PPAR gamma polypeptide and application thereof in monitoring marine perfluorooctanoic acid pollution

By using PPARγ peptides to prepare polyclonal antibodies and combining them with an ELISA kit, a highly sensitive immunofluorescence detection technology for PFOA was established, solving the problem of efficient and low-cost monitoring of PFOA pollution in the ocean and elucidating its multidimensional toxic effects.

CN121717875APending Publication Date: 2026-03-24YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-25
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficient and low-cost monitoring of perfluorooctanoic acid (PFOA) pollution in the ocean. Chemical detection methods and instrument platforms have stringent and expensive requirements, and while they offer high sensitivity, detection capabilities are concentrated in a few laboratories. The demand for biomarker technologies remains unmet.

Method used

Using PPARγ peptide as an antigen, polyclonal antibodies were prepared and combined with an ELISA kit to monitor PFOA contamination using immunofluorescence technology, thus establishing a highly sensitive PFOA immunofluorescence detection technology based on mussels.

Benefits of technology

It achieves highly sensitive monitoring of PFOA with a detection limit of 1.5 ng/L and a linear range of 5-80 ng/L, breaking through the limitations of single-level toxicity evaluation and providing a multi-dimensional elucidation of toxic effects. It is suitable for monitoring PFOA in environmental and biological samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121717875A_ABST
    Figure CN121717875A_ABST
Patent Text Reader

Abstract

The invention relates to a PPAR gamma polypeptide and application thereof in monitoring marine perfluorooctanoic acid pollution, and belongs to the technical field of biology, the amino acid sequence of the polypeptide is shown as SEQ ID NO.1, the invention further provides application of the PPAR gamma polypeptide in monitoring marine perfluorooctanoic acid pollution, and a high-sensitivity PFOA immunofluorescence detection technology is established based on the polypeptide. The lowest detection limit is 1.5 ng / L, the linear range interval is 5-80 ng / L, and an innovative method is provided for high-sensitivity monitoring of PFOA in environmental and biological samples.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to PPAR. γ Peptides and their application in monitoring marine perfluorooctanoic acid (PFOA) pollution. Background Technology

[0002] Perfluoroalkylated substances (PFAS) are a typical example of emerging pollutants and are among the most persistent organic pollutants (POPs) in the world, exhibiting widespread pollution in aquatic environments (Calafat et al., 2006). Perfluorooctanoic acid (PFOA) is a representative compound of PFASs, present in organisms at almost all trophic levels of the aquatic ecosystem food chain, with pollution levels reaching 10 in some domestic sea areas. -1 PFOA levels are in the mg / kg range, and their accumulation varies regionally and by species. PFOA accumulation in shellfish is significantly higher than in other species (averaging tens of μg / kg), indicating that PFAS, including PFOA, pose serious ecological and food safety risks. Toxicological studies have shown that most PFAS species exhibit reproductive toxicity, developmental toxicity, immunotoxicity, endocrine disruption, and potential carcinogenicity, causing adverse biological effects such as decreased body weight, increased liver weight, increased juvenile mortality, and increased susceptibility to disease-related deaths. However, due to the relatively recent focus on PFOA both domestically and internationally, toxicological research on PFOA in aquatic organisms, especially shellfish, is still relatively limited.

[0003] Marine pollution monitoring data often only reflects the enrichment degree of pollutants in water bodies or organisms, but cannot understand the stress effects of pollutants on organisms. Analyzing the stress effects of pollutants on indicator species requires the identification of a series of biological indicators. Among them, some indicators are sensitive to pollutants and have clear dose-response relationships, and can serve as "biomarkers" indicating the specific type or class of pollutants. More precisely, biomarkers are physiological, biochemical, cellular, and behavioral indicators that can reflect the effects of exposure to one or more chemical pollutants at the tissue, body fluid, or individual level. They can directly reflect the biotoxicity of polluted waters and have a good early warning effect on the early toxic effects of environmental pollutants. Currently, the main detection methods for PFOA in the environment and water bodies are chemical methods, including high-performance liquid chromatography / ultraviolet detection (HPLC-UVD), high-performance liquid chromatography-fluorescence detection (HPLC-FLD), high-performance liquid chromatography-mass spectrometry (HPLC-MS), and ultra-high-performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS), with detection limits reaching the ng / L level. However, while chemical detection methods offer high sensitivity, they require stringent instrumentation conditions and expensive standards, and especially demand highly skilled and experienced personnel. Therefore, only a few laboratories in China currently possess the capability to perform this detection, and the high cost limits large-scale PFOA testing. Consequently, sensitive, efficient, and more affordable biomarker technologies have emerged. Summary of the Invention

