Carrier for delivering nucleic acid
By conjugating GalNAc molecules with siRNA to form GalNAc-siRNA conjugates, the problem of ineffective siRNA delivery is solved, achieving efficient nucleic acid drug delivery and gene silencing effects. The vector molecule has a simple structure, readily available raw materials, and an easy-to-develop synthesis process.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-05
- Publication Date
- 2026-03-24
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The lack of effective siRNA delivery vectors in existing technologies prevents siRNA from effectively targeting target tissues and entering cells, thus hindering its therapeutic effects.
Using GalNAc molecules as a vector, GalNAc-siRNA conjugates are formed by coupling with siRNA. Small nucleic acid molecules siRNA are then linked through linkers to achieve excellent delivery and gene silencing efficiency.
It improves the delivery efficiency and gene silencing efficiency of siRNA, enhances the therapeutic effect of nucleic acid drugs, and has a simple vector molecular structure, readily available raw materials, and easy-to-develop synthesis process.
Smart Images

Figure CN121717859A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of medicine, in particular to a carrier for delivering nucleic acid. BACKGROUND
[0002] Small interfering RNA (siRNA) therapy is a class of drugs that use the RNA interference (RNAi) pathway to silence specific genes. siRNA is a large molecule with a negative charge composed of two oligonucleotide chains, which cannot effectively target the target tissue in the body and cannot enter the cell independently. siRNA needs to rely on a delivery carrier to achieve the enrichment of siRNA in the target organ and make it enter the cell to exert the therapeutic effect of siRNA. However, there is still no effective siRNA delivery carrier in the prior art. Therefore, how to develop an effective siRNA delivery carrier is of great significance to realize the efficacy of siRNA.
[0003] Therefore, there is a need in the art to develop a carrier that can effectively deliver nucleic acids such as siRNA. SUMMARY
[0004] The present application relates to the field of medicine, in particular to a carrier for delivering nucleic acid.
[0005] In a first aspect, the present application provides a GalNAc molecule, which has the structure shown in Formula I, or an optical isomer thereof, or a racemate thereof;
[0006]
[0007] I
[0008] wherein,
[0009] R1 is hydrogen, substituted or unsubstituted C1-C4 alkylacyl, or substituted or unsubstituted C6-C8 arylacyl;
[0010] X is -CH2-, -NH- or O;
[0011] Y is -C(O)- or -CH2-;
[0012] n is 1, 2, 3, 4, 5 or 6;
[0013] Ac is acetyl.
[0014] Preferably, R1 is hydrogen or acetyl.
[0015] Preferably, n is 1, 2, 3 or 4.
[0016] Preferably, the GalNAc molecule is selected from the group consisting of:
[0017] Preferably, the GalNAc molecule is selected from the group consisting of:
[0018] In a second aspect, the present application provides a vector for delivering a nucleic acid, said vector for delivering a nucleic acid comprising a structure according to Formula II, or an optical isomer thereof, or a racemate thereof;
[0019]
[0020] II
[0021] wherein,
[0022] R1is hydrogen, substituted or unsubstituted C1-C4alkylacyl, or substituted or unsubstituted C6-C8arylacyl;
[0023] X is -CH2-, -NH-, or O;
[0024] Y is -C(O)-, or -CH2-;
[0025] L is substituted or unsubstituted C1-C10alkylene, cycloalkylene, or arylene;
[0026] n is 1, 2, 3, 4, 5, or 6;
[0027] m is 0, 1, 2, 3, 4, 5, or 6;
[0028] Ac is acetyl.
[0029] Preferably, R1is hydrogen or acetyl.
[0030] Preferably, L is substituted or unsubstituted C1-C10alkylene, cycloalkylene, or arylene.
[0031] Preferably, L is substituted or unsubstituted C1-C8alkylene, cycloalkylene, or arylene.
[0032] Preferably, L is substituted or unsubstituted C1-C6alkylene, cycloalkylene, or arylene.
[0033] Preferably, L is substituted or unsubstituted C1-C4alkylene, cycloalkylene, or arylene.
[0034] Preferably, L is substituted or unsubstituted C1-C2alkylene, cycloalkylene, or arylene.
[0035] Preferably, the alkylene is a straight chain alkylene.
[0036] Preferably, L is methylene.
[0037] Preferably, n is 1, 2, 3, or 4.
[0038] Preferably, m is 1.
[0039] Preferably, the vector for delivering nucleic acids is selected from the group consisting of:
[0040]
[0041] A third aspect of the present invention provides the use of the vector for delivering nucleic acids as described in the second aspect of the present invention in the preparation of a delivery vector for delivering nucleic acids.
[0042] In a fourth aspect, the present invention provides a nucleic acid conjugate, said nucleic acid conjugate being formed by coupling a nucleic acid with a carrier for delivering nucleic acid as described in the second aspect of the present invention.
[0043] Preferably, the vector for delivering nucleic acid is coupled to the 5' or 3' end of the nucleic acid.
[0044] Preferably, the carrier for delivering nucleic acid is coupled to the phosphate or hydroxyl terminus of the nucleic acid.
[0045] Preferably, the structure of the nucleic acid conjugate is shown below.
[0046]
[0047] Wherein, R1, X, Y, n, Ac, m and L are as described in the second aspect of the present invention above;
[0048] G refers to nucleic acid.
[0049] Preferably, the hydroxyl group of the carrier for delivering the nucleic acid coupled to the nucleic acid is connected to the phosphate group end of the nucleic acid.
[0050] Preferably, the hydroxyl group of the carrier for delivering the nucleic acid coupled with the nucleic acid forms a phosphate ester with the phosphate terminus of the nucleic acid.
[0051] Preferably, the nucleic acid includes DNA and RNA.
[0052] Preferably, the nucleic acid includes small interfering RNA (siRNA).
[0053] Preferably, the nucleotide sequence of the nucleic acid is UUUAGAGUGAGGAUUAAAAUG (SEQ ID NO: 1).
