 2'-hydroxyl group of the ribose group of a nucleotide is replaced by a fluorine group. "Nucleotide analogs" refer to groups that can replace nucleotides in nucleic acids but have a structure different from adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides, or thymine deoxyribonucleotides. Such as isonucleotides, bridged nucleic acids (BNAs), or acyclic nucleotides.

[0151] Among them, the structure of the fluorinated modified nucleotide is as follows:

[0152] The structure of a methoxy-modified nucleotide is shown below:

[0153] The nucleotide structure of the locked nucleic acid modification is shown below:

[0154] The structure of a 2'-methoxyethyl modified nucleotide is shown below:

[0155] The nucleotide structure of the 5'-phosphate mimetic is shown below:

[0156] The structure of glycerol nucleotide (GNA) is shown below:

[0157] The structure of Unlocked Nucleic Acid (UNA) is shown below:

[0158] As used herein, the term "siRNA" refers to an RNA molecule that is capable of sequence-specifically inducing RNAi, is composed of a sense strand and an antisense strand, and has a partially or completely complementary double-stranded structure. In the siRNA of the present invention, the length of the complementary double-stranded structure can be 14 to 30 base pairs, for example, 14, 15, 16, 17, 18, 19, 20, or 21 base pairs, for example, 14 to 19 base pairs. In some embodiments of the present invention, the siRNA may also contain modified nucleotides as needed, and the modified nucleotides do not significantly weaken or lose the function of the siRNA in inhibiting lfTSLP gene expression. Currently, there are many methods in the art that can be used to modify siRNA, including, for example, backbone modification (such as phosphate group modification), ribose group modification, and base modification (Watts, JK, GF Deleavey, and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008. 13(19-20): p. 842-55).

[0159] The term "antisense strand" includes a region that is substantially complementary to the target sequence. The term "sense strand" as used herein refers to a strand that is substantially complementary to a region of the antisense strand. The term "region of complementarity" refers to a region on the antisense strand that is substantially complementary to the lfTSLP mRNA or a region on the sense strand that is substantially complementary to the antisense strand. When the region of complementarity is not completely complementary to the target sequence, mismatches may occur in the interior or terminal regions of the molecule. Typically, the most tolerated mismatches are in the terminal regions, for example, within 5, 4, 3, 2, or 1 nucleotides of the 5' and / or 3' termini.

[0160] As used herein, unless otherwise specified, the term "complementary" refers to the ability of an oligonucleotide of a first sequence to hybridize with an oligonucleotide of a second sequence under certain conditions and form a double-stranded structure. "At least partially complementary" means that the two sequences can be completely complementary, or generally have no more than 6, 5, 4, 3, 2, or 1 mismatched base pairings, while retaining the ability to hybridize under relevant conditions. In addition, when two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should not be considered mismatches for the purpose of determining complementarity. As used herein, when the above hybridization ability requirements are met, "complementary" sequences may also include or be completely formed from non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairing or Hoogstein base pairing. Correspondingly, in this document, unless otherwise specified, "mismatch" means that the bases at corresponding positions in the siRNA duplex molecule are not paired in a complementary form.

[0161] Those skilled in the art will be able to determine the most appropriate conditions for testing the complementarity of two sequences based on the intended use of the hybridized nucleotides. Such conditions may, for example, be stringent conditions, such as 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours, followed by washing. Other conditions, such as physiologically relevant conditions encountered in vivo, may also be used.

[0162] As used herein, unless otherwise specified, "nucleotide sequence differences" refer to changes in the base type of the nucleotides at the same or corresponding positions compared to the original nucleotide sequence. For example, if one nucleotide base in the original nucleotide sequence is A, and the nucleotide base at the same or corresponding position is changed to U, C, G, or dT, dC, dG, etc., a nucleotide sequence difference is considered to exist at that position. It should be noted that if the nucleotides at the same or corresponding positions differ only in the presence or type of modification compared to the original nucleotide sequence, a nucleotide sequence difference is not considered to exist at that position.

[0163] In this article, if not otherwise specified, the term "pharmaceutically acceptable carrier and / or excipient" refers to a carrier, delivery vehicle, diluent, adjuvant and / or the salt / ester / hydrate thereof formed, etc., which are usually chemically or physically compatible with other ingredients (such as siRNA of the present invention) constituting a certain pharmaceutical dosage form, and are physiologically compatible with the subject. "Pharmaceutically acceptable carrier and / or excipient" does not play or is not intended to play a therapeutic effect at the expected dose. Such ingredients can play the following roles: a) help the processing of the drug delivery system during manufacturing, b) protect, support or enhance the stability, bioavailability or patient acceptability of the active ingredient, c) assist product identification, and / or d) enhance the overall safety, effectiveness, delivery, etc. of the active ingredient during storage and use. For example, the siRNA of the present invention can be wrapped by a delivery vehicle. "Pharmaceutically acceptable carriers and / or excipients" include, but are not limited to, viruses, liposomes, nanoparticles, bacteria, lipid nanoparticles (LNPs), neutral liposomes (NLs), polymer nanoparticles, double-stranded RNA binding motifs (dsRBMs), pH adjusters, surfactants, adjuvants, ionic strength enhancers, diluents, agents for maintaining osmotic pressure, agents for delaying absorption, and preservatives. For example, viruses include, but are not limited to, retroviruses, adenoviruses, lentiviruses, baculoviruses, and AAVs. Liposomes include, but are not limited to, lipofectamine, cationic DOTAP, and neutral DOPC. Nanoparticles include, but are not limited to, cationic polymers and PEI. Bacteria include, but are not limited to, tkRNAi. Polymeric nanoparticles include, but are not limited to, low molecular weight polymers or high molecular weight polymers. For example, pH adjusters include, but are not limited to, phosphate buffers. Surfactants include, but are not limited to, cationic, anionic, or nonionic surfactants, such as Tween-80. Ionic strength enhancers include, but are not limited to, sodium chloride. Preservatives include, but are not limited to, various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and the like. Agents that maintain osmotic pressure include, but are not limited to, sugars, NaCl, and the like. Agents that delay absorption include, but are not limited to, monostearate and gelatin. Diluents include, but are not limited to, water, aqueous buffers (e.g., buffered saline), alcohols, and polyols (e.g., glycerol).