[0004] This invention addresses the above-mentioned technical problems by providing a peroxisome proliferator-activated receptor. γ (PPAR γ (Peptides and their application in monitoring marine perfluorooctanoic acid (PFOA) pollution. Previous studies have shown that PFOA has a strong accumulation capacity in bivalve mollusks, including mussels, significantly higher than in other aquatic species. Therefore, mussels are used as indicator organisms for monitoring marine environmental pollution.)

[0005] This invention is achieved through the following technical solution: A type of PPAR γ The polypeptide, wherein the amino acid sequence of the polypeptide is: KVERKLMADKEELE (SEQ ID NO.1); The present invention also provides the application of the said polypeptide as an antigen in monitoring marine perfluorooctanoic acid biomarkers.

[0006] The present invention also provides an ELSA kit containing the polypeptide antigen.

[0007] The present invention also provides the PPAR. γ Application of peptides in monitoring marine perfluorooctanoic acid (PFOA) pollution.

[0008] PPAR γ The application of peptides in monitoring marine perfluorooctanoic acid (PFOA) pollution is described below. (1) Prepare a polypeptide antigen using the polypeptide KVERKLMADKEELE, and then prepare a polyclonal antibody by rabbit immunization; (2) Modify the molecular structure of PFOA to prepare modified PFOA small molecules; Further, a method for molecularly modifying PFOA was described. 0.414 g of PFOA, 10 mL of N,N-dimethylformamide (DMF), and 0.417 g of O-benzotriazole-tetramethylurea hexafluorophosphate (HBTU) were added to a container and stirred at room temperature until fully dissolved, then cooled in an ice bath. Next, 0.2 g of unilateral Boc-pentanediamine and 0.2 mL of N,N-diisopropylethylamine (DIEA) were added, and the mixture was stirred overnight at room temperature. After extraction with an ethyl acetate / water mixture, the organic layer was dried, and a colorless oil was obtained by high-performance liquid chromatography (HPLC). 20 mL of 20% trifluoroacetic acid / dichloromethane (TFA / DCM) was added, and the mixture was stirred for at least 1 h, suspended, and the product was obtained by HPLC.

[0009] (3) The modified PFOA small molecule was coupled with the carrier protein (bovine serum albumin, abbreviated as BSA) to obtain the PFOA-BSA hapten; Furthermore, the coupling process is as follows: PFOA and BSA are coupled using the glutaraldehyde method; Solution I (50 mg PFOA, 0.3 mL methanol, 0.6 mL distilled water) and Solution III (100 µL 25% glutaraldehyde, 5 mL distilled water) are added dropwise to Solution II (100 mg hapten, 5 mg BSA, 350 µL 10 mM pH 7.2 PBS buffer solution), and stirred overnight; then the overnight stirred sample is placed in a dialysis bag, and the dialysis bag is placed in 10 mM PBS buffer solution at pH 7.2 to suspend the sample in the dialysis solution; for the first 12 hours, the dialysis solution is changed every two hours; for the remaining time, it is changed every 6 hours until dialysis is complete; the sample is stored at 4°C for later use.