[0054] Preferably, the nucleic acid includes a nucleic acid modified with respect to the nucleic acid shown in SEQ ID NO: 1, wherein the modified nucleic acid includes UmsUfsUmAmGmAfGmUmGmAmGmGmAmUfUmAfAmAmAmsUmsGm, and the meanings of "m", "f" and "s" are as follows:
[0055] m, 2'-methoxy; f, 2'-fluorine; s, thiophosphate;
[0056]
[0057] In a fifth aspect, the present invention provides a composition comprising the nucleic acid conjugate as described in the fourth aspect of the present invention.
[0058] In another preferred embodiment, the composition is a pharmaceutical composition.
[0059] In another preferred embodiment, the composition further includes a pharmaceutically acceptable carrier.
[0060] In another preferred embodiment, the dosage form of the composition is a solid dosage form or a liquid dosage form.
[0061] In another preferred embodiment, the dosage form of the composition is an oral formulation or an injectable formulation.
[0062] In another preferred embodiment, the injectable formulation includes a subcutaneous injection formulation or an intravenous injection formulation.
[0063] In a sixth aspect, the present invention provides the use of a nucleic acid conjugate as described in the fourth aspect of the present invention or a composition as described in the fifth aspect of the present invention for preparing a composition or formulation for use in nucleic acid therapy.
[0064] In another preferred embodiment, the composition or formulation is a pharmaceutical composition or pharmaceutical formulation.
[0065] In another preferred embodiment, the composition or formulation further includes a pharmaceutically acceptable carrier.
[0066] In another preferred embodiment, the dosage form of the composition or preparation is a solid dosage form or a liquid dosage form.
[0067] In another preferred embodiment, the dosage form of the composition or preparation is an oral preparation or an injectable preparation.
[0068] In another preferred embodiment, the injectable formulation includes a subcutaneous injection formulation or an intravenous injection formulation.
[0069] In another preferred embodiment, the nucleic acid includes small interfering RNA (siRNA), and the nucleic acid treatment includes gene knockout or gene silencing.
[0070] In a seventh aspect, the present invention provides a method for nucleic acid therapy, the method comprising administering a nucleic acid conjugate as described in the fourth aspect of the present invention or a composition as described in the fifth aspect of the present invention to a desired subject, thereby performing nucleic acid therapy.
[0071] In another preferred embodiment, the object is a human or non-human mammal (rodents, rabbits, monkeys, livestock, dogs, cats, etc.).
[0072] Within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below can be combined with each other to form new or preferred technical solutions. Attached Figure Description
[0073] Figure 1 To investigate the inhibitory activity of target genes in mice by providing different GalNAc-siRNA conjugates. Detailed Implementation
[0074] This invention develops a GalNAc molecule, which is coupled with a small nucleic acid molecule siRNA via a linker to form a GalNAc-siRNA conjugate. The GalNAc-siRNA conjugate can achieve excellent delivery efficiency and gene silencing efficiency of the small nucleic acid molecule siRNA, thereby improving the therapeutic effect of nucleic acid drugs.
[0075] the term
[0076] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0077] As used herein, the terms “comprising,” “including,” and “containing” are used interchangeably and include not only open-ended definitions but also semi-closed and closed definitions. In other words, the terms include “consisting of” and “substantially consisting of”.
[0078] In the structure of the compounds of this invention, the group "Ac" refers to the acetyl group.
[0079] In this invention, the nucleotide sequence is written in the order of the 5' end and arranged towards the 3' end.
[0080] As used herein, the term "alkyl" refers to a straight-chain (i.e., unbranched) or branched saturated hydrocarbon group containing only carbon and hydrogen atoms, or a combination of straight and branched groups. When an alkyl group is preceded by a carbon number qualifier, it refers to the number of carbon atoms contained in the alkyl group; for example, C1-C4 alkyl refers to an alkyl group containing 1 to 4 carbon atoms. Representative examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, or similar groups.
[0081] As used herein, the term "alkylene" refers to a group formed by removing one hydrogen atom from an alkyl group, as defined above. When an alkylene group is preceded by a carbon number qualifier, it refers to the number of carbon atoms contained in the alkylene group; for example, C1-C4 alkylene groups refer to alkylene groups containing 1-4 carbon atoms. Representative examples of alkylene groups include, but are not limited to, methylene, ethylene, propylene, butylene, or similar groups.
[0082] As used herein, the term "alkyl acyl" refers to an RC(O)- group, where R is an alkyl group, and the alkyl group is as defined above herein. When the alkyl acyl group is preceded by a carbon number limit, such as C1-C4 alkyl acyl, it means that the alkyl group in the alkyl acyl group has 1-4 carbon atoms.
[0083] As used herein, the term "cycloalkyl" refers to a carbonyl group having a saturated or partially saturated monocyclic, bicyclic, or polycyclic (fused, bridged, or spirocyclic) ring. When a cycloalkyl group is preceded by a carbon number limitation (e.g., C3-C12), it refers to the number of carbon atoms in the ring (e.g., 3-12), representative examples including, but not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cycloheptyl, or similar groups.
[0084] As used herein, the term "cycloalkylene" refers to a group formed by removing one hydrogen atom from a cycloalkyl group, as defined above.
[0085] As used herein, the term "aryl" refers to an all-carbon monocyclic or fused polycyclic (i.e., a ring sharing adjacent carbon atom pairs) group with a conjugated π-electron system. It is an aromatic cyclic hydrocarbon compound group. When the aryl group is preceded by a carbon number limit, it means that the aryl group has a number of ring carbon atoms. For example, a C6-C12 aryl group means that the aryl group has 6-12 ring carbon atoms, such as a phenyl group.
[0086] As used herein, the term "aryl" refers to a group formed by removing one hydrogen atom from an aryl group, as defined above.
[0087] As used herein, the term "aryl acyl" refers to an RC(O)- group, where R is an aryl group, and the aryl group is defined as above. When the aryl acyl group is preceded by a carbon number limit, such as C6-C8 alkyl acyl, it means that the aryl group in the aryl acyl group has 6-8 cyclic carbon atoms.