[0164] As used herein, unless otherwise specified, the term "inhibit" refers to the down-regulation of target gene expression due to siRNA-mediated degradation of target gene mRNA. "Down-regulation" refers to a decrease in target gene expression by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% or more, or even 100%, relative to the absence of siRNA treatment. A 100% decrease in target gene expression refers to the absence of detectable target gene expression.

[0165] In this article, the term "overhang" or "nucleotide overhang" refers to at least one unpaired nucleotide protruding from the siRNA duplex structure. For example, when the 3' end of one chain of the siRNA extends beyond the 5' end of the other chain (or vice versa), there is an overhang. The siRNA may include an overhang of at least one nucleotide, or the overhang may include at least 2nt, at least 3nt, at least 4nt, at least 5nt or more. The overhang may include nucleotide / nucleoside analogs, or be composed of nucleotide / nucleoside analogs, and the nucleotide / nucleoside analogs include deoxyribonucleotides / nucleosides. The overhang may be on the sense strand, the antisense strand, or any combination thereof. The nucleotides of the overhang may be present on the 5' end, the 3' end, or both ends of the antisense strand or the sense strand of the siRNA. Accordingly, the term "blunt end" refers to the absence of a nucleotide overhang.

[0166] As used herein, the term "prevention" refers to a method implemented to prevent or delay the occurrence of a disease, condition, or symptom in a subject; and the term "treatment" refers to a method implemented to obtain a beneficial or desired clinical outcome. For the purposes of the present invention, beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms, reduction in the extent of the disease, stabilization (i.e., no longer worsening) of the state of the disease, delaying or slowing the progression of the disease, improvement or alleviation of the state of the disease, and relief of symptoms (whether partial or complete), whether detectable or undetectable. In addition, "treatment" may also refer to prolonging survival compared to the expected survival if not receiving treatment.

[0167] As used herein, the term "effective amount" refers to an amount sufficient to achieve, or at least partially achieve, a desired effect. For example, a prophylactic effective amount is an amount sufficient to prevent, arrest, or delay the onset of a disease; a therapeutic effective amount is an amount sufficient to cure or at least partially arrest the disease and its complications in a patient already suffering from the disease. Determining such an effective amount is well within the capabilities of those skilled in the art. For example, an effective amount for therapeutic use will depend on the severity of the disease being treated, the overall state of the patient's own immune system, the patient's general condition such as age, weight, and sex, the mode of administration of the drug, and any other concurrently administered therapies.

[0168] Advantageous Effects of the Invention

[0169] The siRNA of the present invention can effectively inhibit lfTSLP gene expression in vitro and / or in vivo, and in particular can specifically target the long TSLP isoform with pro-inflammatory activity, inhibiting the expression of the long TSLP isoform mRNA or protein without affecting the expression of the short TSLP isoform with anti-inflammatory activity, and has good stability. Therefore, the siRNA of the present invention can be used to treat diseases or conditions that benefit from reduced lfTSLP levels or suppressed expression, and has important clinical value in the treatment of lfTSLP-related diseases.

[0170] Below in conjunction with embodiment, embodiment of the present invention is described in detail, but those skilled in the art will understand that the following examples are only used to illustrate the present invention, rather than to limit the scope of the invention. According to the following detailed description of preferred embodiments, various objects and advantages of the present invention will become implementable to those skilled in the art. DETAILED DESCRIPTION

[0171] The invention will now be described in the following non-limiting examples.

[0172] Those skilled in the art will appreciate that the examples are provided to illustrate the present invention by way of example and are not intended to limit the scope of the invention. The experimental methods in the examples are conventional methods unless otherwise specified. Where specific conditions are not specified in the examples, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. Where the manufacturer of the reagents or instruments is not specified, they are all commercially available conventional products.

[0173] It is known to those skilled in the art that the siRNA of the present invention can be obtained by conventional siRNA preparation methods in the art (e.g., solid phase synthesis and liquid phase synthesis), wherein both solid phase synthesis and liquid phase synthesis are commercially available. It is also clear to those skilled in the art that modified nucleotide groups can be introduced into the siRNA of the present invention by using nucleotide monomers with corresponding modifications. Methods for preparing nucleotide monomers with corresponding modifications are well known to those skilled in the art, and commercial monomers are also available on the market.

[0174] Preparation Example 1: Synthesis of unmodified siRNA

[0175] This preparation example provides a siRNA for inhibiting lfTSLP expression. The nucleotide sequence of the siRNA is designed based on the target mRNA, as shown in Table 1.