[0010] (4) Establish a standard curve using PFOA-BSA hapten preparation; Furthermore, the process of establishing the standard curve is as follows: 4.1 Combine the conjugated PFOA-BSA hapten with PPAR γ Polyclonal antibodies were diluted 1:400 using 5% BSA solution. After incubation overnight at 4°C, the supernatant was discarded, and the antibodies were washed and ready for use. 4.2 Extraction of a mixture of cell nuclear proteins from fresh tissue samples of mussel visceral mass; 4.3 Preparation of PFOA standard solutions: Dissolve PFOA dry powder in 0.05% DMSO to prepare solutions with concentrations of 5, 10, 25, 50, 80, 100, and 150 μg / L, respectively, with 0.05% DMSO as a control; 4.4 Competitive binding: Cell nuclear protein extracts and PFOA standards of different concentrations were added to an ELISA plate incubated with a quantitative PFOA-BSA hapten, resulting in competitive binding; 4.5 PPAR γ Antibody capture PPAR γ -RXR complex: Add the supernatant from the reaction in section 4.4 to the mixture incubated with PPAR γ In the antibody-labeled ELISA plate, after shaking the reaction, wash. 4.6 Biotin probe, PPAR γ -RXR complex binding: Add cell culture grade PBS buffer and nuclear protein to the ELISA plate in step 4.5 and incubate at room temperature for half an hour, then add double-stranded probe and oscillate; the nucleotide sequence of the double-stranded probe is (positive strand SEQ ID NO.2: 5'AAAAACTGGGTCAAAGGTCT3'; sense strand SEQ ID NO.3: 5'AGACCTTTGACCCAGTTTTT3'). 4.7 Binding of probe to quantum dot fluorescent microspheres: Add the diluted quantum dot fluorescent microsphere solution to each well of the ELISA plate in 4.6, shake in the dark, and then wash with sufficient ELISA washing buffer; 4.8 Using a multi-functional microplate reader, selecting Endpoint reading mode, the microplate prepared in 4.7 was detected using excitation light at 370 nm, emission light at 650 nm, and a step size of 10 nm. The fluorescence intensity corresponding to different concentrations of PFOA standards was recorded, and a PFOA concentration-fluorescence intensity standard curve was constructed, with the formula: y = 19.112x - 23.995, R 2 = 0.9456; y is the ordinate, representing relative fluorescence intensity, x is the abscissa, representing PFOA concentration, R 2 The coefficient of determination reflects the degree of fit of the regression equation; the closer its value is to 1, the higher the degree of fit.

[0011] The advantages of this invention compared to existing technologies: This invention systematically elucidates the toxic effects and harmful mechanisms of PFOA on mussels at different levels, including molecular, histological, and metabolite levels, overcoming the limitations of previous single-level toxicity evaluations. Based on PPAR in mussels... γIt has a specific regulatory effect on PFOA, and PPAR was first proposed. γ This suggests that PPARγ may be a specific binding receptor for PFOA, and further, specific binding sites for PFOA and PPARγ in shellfish were identified. Based on these findings, a polypeptide of a polyclonal antibody against PPARγ was successfully designed and prepared. A highly sensitive immunofluorescence detection technique for PFOA was established based on this polypeptide, with a limit of detection of 1.5 ng / L and a linear range of 5-80 ng / L. This provides an innovative method for highly sensitive monitoring of PFOA in environmental and biological samples. Attached Figure Description

[0012] Figure 1 Electrophoresis diagram of the PCR amplification products of the PPARγ gene; Figure 2 Figure 1 shows the construction and verification of the PPARγ prokaryotic expression vector; where A represents the result of expression vector construction, B represents the result of PPARγ restriction enzyme digestion identification of recombinant expression plasmid pET30a(+), M: marker; 1: result of double enzyme digestion of recombinant expression plasmid. Figure 3 Figure 1 shows the identification of induced expression of recombinant PPARγ protein. M1: Protein marker; PC1: BSA (1 μg); PC2: BSA (2 μg); NC: Uninduced whole cells; 1: Whole cells induced at 15℃ for 16 h; 2: Whole cells induced at 37℃ for 4 h; NC1: Uninduced cell lysis supernatant; 3: Cell lysis supernatant induced at 15℃ for 16 h; 4: Cell lysis supernatant induced at 37℃ for 4 h; NC2: Uninduced cell lysis pellet; 5: Cell lysis pellet induced at 15℃ for 16 h; 6: Cell lysis pellet induced at 37℃ for 4 h. Figure 4 A diagram showing the predicted epitopes of the PPARγ recombinant protein antigen; Figure 5A This is the structural diagram of PFOA small molecules before modification; Figure 5B The mass spectrum and structural diagram of the modified small molecule; Figure 6 This is a UV spectrum scan of a small molecule after hapten conjugation. Figure 7 This is a standard curve of PFOA concentration versus fluorescence intensity. Detailed Implementation