[0088] GalNAc molecules
[0089] This invention provides a GalNAc molecule, wherein the GalNAc molecule has the structure shown in Formula I, or its optical isomer or racemic mixture;
[0090]
[0091] I
[0092] Specifically, the GalNAc molecule described in this invention is as described in the first aspect of this invention above.
[0093] Vectors for delivering nucleic acids
[0094] The present invention provides a carrier for delivering nucleic acids, wherein the carrier for delivering nucleic acids is specifically the structure shown in Formula II, or an optical isomer thereof, or a racemic mixture thereof;
[0095]
[0096] II
[0097] Specifically, the vector for delivering nucleic acids described in this invention is as described in the second aspect of this invention above.
[0098] Nucleic acid conjugates
[0099] The present invention discloses a nucleic acid conjugate, which is formed by coupling a nucleic acid with a carrier for delivering nucleic acid as described in the present invention.
[0100] In a preferred embodiment of the invention, the vector for delivering nucleic acid is coupled to the 5' or 3' end of the nucleic acid.
[0101] Representatively, the structure of the nucleic acid conjugate is shown below.
[0102]
[0103] in,
[0104] G refers to nucleic acid.
[0105] Specifically, the nucleic acid conjugates described in this invention are as described in the fourth aspect of this invention above.
[0106] Composition or formulation
[0107] The compositions or formulations described in this invention are preferably pharmaceutical compositions or pharmaceutical formulations, and the compositions or formulations described in this invention may include pharmaceutically acceptable carriers.
[0108] As used herein, "pharmaceutically acceptable carrier" refers to one or more compatible solid, semi-solid, liquid, or gel fillers that are suitable for human or animal use and must have sufficient purity and sufficiently low toxicity. "Compatibility" means that the components and active ingredients in the composition, as well as the interactions between them, do not significantly reduce the efficacy of the drug.
[0109] It should be understood that, in this invention, there are no particular limitations on the pharmaceutically acceptable carriers used; materials commonly used in the art can be selected, or they can be prepared using conventional methods or purchased from the market. Some examples of pharmaceutically acceptable carriers include cellulose and its derivatives, gelatin, talc, solid lubricants, calcium sulfate, vegetable oils, polyols, emulsifiers, wetting agents, buffers, chelating agents, thickeners, pH adjusters, colorants, flavoring agents, stabilizers, antioxidants, preservatives, antibacterial agents, and pyrogen-free water, etc.
[0110] In a preferred embodiment of the present invention, the dosage form of the composition or preparation is a solid dosage form, a liquid dosage form, or a semi-solid dosage form.
[0111] In a preferred embodiment of the present invention, the dosage form of the composition or preparation is an oral preparation, a topical preparation, or an injectable preparation.
[0112] Typically, the dosage form of the composition or preparation is a tablet, injection, infusion, ointment, gel, solution, microsphere or film.
[0113] The pharmaceutical formulation should be matched with the route of administration. The pharmaceutical formulation of this invention can also be used with other synergistic therapeutic agents (including before, during, or after administration). When using the pharmaceutical composition or formulation, a safe and effective amount of the drug is administered to the desired subject (e.g., human or non-human mammal), said safe and effective amount generally being at least about 10 micrograms per kilogram of body weight, and in most cases not exceeding about 8 milligrams per kilogram of body weight, preferably about 10 micrograms per kilogram of body weight to about 1 milligram per kilogram of body weight. Of course, the specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are within the scope of a skilled physician's expertise.
[0114] The main superior technical effects of this invention include:
[0115] 1. This invention develops a GalNAc molecule, which is coupled with a small nucleic acid molecule siRNA via a linker to form a GalNAc-siRNA conjugate. The GalNAc-siRNA conjugate can achieve excellent delivery efficiency and gene silencing efficiency of the small nucleic acid molecule siRNA, thereby improving the therapeutic effect of nucleic acid drugs.
[0116] 2. This invention develops a vector for delivering nucleic acids, which can effectively deliver nucleic acids such as siRNA into cells, thereby effectively exerting the therapeutic effect of nucleic acids.
[0117] 3. The carrier and nucleic acid conjugate for delivering nucleic acids described in this invention have advantages such as simple molecular structure, inexpensive and readily available raw materials, and easy development of CMC process, while also having good oligonucleotide synthesis efficiency and in vivo biological activity.
[0118] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that the following specific embodiments are based on this technical solution and provide detailed implementation methods and specific operating procedures, but the scope of protection of the present invention is not limited to these embodiments.
[0119] Example 1
[0120] Example 1 examines how GalNAc molecules, as delivery vectors, can effectively deliver siRNA into cells, thereby effectively exerting the inhibitory effect of siRNA on the target gene.
[0121] 1. Preparation of different GalNAc molecules (compounds DM02001, DM02002, DM02003, DM02004 and DM02005)
[0122] 1.1 Preparation of compound DM02001
[0123] The structure of compound DM02001 is as follows:
[0124]
[0125] Ac refers to acetyl group.
[0126] DM02001
[0127] Preparation of compound DM02001
[0128] Preparation of compound 2:
[0129]
[0130] Compound 1 (4.8 g, 13.1 mmol, 1.2 equivalents), HATU (2-(7-azobenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate, 6.2 g, 16.32 mmol, 1.5 equivalents) and DIEA (N,N-diisopropylethylamine, 2.8 g, 21.71 mmol, 2.0 equivalents) were added sequentially to 40.0 mL of dichloromethane solution. After stirring at room temperature for 15 min, benzyl 4-aminobutyrate (4.0 g, 10.95 mmol, 1.0 equivalents) was added to the reaction solution, and the reaction was continued at room temperature for 12 h. After the reaction was completed, 40 mL of water and 80 mL of dichloromethane were added to the system for extraction. The organic phase was washed once with saturated sodium bicarbonate and once with water, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain compound 2 (18.0 g, yield 71.4%).