[0176] Table 1: siRNA sequences

[0177] Preparation Example 2: Synthesis of modified siRNA

[0178] This preparation example provides a modified siRNA for inhibiting lfTSLP expression. The modification pattern of the siRNA is shown in Table 2, and the modified siRNA sequence is shown in Table 3.

[0179] Modification instructions:

[0180] In Table 2-3, Nm is a methoxy-modified nucleotide, Nf is a fluorinated-modified nucleotide, N(LNA) is a locked nucleic acid-modified nucleotide, N(d) is a 2'-deoxyribonucleotide, s is a phosphorothioate linkage, VP represents a 5'-phosphate mimetic, and N(GNA) represents a glycerol nucleotide.

[0181] The sequence name suffixes S1, S2, S3, S4, and S5 in Table 3 represent different modification methods, which are described as follows:

[0182] S1 represents the sense strand modification pattern SEQ ID NO: 722 + the antisense strand modification pattern SEQ ID NO: 719. The sense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 2 and 3 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 4, 6, 10, 12, 14, 16, and 18 are methoxy-modified nucleotides; the nucleotides at positions 3, 5, 7, 8, 9, 11, 13, 15, 17, and 19 are fluorinated-modified nucleotides; and the antisense strand comprises the following chemical modifications: : From the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 4, 6, 8, 10, 14, 16, and 18 are fluorine-modified nucleotides.

[0183] S2 represents the sense strand modification pattern SEQ ID NO: 723 + antisense strand modification pattern SEQ ID NO: 720. The sense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 2 and 3 are linked by thiophosphate groups; the nucleotides at positions 1, 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides; and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated nucleotides; the antisense strand includes the following chemical modifications: : From the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 8, 14, and 16 are fluorine-modified nucleotides.

[0184] S3 represents the sense strand modification pattern SEQ ID NO: 724 + antisense strand modification pattern SEQ ID NO: 721. The sense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 2 and 3 are linked by thiophosphate groups; the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxy-modified nucleotides; the nucleotides at positions 5, 7, and 8 are fluorinated-modified nucleotides; and the nucleotide at position 9 is a deoxyribonucleotide; the antisense strand includes The chemical modifications include the following: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 4, 6, 14, and 16 are fluorine-modified nucleotides.

[0185] S4 represents the sense strand modification pattern SEQ ID NO: 725 + antisense strand modification pattern SEQ ID NO: 720. The sense strand includes the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 2 and 3 are linked by thiophosphate groups, the nucleotide at position 1 is a locked nucleic acid modified nucleotide, the nucleotides at positions 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy modified nucleotides, and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated modified nucleotides; the antisense strand includes The chemical modifications include the following: in the direction from the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 8, 14, and 16 are fluorine-modified nucleotides.

[0186] S5 represents the sense strand modification pattern SEQ ID NO: 726 + the antisense strand modification pattern SEQ ID NO: 720. The sense strand comprises the following chemical modifications: from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 2 and 3 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides; and the nucleotides at positions 5, 7, 8, 9, and 15 are fluorinated nucleotides; the antisense strand comprises the following chemical modifications: : From the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by thiophosphate groups, the nucleotides at positions 1, 3, 4, 5, 7, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 6, 8, 14, and 16 are fluorine-modified nucleotides.

[0187] Antisense strand modification pattern 4 (SEQ ID NO: 728) indicates that, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by phosphorothioate groups, the nucleotide at position 1 is a methoxy-modified nucleotide comprising a 5'-phosphate mimetic, the nucleotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, and the nucleotides at positions 2, 4, 6, 14, and 16 are fluorinated-modified nucleotides.

[0188] Antisense strand modification pattern 5 (SEQ ID NO: 729) indicates that, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by phosphorothioate groups, the nucleotide at position 1 is a methoxy-modified nucleotide comprising a 5'-phosphate mimetic, the nucleotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 2, 4, 14, and 16 are fluorinated-modified nucleotides, and the nucleotide at position 6 is a glycerol nucleotide.

[0189] Antisense strand modification pattern 6 (SEQ ID NO: 730) indicates that, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, positions 2 and 3, positions 19 and 20, and positions 20 and 21 are linked by phosphorothioate groups, the nucleotide at position 1 is a methoxy-modified nucleotide comprising a 5'-phosphate mimetic, the nucleotides at positions 3, 5, 6, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19, 20, and 21 are methoxy-modified nucleotides, the nucleotides at positions 2, 4, 14, and 16 are fluorinated-modified nucleotides, and the nucleotide at position 7 is a glycerol nucleotide.

[0190] Sense strand modification pattern 6 (SEQ ID NO: 731) indicates that, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 2 and 3 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxy-modified nucleotides; the nucleotides at positions 5 and 8 are fluorinated-modified nucleotides; and the nucleotides at positions 7 and 9 are 2'-deoxyribonucleotides.

[0191] Sense strand modification pattern 7 (SEQ ID NO: 732) indicates that, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 4, 6, 10, 12, 14, 16, and 18 are methoxy-modified nucleotides; and the nucleotides at positions 3, 5, 7, 8, 9, 11, 13, 15, 17, and 19 are fluorine-modified nucleotides.

[0192] Sense strand modification pattern 8 (SEQ ID NO: 733) indicates that, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides; and the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated-modified nucleotides.