[0013] The technical solution of the present invention will be further explained below through embodiments, but the scope of protection of the present invention is not limited in any way by the embodiments.

[0014] Example 1 This embodiment demonstrates the effect of PFOA on mussels (… Mytilus edulis Toxicological experiments were conducted to explore the mechanism of toxicity of PFOA. Semi-static exposure to 0, 20, 200, and 2000 μg / L PFOA for 14 days, followed by a 7-day recovery period in clean water, was performed. The accumulation and residue of PFOA in five tissues of *Mussela purpurea*—gills, visceral mass, mantle, gonads, and adductor muscle—were detected. At the histological level, the damage of PFOA to the visceral mass of *Mussela purpurea* was identified; at the enzyme activity level, the effect of PFOA on the antioxidant system was detected; and further, transcriptomic and metabolomic association analyses were used to explore the harmful mechanism of PFOA on *Mussela purpurea*. Preliminary screening of PFOA biomarkers was also conducted at the molecular level.

[0015] Transcriptomic and metabolomic association analyses identified key gene changes and major metabolites caused by PFOA stress (Table 1). It can be seen that PFOA significantly affected the metabolic pathways of *Mussela purpurea*, with several typical pathways showing marked alterations. The most significant changes were in fatty acid metabolism, amino acid synthesis and metabolism, glycolysis, and the central carbon cycle. Correlating these changes with transcriptomic analysis revealed that in the 14-day exposure group, the oxidative damage system closely related to detoxification metabolism showed significant changes at both the transcriptional and protein levels. After one week of recovery in clean water, some indicators or gene expression levels slightly recovered, but failed to return to the control group levels. Table 1 shows some important differentially expressed gene / metabolite changes. ; In this embodiment, PPAR γ The expression level of PPAR increased by 3.7-fold, and the enrichment pathway diagram of differentially expressed genes in KEGG showed that PPAR... γ Differential gene expression regulates the transcription of key downstream genes, thereby affecting metabolic pathways such as those for sugars, lipids, and amino acids, thus enabling mussels to detoxify PFOA. Therefore, based on the above findings, we screened PPAR... γ As a potential biological response factor of PFOA in bivalves.

[0016] Example 2 This example utilizes the PPAR of the mussel obtained from transcriptome sequencing in Example 1. γ The sequence was identified as a potential target for PFOA in bivalve mollusks. Sequencing and homology alignment confirmed that the sequence indeed represents the PPAR of the mussel. γThe sequence retained both the ligand-binding domain and the DNA-binding domain. This sequence was then expressed in prokaryotes, and Western blotting confirmed its identity as the target protein. Hydrophobicity and antigenicity analyses were performed on the obtained peptides, and the peptide sequence (SEQ ID NO.1 KVERKLMADKEELE) was selected to prepare a peptide antigen, ultimately yielding a purified specific antibody with a titer exceeding 512K. A PPAR-based antibody was also established using mussels. γ An immunoassay technique for PFOA sequences was developed. This technique showed the best detection performance in the PFOA concentration range of 5 ng / L-80 ng / L, with a spiked recovery rate of 98.98%-101.23% and a limit of detection of 1.5 ng / L.

[0017] 1. Experimental reagents and instruments Experimental reagents: PFOA standard was purchased from Sigma-Aldrich (Shanghai), with a purity of 99.7%; DMSO was purchased from Sigma-Aldrich (Shanghai); ethanol, chloroform, isopropanol, and Trizol were all domestically produced analytical grade reagents, purchased from Sinopharm Group.