[0131] MS m / z[M+H] + Theoretical value: 542.7; Measured value: 542.3.
[0132] Preparation of compound 3:
[0133]
[0134] Compound 2 (6.0 g, 11.08 mmol, 1.0 equivalent) was dissolved in 60.0 mL of dichloromethane, and then 60.0 mL of a 4.0 mol / L HCl / dioxane solution was slowly added dropwise to the mixture. After the addition was complete, the mixture was reacted at room temperature for 2 h. The reaction solution was then concentrated to obtain a crude product, which was then concentrated twice with 100 mL of dichloromethane to obtain compound 3, 8.14 g, which was used directly in the next step.
[0135] MS m / z[M+H] + Theoretical value: 442.5; Measured value: 442.2.
[0136] Preparation of compound 4:
[0137]
[0138] N-Benzyloxycarbonyl-3-aminopropionaldehyde (2.12 g, 10.23 mmol, 1.0 equivalent) and compound 3 (8.14 g, 17.41 mmol, 2.0 equivalent) were added sequentially to 20.0 mL of tetrahydrofuran. After stirring the reaction system for a short time, triethylamine (2.38 g, 23.56 mmol, 2.3 equivalent) was added. After stirring for another 2 h, sodium triacetoxyborohydride (4.3 g, 20.29 mmol, 2.0 equivalent) was added to the reaction system, and the reaction was continued at room temperature under nitrogen protection for 14 h. After the reaction was complete, 50 mL of water and 100 mL of ethyl acetate were added to the system. The mixture was extracted, allowed to stand, and separated. The organic phase was washed once with saturated brine and dried with anhydrous sodium sulfate. The mixture was then filtered and concentrated to obtain the crude product. The crude product was purified by column chromatography (4% methanol in dichloromethane solution) to obtain a pale yellow oily compound 4 (3.3 g, yield 51.0%).
[0139] MS m / z[M+H] + Theoretical value: 633.8; Measured value: 633.3.
[0140] Preparation of compound 7:
[0141]
[0142] Compound 5 (2.67 g, 5.80 mmol, 1.3 equivalents), HATU (3.39 g, 8.92 mmol, 2.0 equivalents), and DIEA (1.73 g, 13.41 mmol, 3.0 equivalents) were added sequentially to 25.0 mL of DMF. After stirring at room temperature for 15 min, compound 4 (2.44 g, 4.46 mmol, 1.0 equivalents) was added to the reaction system, and the reaction was continued at room temperature for 12 h. After the reaction was completed, 30 mL of water and 60 mL of ethyl acetate were added sequentially to the system, and the mixture was extracted and separated. The organic phase was washed five times with saturated brine and once with water, and dried over anhydrous sodium sulfate. After filtration and concentration, the crude product was obtained. The crude product was purified by reversed-phase HPLC, and the product was flushed off with 60% acetonitrile. The product fraction was collected and concentrated to obtain compound 7 (4.2 g, yield 95.5%).
[0143] MS m / z[M+H] + Theoretical value: 991.0; Measured value: 991.4
[0144] Preparation of compound 8:
[0145]
[0146] Compound 7 (3.5 g, 3.54 mmol, 1.0 equivalent) was dissolved in 35.0 mL of dichloromethane. Then, 35.0 mL of 33% HBr / HOAc was added dropwise to the reaction solution. After the addition was complete, the mixture was cooled to room temperature and reacted for 2 h. After the reaction was complete, the solution was concentrated to obtain a crude product. This crude product was added to 50.0 mL of ethyl acetate and stirred for approximately 5 h. The mixture was then filtered, and the filter cake was washed once with ethyl acetate and then filtered again to obtain a filter cake. After drying, compound 8 (3.0 g) was obtained and used directly in the next step.
[0147] MS m / z[M+H] + Theoretical value: 722.8; Measured value: 723.4
[0148] Preparation of compound 9:
[0149]
[0150] Compound 5 (1.95 g, 4.24 mmol, 2.5 equivalents), HATU (1.80 g, 4.74 mmol, 2.8 equivalents), and DIEA (1.31 g, 10.16 mmol, 6.0 equivalents) were added sequentially to 15.0 mL of dichloromethane. After stirring for 15 min, compound 8 (1.50 g, 1.70 mmol, 1.0 equivalents) was added to the reaction system. The reaction was continued at room temperature under nitrogen protection for 12 h. After the reaction was completed, 30 mL of water and 60 mL of dichloromethane were added sequentially to the system. The mixture was extracted and separated. The organic phase was washed once with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain the crude product. The crude product was purified by column chromatography (10% methanol in dichloromethane). The product fraction was concentrated to obtain a pale yellow foamy solid compound 9 (0.7 g, yield 25.9%).
[0151] MS m / z[M+H] + Theoretical value: 1607.3; Measured value: 1607.7.
[0152] Preparation of compound 10:
[0153]
[0154] Compound 9 (0.55 g, 0.34 mmol, 1.0 equivalent) was dissolved in 5.0 mL of methanol, and then 0.055 g of 10% palladium on carbon was added. After purging with hydrogen three times, the reaction was carried out at room temperature for 12 h. After the reaction was completed, the reaction system was concentrated to give compound 10 (0.5 g, yield 96.3%), a pale yellow foamy solid.
[0155] MS m / z[M+H] + Theoretical value: 1517.5; Measured value: 1517.7.