[0193] Sense strand modification pattern 9 (SEQ ID NO: 734) indicates that, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and 18 and 19 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxy-modified nucleotides; the nucleotides at positions 5, 7, and 8 are fluorinated-modified nucleotides; and the nucleotide at position 9 is a 2'-deoxyribonucleotide.

[0194] Sense strand modification pattern 10 (SEQ ID NO: 735) indicates that, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by phosphorothioate groups; the nucleotides at positions 2, 4, 5, 6, 10, 12, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides; the nucleotides at positions 3, 7, 8, 9, 11, 13, and 15 are fluorinated-modified nucleotides; and the nucleotide at position 1 is a locked nucleic acid-modified nucleotide.

[0195] Sense strand modification pattern 11 (SEQ ID NO: 736) indicates that, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 16, 17, 18, and 19 are methoxy-modified nucleotides; and the nucleotides at positions 5, 7, 8, 9, and 15 are fluorinated-modified nucleotides.

[0196] Sense strand modification pattern 12 (SEQ ID NO: 737) indicates that, from the 5' end to the 3' end, the nucleotides at positions 1 and 2, and positions 18 and 19 are linked by phosphorothioate groups; the nucleotides at positions 1, 2, 3, 4, 6, 10, 11, 12, 13, 14, 15, 16, 17, 18, and 19 are methoxy-modified nucleotides; the nucleotides at positions 5 and 8 are fluorinated-modified nucleotides; and the nucleotides at positions 7 and 9 are 2'-deoxyribonucleotides.

[0197] Table 2: Modification patterns of siRNA

[0198] Table 3: Modified siRNA sequences

[0199] The experimental cells involved in the following examples are 293T cells, which were purchased from the Cell Bank of the Chinese Academy of Sciences.

[0200] Example 1: On-target activity detection of unmodified siRNA for inhibition of lfTSLP

[0201] This example provides an on-target activity detection experiment for unmodified siRNA used to inhibit lfTSLP. A plasmid vector was constructed using the psiCHECK2 vector for detection. The psiCHECK2 vector is a plasmid vector that can monitor changes in the expression of a target gene fused to a reporter gene. The vector uses Renilla luciferase as the primary reporter gene. The target fragment is cloned into the multiple cloning site downstream of the translation stop codon of Renilla luciferase. The RNAi process against the target gene triggered by the synthetic siRNA leads to the cleavage and subsequent degradation of the fusion mRNA. By detecting changes in Renilla luciferase activity, it can be determined whether the siRNA and the target gene fragment have a targeting relationship. The experimental process is as follows:

[0202] (1) Construction of detection plasmid TSLP-psiCHECK2

[0203] Using psiCHECK TM -2(Promega TM ) plasmid construction detection plasmid, the detection plasmid contains the following insert sequence, the insert sequence is derived from the mRNA sequence shown in Genbank accession number NM_033035.5, a single copy of the insert sequence is cloned into psiCHECK TM -2 plasmid Xho I / Not I site to obtain the detection plasmid TSLP-psiCHECK2;

[0204] Insert sequence: 5'-gtttctttcaggaaaatcttcatcttacaacttgtagggctggtgttaacttacgacttcactaactgtgactttgagaagattaaagca gcctatctcagtactatttctaaagacctgattacatatatgagtgggaccaaaagtaccgagttcaacaacaccgtctcttgtagcaatcg-3'(SEQ ID NO:727).

[0205] (2) Cell culture and transfection

[0206] In a 96-well plate, 12.5 μl of Opti-MEM containing 20 ng of TSLP-psiCHECK2 detection plasmid and 32.5 μl of Opti-MEM plus 0.3 μl of Lipofectamine 2000 (purchased from Invitrogen, cat. no. 11668-019) were added to each well of 5 μl siRNA and incubated at room temperature for 15 minutes. Then, 50 μl of 1×10 4293T cells were cultured in complete DMEM medium (purchased from Transgen Biotech, catalog number FI101-01) at 37°C for 24 hours for subsequent dual-luciferase assays. The assay was performed at a final siRNA concentration of 1 nM.

[0207] (3) Dual luciferase assay

[0208] The 5× lysis buffer in the dual luciferase assay kit (purchased from Promega, catalog number E2940) was diluted with water to 1× lysis buffer. The cells obtained by culturing in step (2) were discarded, and each well was diluted and washed twice with PBS buffer (purchased from Hyclone, catalog number SH30256.01). 50 μL / well of 1× lysis buffer was added to each cell plate, and lysis was carried out at room temperature for 20 minutes to obtain a lysed cell plate; 30 μL / well of lysis buffer was aspirated from the lysed cell plate and added to an opaque 96-well detection plate. The dual luciferase assay kit was taken and two substrates were prepared according to the instructions. The two substrates were added to new 96-well plates, and 30 μL / well of substrate 1 and substrate 2 were added respectively. After each addition of substrate, the assay was performed using a multifunctional microplate reader to obtain the numerical results of firefly luciferase and Renilla luciferase, respectively.

[0209] The luminescence ratio of each well on the ELISA plate was calculated as Renilla / Firefly. The luminescence ratio of each test or control group was the average of the luminescence ratios of three culture wells. The luminescence ratio of each test group was normalized to the luminescence ratio of the control group. The ratio R (luminescence ratio (test) / luminescence ratio (control)) was calculated to represent the expression level of the Renilla reporter gene, i.e., the relative residual activity. The inhibition rate of siRNA was (1-R) ​​× 100%, where MOCK was a blank control group containing only transfection reagent and plasmid.