[0018] Major instruments: Cryo-Grinding Analyzer (Spex, USA); 3K15 Refrigerated Centrifuge (Sigma, USA); Lifetouch Gradient PCR System (Bioer, Germany); Water Bath (Shanghai Jinghong Experimental Equipment Co., Ltd.); Constant Temperature Shaking Incubator (Shanghai Zhicheng Analytical Instrument Manufacturing Co., Ltd.); Horizontal and Vertical Electrophoresis System (Shanghai Zhicheng Analytical Instrument Manufacturing Co., Ltd.); Sterilizer (Shanghai Shenan Medical Instrument Factory); Magnetic Stirrer (Jiangsu Guohua Instrument Factory); Multifunctional Microplate Detector (MD, USA).

[0019] 2. Biological materials: The experimental material was mussels (average shell length 44.1 ± 1.0 mm), purchased from Qingdao Jinhuangwan Aquaculture Company. Healthy female New Zealand white rabbits, 4 months old, with an average weight of approximately 2.1 kg.

[0020] 3 Experimental Methods 3.1 Prokaryotic expression: RNA was extracted from the samples, and cDNA was obtained through reverse transcription. PCR primers were designed using Primer 6.0 software, and Oligo 7 software was used to verify that the primers followed general principles of PCR primer design. Restriction sites and protective base sequences were added to the 5' and 3' ends of the primers. Primer sequences are shown in Table 2; the PCR amplification reaction system is shown in Table 3. Table 2 Primer sequences ; Table 3. Reaction system for PCR amplification .

[0021] PCR amplification conditions: 98℃ for 3 min; 98℃, 20 s, 55℃, 10 s, 72℃, 30 s, 32 cycles, 72℃ for 2 min.

[0022] 3.2 Validation and gel recovery of PCR products The PCR products were subjected to 1.2% agarose gel electrophoresis. The electrophoresis conditions were 110 V AC for 32 minutes.

[0023] Gel recovery: Under UV light irradiation, the gel at the target band was rapidly and accurately removed using a surgical scalpel. 0.1 g of solid gel was weighed and transferred to a pre-sterilized EP tube using forceps. 300 µL of Buffer MB was added, and the tube was placed in a 37°C water bath and heated for 15 minutes. After the gel had completely dissolved, the solution was allowed to return to room temperature. Subsequent gel removal and recovery were then performed.

[0024] Electrophoresis results of the PCR product showed a single bright band at approximately 1000 bp, consistent with the predicted value, preliminarily indicating that the PCR amplification product may be the target gene. Figure 1 Sequencing and alignment revealed that the sequence was highly identical to the mussel PPARγ sequence annotated by NCBI, with an identity rate of 97.97%. Furthermore, conserved domain alignment showed that the sequence possesses the complete DNA-binding domain and ligand-binding domain of the nuclear receptor protein family, suggesting that it has the function of a nuclear receptor protein gene.

[0025] 3.3 Connection and Transformation Reactions Connection: Add the reagents shown in Table 4 sequentially, and react at 16 °C for 45 minutes; Table 4 Connection Reaction System ; Transformation: Remove 1 mL of frozen competent cells from the -80℃ freezer and thaw on ice. Add 10 μL of the mixture from the above reaction system, incubate on ice for 30 minutes, then place in a 42℃ water bath for 90 seconds, followed by cooling on ice for 2 minutes. Add 1200 mL of SOC medium and incubate at 37℃ with shaking for 2 hours.

[0026] 3.4 Blue-white screening Preparation of selective medium: Prepare fresh LB solid medium and spread 40 μL of X-GAL and 20 μL of IPTG evenly in a 2:1 ratio under light-protected conditions.

[0027] Screening: After shaking culture, the bacterial culture was centrifuged at 8000 rpm for 5 min. 50 μL of the supernatant was used to resuspend the bacterial pellet and spread onto a selective medium. The medium was sealed and incubated overnight (approximately 15 hours) by inversion. Single white colonies with a diameter of 1 mm or more were picked and inoculated into fresh liquid medium. The bacterial culture was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing.