[0156] Preparation of compound 11:
[0157]
[0158] Compound 10 (0.5 g, 0.33 mmol, 1.0 equivalent), HATU (0.16 g, 0.42 mmol, 1.3 equivalent), and DIEA (0.085 g, 0.66 mmol, 2.0 equivalent) were added sequentially to 5.0 mL of dichloromethane. After stirring for 15 min, benzyl 4-aminobutyrate (0.156 g, 0.43 mmol, 1.3 equivalent) was added to the reaction system. The reaction was continued at room temperature under nitrogen protection for 12 h. After the reaction was completed, 30 mL of water and 60 mL of dichloromethane were added sequentially to the system. The mixture was extracted and separated. The organic phase was washed once with 30 mL of saturated brine and dried over anhydrous sodium sulfate. The mixture was then filtered and concentrated to obtain the crude product. The crude product was purified by column chromatography (10% methanol in dichloromethane solution). The product fraction was concentrated to obtain a pale yellow foamy solid compound 11 (0.5 g, yield 89.3%).
[0159] MS m / z[M+H] + Theoretical value: 1692.8; Measured value: 1692.6.
[0160] Preparation of compound DM02001:
[0161]
[0162] Compound 11 (0.50 g, 0.31 mmol, 1.0 equivalent) was dissolved in 5.0 mL of methanol, and then 10% Pd / C was added. After three purgings with hydrogen, the reaction was carried out at room temperature for 12 h. After the reaction was complete, the reaction system was concentrated to dryness to give a gray foamy solid compound DMO2001 (0.47 g, yield 99.4%).
[0163] MS m / z[M+H] + Theoretical value: 1602.6; Measured value: 1602.3.
[0164] 1.2 Preparation of compound DMO2002
[0165] The structure of compound DM02002 is as follows:
[0166]
[0167] Ac refers to acetyl group.
[0168] DM02002
[0169] The preparation method of compound DM02002 is as follows:
[0170] Preparation of compound 12:
[0171]
[0172] Compound 6 (1.52 g, 3.4 mmol, 1.5 equivalents), HATU (1.3 g, 3.42 mmol, 1.5 equivalents), and DIEA (0.59 g, 4.57 mmol, 2.0 equivalents) were added sequentially to 15.0 mL of DMF. After stirring for 15 min, compound 4 (1.44 g, 2.28 mmol, 1.0 equivalents) was added to the reaction solution. The reaction was carried out at room temperature for 12 h. After the reaction was completed, 30 mL of water and 60 mL of ethyl acetate were added sequentially to the system. The mixture was extracted, allowed to stand, and separated. The organic phase was washed five times with saturated brine and once with water. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated to obtain the crude product. The crude product was purified by reversed-phase HPLC (washed with 60% acetonitrile) to obtain compound 12 (1.7 g, yield 70.8%).
[0173] MS m / z[M+H] + Theoretical value: 1062.1; Measured value: 1062.4.
[0174] Preparation of compound 13:
[0175]
[0176] Compound 12 (1.0 g, 0.94 mmol, 1.0 equivalent) was dissolved in 10.0 mL of methanol, and then 10% palladium on carbon was added to the reaction system. After purging with hydrogen three times, the reaction was carried out at room temperature for 12 h. After the reaction was complete, the reaction system was concentrated to dryness to give compound 13 (0.5 g, yield 75.8%), a pale yellow foamy solid.
[0177] MS m / z[M+H] + Theoretical value: 703.8; Measured value: 703.3.
[0178] Preparation of compound DM02002:
[0179]
[0180] Compound 6 (0.78 g, 1.74 mmol, 2.5 equivalents), HATU (0.61 g, 1.61 mmol, 2.3 equivalents), and DIEA (0.27 g, 2.09 mmol, 3.0 equivalents) were added sequentially to 5.0 mL of DCM. After stirring for 15 min, compound 13 (0.49 g, 0.70 mmol, 1.0 equivalents) was added, and the mixture was allowed to react at room temperature under nitrogen protection for 12 h. After the reaction was complete, the system was directly purified by reversed-phase HPLC (35–40% acetonitrile). The product fraction was collected, concentrated, and the product compound DM02002 (0.4 g, yield 36.7%) was obtained.
[0181] MS m / z[M+H]+: Theoretical value: 1560.6; Measured value: 1560.4.
[0182] 1.3 Preparation of compound DM02003
[0183] The structure of compound DM02003 is as follows:
[0184]
[0185] Ac refers to acetyl group.
[0186] DM02003
[0187] The preparation method of compound DM02003 is as follows:
[0188] Preparation of compound 15:
[0189]
[0190] Compound 4 (0.38 g, 0.88 mmol, 1.4 equivalents), HATU (0.36 g, 0.95 mmol, 1.5 equivalents), and DIEA (0.16 g, 1.24 mmol, 2.0 equivalents) were added sequentially to 4 mL of DMF. After stirring for 15 min, compound 14 (0.40 g, 0.63 mmol, 1.0 equivalents) was added to the reaction system. After reacting at room temperature for 12 h, 20 mL of water and 60 mL of ethyl acetate were added to the system for extraction. The organic phase was washed five times with saturated brine and once with water, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain the crude product. The crude product was purified by reversed-phase HPLC (35–40% acetonitrile), and the product fraction was collected and concentrated to obtain compound 15 (0.5 g, yield 75.6%).
[0191] MS m / z[M+H]+: Theoretical value: 1047.2; Measured value: 1047.4.
[0192] Preparation of compound 16:
[0193]
[0194] Compound 15 (0.6 g, 0.57 mmol, 1.0 equivalent) was dissolved in 6.0 mL of methanol, and then 0.06 g of 10% palladium on carbon was added. After purging with hydrogen three times, the reaction solution was allowed to react at room temperature for 12 h. After the reaction was complete, the reaction system was concentrated to dryness to obtain a pale yellow, foamy crude compound 16 (0.26 g), which was used directly in the next step.
[0195] MS m / z[M+H]+: Theoretical value: 688.8; Measured value: 688.5.
[0196] Preparation of compound DM02003:
[0197]
[0198] Compound 14 (0.39 g, 0.90 mmol, 2.5 equivalents), HATU (0.32 g, 0.84 mmol, 2.3 equivalents), and DIEA (0.14 g, 1.09 mmol, 3.) were added sequentially to 3.0 mL of DMF. After stirring for 15 min, compound 16 (0.25 g, 0.36 mmol, 1.0 equivalent) was added. The mixture was placed under nitrogen protection and reacted at room temperature for 12 h. The system was then purified directly by reverse-phase HPLC (20-25% acetonitrile). The product fraction was concentrated to obtain a pale yellow foamy solid compound DMO2003 (0.31 g, yield 56.3%).