[0210] The on-target activity results are shown in Table 4 below, which show that these duplexes have inhibitory activity against lfTSLP expression.

[0211] Table 4: On-target activity detection of unmodified siRNA

[0212] Example 2: On-target activity detection of unmodified siRNA for inhibition of lfTSLP

[0213] The sequences with the highest inhibitory rates in Example 1 were tested for on-target activity at final siRNA concentrations of 0.01 nM, 0.1 nM, and 1 nM. The assay method used was the same as in Example 1, differing in the final siRNA concentrations. MOCK served as a blank control group, containing only the transfection reagent and plasmid. The results are shown in Table 5 below, demonstrating that these duplexes exhibited significant inhibitory activity against lfTSLP expression at various concentrations.

[0214] Table 5: On-target activity detection of unmodified siRNA at different concentrations

[0215] Example 3: On-target activity detection of modified siRNA for inhibition of lfTSLP

[0216] siRNA sequences with high inhibitory rates from Examples 1 and 2 were chemically modified. The specific sequences are shown in Table 3. On-target activity was tested at a final siRNA concentration of 1 nM. The experimental method used was the same as that used in Example 1, except that the siRNAs were different. MOCK was a blank control group containing only the transfection reagent and plasmid. The test results are shown in Table 6 below, demonstrating that the chemically modified duplexes exhibited significant inhibitory activity against lfTSLP expression.

[0217] Table 6: On-target activity detection of modified siRNA

[0218] Example 4: On-target activity detection of modified siRNA for inhibition of lfTSLP

[0219] The sequences with the highest inhibitory rates in Example 3 were tested for on-target activity at final siRNA concentrations of 0.01 nM, 0.1 nM, and 1 nM. The experimental method used was the same as that used in Example 1, except that the siRNAs used and their final concentrations were different. MOCK served as a blank control group containing only the transfection reagent and plasmid. The test results are shown in Table 7 below, demonstrating that the chemically modified duplexes exhibited significant inhibitory activity against lfTSLP expression at various concentrations.

[0220] Table 7: On-target activity detection of modified siRNA at different concentrations

[0221] Example 5: Activity detection of modified siRNA in stably transfected cell line hTSLP-A549

[0222] Genemax was commissioned to construct a stably transfected cell line hTSLP-A549 that overexpressed human TSLP protein (human TSLP sequence gene number is NM_033035.5) in the A549 cell line through lentiviral infection. The stably transfected cell line was cultured using F12K complete medium.

[0223] siRNAs were transfected into hTSLP-A549 cells using lipofectamine RNAiMAX (purchased from Invitrogen) at final siRNA concentrations of 1 nM, 0.1 nM, and 0.01 nM, respectively. Each siRNA was transfected in triplicate wells. Experiments were performed in triplicate. A MOCK control group was also established, consisting of cells treated with lipofectamine RNAiMAX alone without any siRNA.

[0224] The relative inhibition level of the siRNA compound of the present invention on human TSLP mRNA in the stably transfected cell line hTSLP-A549 was determined by real-time fluorescence quantitative PCR (qPCR).

[0225] The specific steps are as follows: a total RNA extraction kit (purchased from Suzhou GeneGene Co., Ltd., product number E31008) was used to extract total RNA from the cells in each well according to the method described in the kit instructions.

[0226] 5 μl of each RNA-containing solution was used as a template for real-time quantitative PCR using the HiScript II U+ One Step qRT-PCR Probe Kit (purchased from Nanjing Novozymes Biotechnology Co., Ltd., Cat. No. Q222-CN-00). During amplification, the probe luminescence signals for the target gene TSLP and the internal reference gene GAPDH were collected using a real-time quantitative PCR instrument to obtain Ct values ​​for the target gene TSLP and the internal reference gene GAPDH.

[0227] Detection primer sequence

[0228] lfTSLP-FO1 5'-3':ATATGAGTGGGACCAAAAGTAC (SEQ ID NO:738);

[0229] lfTSLP-RE1 5'-3':TGCCTGAGTAGCATTTATCTG (SEQ ID NO:739);

[0230] HEX-lfTSLP-P1 5'-3':CGTCTCTTGTAGCAATCGGC (SEQ ID NO:740);

[0231] hGAPDH-FO1 5'-3': CATGAGAAGTATGACAACAGCCT (SEQ ID NO:741);

[0232] hGAPDH-RE1 5'-3': AGTCCTTCCACGATACCAAAGT (SEQ ID NO:742);

[0233] FAM-hGAPDH 5'-3':CAATGCCTCCTGCACCACCAA (SEQ ID NO:743);

[0234] The comparative Ct (ΔΔCt) method was used to calculate the relative quantitative expression of the target gene TSLP in each test group and the control group. The calculation method is as follows:

[0235] ΔCt(test group) = Ct(test group target gene) – Ct(test group reference gene)

[0236] ΔCt(control group) = Ct(control group target gene) – Ct(control group internal reference gene)

[0237] ΔΔCt(test group)=ΔCt(test group)-ΔCt(control group average)

[0238] ΔΔCt(control group) = ΔCt(control group) - ΔCt(control group average)

[0239] Each test group consisted of hTSLP-A549 cells treated with each siRNA, while the control group consisted of hTSLP-A549 cells without siRNA treatment. ΔCt (control group average) is the arithmetic mean of the ΔCt (control group) values ​​for each of the three control group wells. Thus, each well in the test and control groups corresponds to a single ΔΔCt value.

[0240] The expression level of TSLP mRNA in the test group was normalized with the control group as the benchmark, and the expression level of TSLP mRNA in the control group was defined as 100%.

[0241] The relative expression level of TSLP mRNA in the test group = 2 - ΔΔCt (test group) × 100%.

[0242] For the same test group siRNA, the average relative expression level of TSLP mRNA in the test group at each concentration is the arithmetic mean of the relative expression levels of three culture wells at that concentration.

[0243] The inhibition rate of siRNA on TSLP mRNA expression was calculated according to the following equation: inhibition rate = (1-relative expression level of TSLP mRNA in the test group) × 100%.

[0244] The results of transfection with the above siRNA at final concentrations of 1 nM, 0.1 nM, and 0.01 nM are shown in Table 8 below. The results show that the chemically modified duplex has good inhibitory activity on TSLP expression in A549 cells at different concentrations.

[0245] Table 8: Activity detection of modified siRNA at different concentrations in hTSLP-A549

[0246] Example 6: Activity detection of modified siRNA in stably transfected cell line hTSLP-BEAS-2B

[0247] Genemax was commissioned to construct a stable cell line hTSLP-BEAS-2B that overexpresses human TSLP protein (human TSLP sequence number NM_033035.5) in the BEAS-2B cell line via lentiviral infection. This example used the same experimental steps as Example 5, except that the cells used were the hTSLP-BEAS-2B stable cell line, which was cultured in complete DMEM medium.

[0248] The results of transfection with the above siRNA at final concentrations of 1 nM, 0.1 nM, and 0.01 nM are shown in Table 9 below. The results show that the chemically modified duplex has good inhibitory activity on TSLP expression in BEAS-2B cells at different concentrations.

[0249] Table 9: Activity detection of modified siRNA at different concentrations in hTSLP-BEAS-2B

[0250] Example 7: Activity detection of modified siRNA in cell line LN18

[0251] This example uses the same experimental steps as in Example 5, except that the cells used are LN18 cells (Jima Gene), and the LN18 cell line is cultured using DMEM complete medium.

[0252] The results of transfection with the above siRNA at final concentrations of 1 nM, 0.1 nM, and 0.01 nM are shown in Table 10 below. The results show that the chemically modified duplex has good inhibitory activity on TSLP expression in LN18 cells at different concentrations.

[0253] Table 10: Activity detection of modified siRNA at different concentrations in LN18

[0254] Example 8: IC50 detection of modified siRNA in stably transfected cell line hTSLP-A549

[0255] The stably transfected hTSLP-A549 cell line was transfected with siRNA at seven different concentrations, with final experimental concentrations of 30 nM, 10 nM, 1 nM, 0.1 nM, 0.03 nM, 0.01 nM, and 0.001 nM. IC50 values ​​were calculated using the same experimental method as in Example 5. The experimental results are shown in Table 11 below, demonstrating that the chemically modified duplex exhibited significant inhibitory activity against TSLP expression in A549 cells.

[0256] Table 11: IC50 detection of modified siRNA in hTSLP-A549

[0257] Example 9: IC50 detection of modified siRNA in stably transfected cell line hTSLP-BEAS-2B

[0258] The stably transfected hTSLP-BEAS-2B cell line was transfected with siRNA at seven different concentrations, with final experimental concentrations of 30 nM, 10 nM, 1 nM, 0.1 nM, 0.03 nM, 0.01 nM, and 0.001 nM. IC50 values ​​were calculated using the same experimental method as in Example 6. The experimental results are shown in Table 12 below, demonstrating that the chemically modified duplexes exhibited significant inhibitory activity against TSLP expression in BEAS-2B cells.

[0259] Table 12: IC50 detection of modified siRNA in hTSLP-BEAS-2B

[0260] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and variations may be made to the details based on all the teachings disclosed, and that such modifications are within the scope of protection of the present invention. The full scope of the present invention is given by the appended claims and any equivalents thereof.

Claims

1. A small interfering RNA (siRNA) for inhibiting the expression of the long subtype TSLP (lfTSLP) gene, wherein the siRNA comprises a sense strand and an antisense strand, wherein: The antisense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 164 by no more than 4 (e.g., 0, 1, 2, 3 or 4) nucleotides, and the positive strand is at least partially complementary to the antisense strand.

2. The siRNA according to claim 1, wherein The antisense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 164 by 0 or 1 nucleotide.

3. The siRNA according to claim 1 or 2, wherein The sense strand comprises at least 14 consecutive nucleotides that differ from the nucleotide sequence shown in any one of SEQ ID NO: 165 to SEQ ID NO: 328 by no more than 4 (e.g., 0, 1, 2, 3 or 4) nucleotides; Preferably, the sense strand comprises at least 14 consecutive nucleotides that differ by 0 or 1 nucleotide from the nucleotide sequence shown in any one of SEQ ID NO: 165 to SEQ ID NO: 328; Preferably, the sense strand has a region of at least 85% complementarity with the antisense strand within the 14 consecutive nucleotides.