[0199] MS m / z[M+H]+: Theoretical value: 1515.6; Measured value: 1515.4.
[0200] 1.4 Preparation of compound DM02004
[0201] The structure of compound DM02004 is as follows:
[0202]
[0203] Ac refers to acetyl group.
[0204] DM02004
[0205] The preparation method of compound DM02004 is as follows:
[0206] Preparation of compound 18:
[0207]
[0208] HATU (0.32 g, 0.84 mmol, 1.5 equivalents), N,N-diisopropylethylamine (0.145 g, 1.12 mmol, 2.0 equivalents), and compound 17 (0.339 g, 0.79 mmol, 1.4 equivalents) were added to 5.0 mL of DMF. After stirring for 15 min, compound 4 (0.355 g, 0.56 mmol, 1.0 equivalents) was added. The reaction was continued at room temperature under nitrogen protection for 12 h. After the reaction was complete, 20 mL of water and 60 mL of ethyl acetate were added to the system sequentially. The mixture was extracted, separated, and the organic phase was washed once with 20 mL of saturated brine and dried over anhydrous sodium sulfate. The mixture was then filtered and concentrated to obtain the crude product. The crude product was purified by reversed-phase HPLC (washed with 40–50% acetonitrile) to obtain a pale yellow foamy solid compound 18 (0.5 g, yield 84.7%).
[0209] MS m / z[M+H]+: Theoretical value: 1047.2; Measured value: 1047.1.
[0210] Preparation of compound 19:
[0211]
[0212] Compound 18 (0.5 g, 0.48 mmol, 1.0 equivalent) was dissolved in 5.0 mL of methanol, and then 0.05 g (0.1 g / g) of 10% palladium on carbon was added. After purging with hydrogen three times, the reaction was carried out at room temperature for 12 h. After the reaction was completed, the reaction solution was concentrated to dryness to obtain a pale yellow, foamy crude compound 19 (0.25 g), which was used directly in the next step.
[0213] MS m / z[M+H] + Theoretical value: 687.8; Measured value: 688.4;
[0214] Preparation of compound DM02004
[0215]
[0216] Compound 17 (0.39 g, 0.90 mmol, 2.5 equivalents) was dissolved in 3.0 mL of DMF, followed by the sequential addition of HATU (0.32 g, 0.84 mmol, 2.3 equivalents) and DIEA (0.14 g, 1.09 mmol, 3.0 equivalents). After stirring for 15 min, compound 19 (0.25 g, 0.36 mmol, 1.0 equivalents) was added. The reaction was continued at room temperature under nitrogen protection for 14 h. After the reaction was complete, the system was directly purified by reversed-phase HPLC (eluting with 23–28% acetonitrile). The product fraction was concentrated to obtain a pale yellow, foamy solid compound DMO2004 (0.29 g, yield 52.7%).
[0217] MS m / z[M+H] + Theoretical value: 1515.6; Measured value: 1515.64.
[0218] 1.5 Preparation of compound DM02005
[0219] The structure of compound DM02005 is as follows:
[0220]
[0221] Ac refers to acetyl group.
[0222] DM02005
[0223] The preparation method of compound DM02005 is as follows:
[0224] Preparation of compound 21:
[0225]
[0226] Compound 20 (2.58 g, 5.76 mmol, 1.2 equivalents) was dissolved in 10 mL of dichloromethane. Then, oxaloyl chloride (0.786 g, 6.24 mmol, 1.3 equivalents) was added under ice bath conditions. The mixture was slowly heated to room temperature and reacted for 20 min. After concentration, the solution was dissolved in 10 mL of dichloromethane and set aside. Under argon protection, compound 4 (2.6 g, 4.8 mmol, 1.0 equivalents) and triethylamine (1.45 g, 14.4 mmol, 3.0 equivalents) were added to 10 mL of dichloromethane. The dichloromethane solution of the acyl chloride obtained above was then slowly added to the reaction mixture. The reaction was continued at room temperature for 12 hours. After the reaction was complete, 30 mL of saturated sodium bicarbonate solution was added, followed by an appropriate amount of dichloromethane. The mixture was extracted and separated. The organic phase was extracted again with saturated sodium bicarbonate solution, washed once with saturated saline solution, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. Reversed-phase column chromatography (C18 column, eluent: 5 mmol / L ammonium bicarbonate / water = 51 / 49, v / v) yielded compound 21 (1.85 g, yield 86%).
[0227] MS m / z[M+H] + Theoretical value: 978.0; Measured value: 978.4.
[0228] Preparation of compound 22:
[0229]
[0230] Compound 21 (1.85 g, 1.91 mmol, 1.0 equivalent) was dissolved in 20 mL of 33% (wt%) hydrobromic acid in acetic acid solution. After reacting at room temperature for 1 h, the filtrate was concentrated under reduced pressure. The residue was pulped with ethyl acetate and filtered. The resulting filter cake was dissolved and concentrated in dichloromethane. The residue was then dried under vacuum to obtain compound 22 (1.54 g colloid, yield: 97%).
[0231] MS m / z[M+H] + Calcd: 709.8; Measured value: 709.3.
[0232] Preparation of compound 23:
[0233]
[0234] Compounds 22 and 20 were dissolved in 20 mL of dichloromethane. The reaction system was placed under argon protection. DIEA and HATU were added to the reaction solution sequentially. After reacting at room temperature for 2 h, saturated sodium bicarbonate solution and appropriate amount of dichloromethane were added. The mixture was allowed to stand and separated. The organic phase was extracted once with saturated sodium bicarbonate solution, washed once with saturated saline solution, and dried with anhydrous sodium sulfate. The solution was then removed under reduced pressure. The residue was dissolved in DCM and separated by column chromatography (gradient elution, methanol / dichloromethane = 1 / 50-1 / 30 v / v). The product was foamed and dried by an oil pump to obtain compound 23 (800 mg, yield: 30%).