4. The siRNA according to any one of claims 1 to 3, wherein The siRNA comprises a blunt end and / or an overhang of 1-4 nucleotides; Preferably, the siRNA comprises an overhang of 1 or 2 nucleotides; Preferably, the overhang is present at the 5' end and / or the 3' end of the antisense strand and / or the sense strand; Preferably, the 3' end of the antisense strand of the siRNA comprises an overhang of 2 nucleotides.

5. The siRNA according to any one of claims 1 to 4, wherein The lengths of the antisense strand and the sense strand are independently 14 to 30 nucleotides; preferably, the length of the antisense strand is 16 to 25 nucleotides; preferably, the length of the sense strand is 14 to 23 nucleotides.

6. The siRNA according to any one of claims 1 to 4, wherein The antisense strand is 21 to 23 nucleotides in length, and the sense strand is 19 to 21 nucleotides in length.

7. The siRNA according to any one of claims 1 to 6, wherein The sense strand has no more than 6 (eg, 0, 1, 2, 3, 4, 5, or 6) nucleotide mismatches with the antisense strand.

8. The siRNA according to any one of claims 1 to 7, wherein The sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any duplex of GPSZT082UM to GPSZT245UM provided in Table 1; Preferably, the sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any duplex provided in Table 5.

9. The siRNA according to any one of claims 1 to 8, wherein The siRNA contains at least one modified nucleotide.

10. The siRNA according to claim 9, wherein All nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides or nucleotide analogs; Preferably, all nucleotides in the sense strand of the siRNA are modified nucleotides or nucleotide analogs, and all nucleotides in the antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

11. The siRNA according to claim 9 or 10, wherein The modified nucleotide or nucleotide analog is selected from 2'-methoxy nucleotides, 2'-fluoro nucleotides, 2'-deoxyribonucleotides, 2',3'-split ring nucleotide analogs, 2'-fluoroarabino nucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 3'-methoxy nucleotides, 2'-allyl modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate esters, nucleotides containing 5'-phosphate mimetics, diol-modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleic acids, unlocked nucleic acids or glycerol nucleotides.

12. The siRNA according to any one of claims 9 to 11, wherein The nucleotides in the sense strand of the siRNA are selected from at least two of 2'-methoxy nucleotides, 2'-fluoro nucleotides, 2'-deoxyribonucleotides or locked nucleic acids; and / or the nucleotides in the antisense strand of the siRNA are selected from at least two of 2'-methoxy nucleotides, 2'-fluoro nucleotides, 2'-deoxyribonucleotides, glycerol nucleotides, nucleotides containing 5'-phosphate esters or nucleotides containing 5'-phosphate ester mimetics.

13. The siRNA according to any one of claims 9 to 12, wherein The sense strand and / or antisense strand of the siRNA comprises a modified internucleoside linkage; Preferably, the 5' end and / or 3' end of the sense strand independently comprises 1 or 2 phosphorothioate linkages; and / or the 5' end and / or 3' end of the antisense strand independently comprises 1 or 2 phosphorothioate linkages.

14. The siRNA according to any one of claims 9 to 13, wherein The antisense strand of the siRNA comprises the following modification pattern: (1) 5'-NmsNfsNmNfNmNfNmNfNmNfNmNmNmNfNmNfNmNfNmsNmsNm-3' (SEQ ID NO: 719); (2) 5'-NmsNfsNmNmNmNfNmNfNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 720); (3) 5'-NmsNfsNmNfNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 721); (4) 5'-VPNmsNfsNmNfNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm-3' (SEQ ID NO: 728); (5) 5'-VPNmsNfsNmNfNmN(GNA)NmNmNmNmNmNmNmNfNmNfNmNmNmsNms Nm-3' (SEQ ID NO: 729); or (6) 5'-VPNmsNfsNmNfNmNmN(GNA)NmNmNmNmNmNmNfNmNfNmNmNmsNms Nm-3' (SEQ ID NO: 730); Among them, Nm is a methoxy-modified nucleotide, Nf is a fluorinated-modified nucleotide, s is a phosphorothioate linkage, VP represents a 5'-phosphate mimetic, and N(GNA) represents a glycerol nucleotide.

15. The siRNA according to any one of claims 9 to 14, wherein The sense strand of the siRNA comprises the following modification pattern: (1) 5'-NmsNmsNfNmNfNmNfNfNfNmNfNmNfNmNfNmNfNmNf-3' (SEQ ID NO: 722); (2) 5'-NmsNmsNfNmNmNmNfNfNfNmNfNmNfNmNfNmNmNmNm-3' (SEQ ID NO: 723); (3)5'-NmsNmsNmNmNfNmNfNfN(d)NmNmNmNmNmNmNmNmNmNm-3' (SEQ ID NO: 724); (4) 5'-N(LNA)sNmsNfNmNmNmNfNfNfNmNfNmNfNmNfNmNmNmNm-3' (SEQ ID NO: 725); (5) 5'-NmsNmsNmNmNfNmNfNfNfNmNmNmNmNmNfNmNmNmNm-3' (SEQ ID NO: 726); (6) 5'-NmsNmsNmNmNfNmN(d)NfN(d)NmNmNmNmNmNmNmNmNmNm-3' (SEQ ID NO: 731); (7) 5'-NmsNmNfNmNfNmNfNfNfNmNfNmNfNmNfNmNfNmsNf-3' (SEQ ID NO: 732); (8) 5'-NmsNmNfNmNmNmNfNfNfNmNfNmNfNmNfNmNmNmsNm-3' (SEQ ID NO: 733); (9) 5'-NmsNmNmNmNfNmNfNfN(d)NmNmNmNmNmNmNmNmNmsNm-3' (SEQ ID NO: 734); (10) 5'-N(LNA)sNmNfNmNmNmNfNfNfNmNfNmNfNmNfNmNmNmsNm-3' (SEQ ID NO: 735); (11) 5'-NmsNmNmNmNfNmNfNfNfNmNmNmNmNmNfNmNmNmsNm-3' (SEQ ID NO: 736); or (12) 5'-NmsNmNmNmNfNmN(d)NfN(d)NmNmNmNmNmNmNmNmNmsNm-3' (SEQ ID NO: 737); Among them, Nm is a methoxy-modified nucleotide, Nf is a fluorinated-modified nucleotide, N(LNA) is a locked nucleic acid-modified nucleotide, N(d) is a 2'-deoxyribonucleotide, and s is a phosphorothioate linkage.