[0235] MS m / z[M+ Na] + Theoretical value: 1590.7; Measured value: 1590.6.
[0236] Preparation of compound 24:
[0237]
[0238] Compound 23 (0.64 g, 0.41 mmol, 1.0 equivalent), triethylamine and palladium on carbon were dissolved in 10 mL of dry ethyl acetate. After three hydrogen purgings, the mixture was reacted at room temperature for 12 h. The reaction solution was filtered, the filtrate was concentrated under reduced pressure and dried to obtain compound 24 (620 mg, yield 96%).
[0239] MS m / z[M+H] + Theoretical value: 1478.5; Measured value: 1478.6.
[0240] Preparation of compound 25:
[0241]
[0242] Compound 24 (0.62 g, 0.42 mmol, 1.0 equivalent) and benzyl aminobutyrate p-toluenesulfonate (0.2 g, 0.55 mmol, 1.3 equivalent), DIEA (0.108 g, 0.84 mmol, 2.0 equivalent), and HATU (0.207 g, 0.55 mmol, 1.3 equivalent) were dissolved in 10 mL of DCM. After reacting at room temperature for 2 h, the mixture was concentrated, and the residue was separated by column chromatography (gradient eluent: methanol / dichloromethane, 1 / 20-1 / 15, V / V) to give compound 25 (730 mg, yield: 105%).
[0243] MS m / z[M+H] + Theoretical value: 1653.8; Measured value: 1653.6.
[0244] Preparation of compound DM02005:
[0245]
[0246] Compound 25 (0.73 g, 0.44 mmol, 1.0 equivalent), triethylamine and palladium on carbon were dissolved in 10 mL of dry ethyl acetate and 2.5 mL of methanol, respectively. After purging with hydrogen three times, the mixture was reacted at room temperature for 12 h. The mixture was then filtered directly and dried under vacuum using an oil pump to obtain compound DM02005 (740 mg, 100% yield).
[0247] MS m / z[M+H] + Theoretical value: 1563.6; Measured value: 1563.6.
[0248] 2. Preparation and in vivo activity assessment of GalNAc-siRNA conjugates
[0249] 2.1 Preparation of GalNAc-siRNA conjugates
[0250] 2.1.1 Preparation of carboxylic acid-activated lipids of GalNAc molecules
[0251]
[0252] Under nitrogen protection at room temperature, 1.0 equivalent of GalNAc monomer compound DMO200X was dissolved in 3.0 mL of DCM. Then, 4.0 equivalent of DIEA was added to the reaction mixture, and the reaction was placed in an ice bath. Then, 2.0 equivalent of 18 mg / mL of pentafluorophenyl trifluoroacetate DCM solution was slowly added dropwise. After the addition was complete, the mixture was kept in an ice bath for 15 min, then heated to room temperature and the reaction was continued for 1 h. After the reaction was completed by LC-MS monitoring, the mixture was directly dried for the next reaction.
[0253] 2.1.2 Coupling of the carboxylic acid-activated lipid of the GalNAc molecule to single-stranded RNA
[0254]
[0255] At room temperature, 1.0 equivalent of positive strand RNA (number: RG025001SS or RG025002SS, MW:6330) was dissolved in 200 μL of 100 mM sodium bicarbonate aqueous solution. A DMF solution of 140 mg / mL intermediate 1 (20-50 equivalents) was added to the reaction system. After vortexing and centrifugation, the reaction was allowed to proceed for 15 h. After the reaction was completed, the reaction solution was diluted with 0.5 mL of a DMF and H2O (1:1, V / V) mixture. The reaction solution was then vortexed for 2 min and centrifuged for 5 min to obtain 1.2-1.4 mL of supernatant. This supernatant was then separated by HPLC and lyophilized to obtain 1.0 equivalent of white powder GalNAc-RNA single strand 2 (i.e., intermediate 2).
[0256] The preparation method is as follows: Waters e2695 HPLC (Luna® column 5 µm C18(2)) was used, with the mobile phase being: A-20mM NH4HCO3 (pH approximately 7.5-7.8), B-acetonitrile. Preparation method (B%): 0-5 min, 5% equilibration; 6-26 min, 8-23% gradient elution; 26-27 min, ramp to 95%; 27-32 min;
[0257] 2.1.3 Deprotection of GalNAc-RNA single strands
[0258]
[0259] Take 1.0 equivalent of GalNAc-RNA single strand 2 into a 1.5 ml centrifuge tube, add 8-10 equivalents of 28% ammonia water, vortex, and react at room temperature for about 12-16 h. The reaction solution is prepared by HPLC and lyophilized to obtain a white powder, namely intermediate 3.
[0260] The preparation method is as follows: Waters e2695 HPLC (Luna® column 5 µm C18(2)) was used, with the mobile phase being A-20mM NH4HCO3 (pH approximately 7.5-7.8) and B-acetonitrile. Preparation method (B%): 0-5 min, 5% equilibration; 6-26 min, 8-23% gradient elution; 26-27 min, ramp to 95%; 27-32 min; The detection method is as follows: The purity of the positive chain and molecular weight of the above were detected using Waters Acquity UPLC-LTQLCMS (column: ACQUITY UPLC BEH C18). The measured values are consistent with the theoretical values, as shown in Table 1.
[0261] 2.1.4 siRNA double-strand annealing
[0262]
[0263] The annealing procedure was as follows: The purified sense and antisense strands were dissolved separately in water for injection to prepare solutions ranging from 0.1 mg / mL to 40 mg / mL. The solutions were then mixed in equimolar ratios using Thermo Scientific Nanodrop, heated at 95°C for 5 minutes, and then slowly cooled naturally to allow them to form a double-stranded structure through hydrogen bonds. Samples were taken and sent to test the SEC purity of the product (see Table 1). The double-stranded samples were lyophilized to obtain a white powder of double-stranded siRNA.