16. The siRNA according to any one of claims 9 to 15, wherein The antisense strand comprises a nucleotide sequence shown in any one of SEQ ID NOs: 329-523; Preferably, the antisense strand comprises SEQ ID NOs: 329-331, 333-337, 339, 341, 344-356, 360, 362-363, 365, 367-369, 371-378, 380-381, 383, 385-393, 395-396, 398-404, 407-408, 411-417, 419-420, 425-426, 428, 43 The nucleotide sequence shown in any one of 0-431, 433-434, 438, 440-441, 446-447, 450-456, 458-459, 463-470, 472-474, 476-477, 479-480, 482, 484-486, 488-498, 500, 502-513, 515-516, and 518-521.

17. The siRNA according to any one of claims 9 to 16, wherein The positive strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 524-718; Preferably, the sense strand comprises SEQ ID NOs: 524-526, 528-532, 534, 536, 539-551, 555, 557-558, 560, 562-564, 566-573, 575-576, 578, 580-588, 590-591, 593-599, 602-603, 606-612, 614-615, 620-621, 623, 624-625 The nucleotide sequence shown in any one of 5-626, 628-629, 633, 635-636, 641-642, 645-651, 653-654, 658-665, 667-669, 671-672, 674-675, 677, 679-681, 683-693, 695, 697-708, 710-711, and 713-716.

18. The siRNA according to any one of claims 9 to 17, wherein The sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any duplex of GPSZT082S1 to GPSZT233S5 provided in Table 3; Preferably, the sequences of the sense strand and antisense strand of the siRNA are selected from the sense strand and antisense strand sequences of any duplex provided in Table 7.

19. A conjugate, wherein: The conjugate comprises the siRNA according to any one of claims 1 to 18 and a pharmaceutically acceptable targeting molecule.

20. A pharmaceutical composition, wherein The pharmaceutical composition comprises the siRNA according to any one of claims 1 to 18 or the conjugate according to claim 19, and a pharmaceutically acceptable carrier and / or excipient.

21. The pharmaceutical composition according to claim 20, wherein The pharmaceutically acceptable carrier is a delivery carrier; preferably, the siRNA is encapsulated by the delivery carrier.

22. Use of the siRNA according to any one of claims 1 to 18, the conjugate according to claim 19 and / or the pharmaceutical composition according to claim 20 or 21 in the preparation of a medicament for treating and / or preventing a disease associated with lfTSLP; Preferably, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (eg, siRNA targeting a different target sequence in the lfTSLP gene or siRNA targeting other targets).

23. The use according to claim 22, wherein The disease associated with lfTSLP is an inflammatory disease, such as an inflammatory respiratory disease, an inflammatory digestive disease or an inflammatory skin disease.

24. The use according to claim 22, wherein The disease associated with lfTSLP is selected from asthma, nasal polyps, allergic rhinitis, chronic sinusitis, atopic dermatitis, eosinophilic esophagitis, chronic obstructive pulmonary disease or idiopathic pulmonary fibrosis.

25. A method for inhibiting lfTSLP expression in a cell, wherein: The method comprises: introducing into a cell the siRNA according to any one of claims 1 to 18, the conjugate according to claim 19, and / or the pharmaceutical composition according to claim 20 or 21; Preferably, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (eg, siRNA targeting a different target sequence in the lfTSLP gene or siRNA targeting other targets).

26. A method for preventing and / or treating a disease associated with lfTSLP in a subject, wherein: The method comprises administering to a subject in need thereof an effective amount of the siRNA of any one of claims 1 to 18, the conjugate of claim 19, and / or the pharmaceutical composition of claim 20 or 21; Preferably, the disease associated with lfTSLP is an inflammatory disease, such as an inflammatory respiratory disease, an inflammatory digestive disease or an inflammatory skin disease; Preferably, the disease associated with lfTSLP is selected from asthma, nasal polyps, allergic rhinitis, chronic sinusitis, atopic dermatitis, eosinophilic esophagitis, chronic obstructive pulmonary disease or idiopathic pulmonary fibrosis; Preferably, the subject is a mammal, such as a human; Preferably, the siRNA, the conjugate or the pharmaceutical composition is used alone or in combination with another pharmaceutically active agent (eg, siRNA targeting a different target sequence in the lfTSLP gene or siRNA targeting other targets).