[0264] RG025001SS (5'-3')
[0265] NH2H 12 C6-UmsUmsUmUmAmAmUfCfCfUmCmAmCmUmCmUmAmAmAm
[0266] RG025002SS (5'-3')
[0267] UmsUmsUmUmAmAmUfCfCfUmCmAmCmUmCmUmAmAmAm-C6H 12 NH2
[0268] AS (antisense chain): (5'-3')
[0269] UmsUfsUmAmGmAfGmUmGmAmGmGmAmUfUmAfAmAmAmsUmsGm
[0270] Wherein: m, 2'-methoxy; f, 2'-fluorine; s, thiophosphate;
[0271]
[0272] The conjugates of different GalNAc molecules (compounds DM02001, DM02002, DM02003, DM02004 and DM02005) with siRNA and their characteristics are shown in Table 1 below.
[0273] Table 1. GalNAc-siRNA conjugate numbering and sequence information
[0274]
[0275] Note: SS refers to the Chain of Justice.
[0276] 2.2. In vivo activity assessment of GalNAc-conjugated superoxide dismutase 1 (SOD1) siRNA
[0277] The inhibitory activity of siRNA sequences conjugated to the GalNAc vector at the 3' or 5' end of the positive strand of siRNA on the target gene SOD1 in mice was evaluated using a mouse in vivo target gene inhibitory activity assessment method.
[0278] Six- to eight-week-old C57BL / 6j mice were randomly divided into 11 groups of five mice each, based on body weight. Each group of mice was administered the GalNAc-siRNA conjugate prepared in this embodiment via subcutaneous abdominal administration. The dosage of the GalNAc-siRNA conjugate per mouse was 1.0 mg / kg (based on siRNA), and the administration volume was 5 mL / kg of mouse body weight. The day of administration was designated as day 1 (D1). Mice were sacrificed on day 8 (D8), and liver tissue was collected for RNA extraction, reverse transcription, and Real-time PCR detection.
[0279] The primer sequences required for the experiment are shown in Table 2. The inhibitory activities of different GalNAc-siRNA conjugates on the target genes in mice are shown in Table 3. Figure 1 As shown.
[0280] Table 2 Primer sequence information
[0281]
[0282] Results are expressed as the level of mRNA inhibition in the siRNA-treated group compared to the solvent group (0% in the PBS solvent group). The siRNA sequences of the conjugates used for injection are shown in Table 1.
[0283] Table 3 shows the inhibitory activity of different GalNAc-siRNA conjugates on target genes in mice.
[0284]
[0285] Note: siRNA numbers are shown in Table 1 above.
[0286] From Table 3 and Figure 1As can be seen, GalNAc molecules, as delivery vectors, can effectively deliver siRNA into cells, thereby effectively exerting the inhibitory effect of siRNA on the target gene. The results of this embodiment show that siRNA conjugates RG027003, RG027005, RG027007, RG027009, and RG027011 with GalNAc vectors conjugated at the 5' end of the positive strand, and siRNA conjugates RG027004, RG027006, RG027008, RG027010, and RG027012 with GalNAc vectors conjugated at the 3' end of the positive strand, can all inhibit the target gene. Among them, the DM02002 conjugate RG027010 and the DM02001 conjugate RG027012, which use linkers with enhanced metabolic stability, have an inhibitory activity of over 80% (Table 3), which is significantly better than the natural β-O glycosidic bond-coupled DM02005 conjugate RG027003.
[0287] The above description is an implementation scheme designed for one case of the present invention. It should be noted that for those skilled in the art, several improvements can be made without departing from the principle of the present invention, and these improvements should also be considered within the scope of protection of the present invention.
Claims
1. A GalNAc molecule, characterized in that, The GalNAc molecule is specifically represented by formula I, or its optical isomer or racemate; in, R1 is hydrogen, a substituted or unsubstituted C1-C4 alkyl acyl group, or a substituted or unsubstituted C6-C8 aryl acyl group; X is -CH2-, -NH-, or O; Y is -C(O)- or -CH2-; n is 1, 2, 3, 4, 5 or 6; Ac represents the acetyl group.
2. The GalNAc molecule as described in claim 1, characterized in that, The GalNAc molecule is selected from the following group:
3. A vector for delivering nucleic acids, characterized in that, The carrier for delivering nucleic acids is specifically the structure shown in Formula II, or its optical isomer, or its racemic mixture; in, R1 is hydrogen, a substituted or unsubstituted C1-C4 alkyl acyl group, or a substituted or unsubstituted C6-C8 aryl acyl group; X is -CH2-, -NH-, or O; Y is -C(O)- or -CH2-; L represents a substituted or unsubstituted C1-C10 alkylene, cycloalkylene, or arylene group; n is 1, 2, 3, 4, 5 or 6; m can be 0, 1, 2, 3, 4, 5, or 6; Ac represents the acetyl group.
4. The vector for delivering nucleic acids as described in claim 3, characterized in that, Preferably, the vector for delivering nucleic acids is selected from the group consisting of:
5. Use of the vector for delivering nucleic acids as described in claim 3 in the preparation of delivery vectors for delivering nucleic acids.
6. A nucleic acid conjugate, said nucleic acid conjugate being formed by coupling a nucleic acid with a carrier for delivering nucleic acid as described in claim 3.
7. The nucleic acid conjugate as described in claim 6, characterized in that, The vector for delivering nucleic acid is coupled to the 5' or 3' end of the nucleic acid.
8. A composition comprising the nucleic acid conjugate as described in claim 6.
9. Use of the nucleic acid conjugate as claimed in claim 6 for the preparation of a composition or formulation for nucleic acid therapy.
10. A method of nucleic acid therapy, the method comprising administering the nucleic acid conjugate of claim 6 or the composition of claim 8 to a desired subject, thereby performing nucleic acid therapy.