[0028] 3.5 Construction and double enzyme digestion identification of expression vector The bacterial culture that matched the target gene in the sequencing results from Shanghai Sangon Biotech was returned to the laboratory for plasmid extraction.

[0029] The double enzyme digestion system is shown in Table 5. Incubate overnight at 37°C, then at 65°C for 10 minutes. Table 5 Double enzyme digestion system ;

[0030] The double enzyme digestion procedure for the PET30a plasmid is the same as above. After electrophoresis and gel recovery, the ligation and transformation of BL21 recipient bacteria are performed. The transformed bacterial culture is plated onto LB selective medium containing 100 mg / L kanamycin and cultured for 12-16 hours. Single colonies larger than 1 mm are picked and cultured in liquid medium at 37°C with shaking. The culture is then sent to Shanghai Sangon Biotech for sequencing. After successful identification, the bacterial strain is stored at -80°C.

[0031] After double digestion of the PCR product and plasmid with NCOI and NOTI restriction endonucleases, the target gene was inserted into the multiple cloning site region of PET30a, and the constructed expression vector was as follows: Figure 2 As shown in A in the diagram. Figure 2 B in the figure represents the result of double digestion (NCOI, NOTI) of the extracted recombinant plasmid. Identification results showed that two fragments appeared after digestion: one approximately 1059 bp, consistent with the size of the PCR amplification product; the other fragment was identical to plasmid pET30a(+), indicating that pET30a(+) → PPAR... γ The recombinant plasmid was successfully constructed.

[0032] 3.6 Bacterial Induced Expression Incubate at 37℃ with shaking at 200 rpm until OD... 600When the expression threshold reaches 0.6–0.8, 10 μL of 0.5 mM IPTG is added to induce expression. Two induction conditions are used: 15℃ for 16 hours and 37℃ for 4 hours. After induction, the bacterial culture is centrifuged at 8000 rpm, and the cell pellet is resuspended in lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 5% glycerol) and sonicated for 1 minute. 80 μL of the sonicated mixture is mixed with 20 μL of 5× loading buffer, heated at 100℃ for 10 minutes, and centrifuged at 15000 rpm for 5 minutes. 200 μL of the sonicated mixture is centrifuged at 15000 rpm for 10 minutes. 50 μL of 5× loading buffer is added to 200 μL of supernatant to obtain the supernatant sample. The pellet is resuspended in 50 μL of 5× loading buffer to obtain the inclusion body sample. The sample is heated at 100℃ for 10 minutes, centrifuged at 15000 rpm for 5 minutes, and stored for later use.

[0033] The amino acid sequence information was input into the Protaram database of Expasy to predict the physicochemical properties of the protein. The prediction results showed that the peptide contains 354 amino acids, with leucine being the most abundant. The relative molecular mass of the peptide is approximately 42 kDa, and its isoelectric point is approximately 8.73. The molecular formula is C1. 1834 H 2936 N 516 O 516 S 24 Hydrophilicity / hydrophobicity predicts this protein to be hydrophobic. The instability index is 50.79, indicating relatively weak stability.

[0034] 3.7 SDS-PAGE and Western Blot The samples prepared in 3.6 were subjected to SDS-PAGE. The SDS-PAGE results showed that the target protein was not significantly induced to express in the recipient bacteria. To further verify the expression status, Western blotting was used.

[0035] Because the recombinant expression vector has 6×histidine tags both upstream and downstream of the multiple cloning site region, the primary antibody used in Western blotting is a histidine antibody. Figure 3 The results show a single band at approximately 42 kDa, which is consistent with previous expectations for the molecular weight of the recombinant protein. This proves that the expressed protein is the target protein.

[0036] Antigenic epitope prediction based on recombinant protein amino acid sequence information ( Figure 4The predictive indicators include hydrophilicity, flexibility, surface accessibility, and antigenic index. Purple represents hydrophilicity; the stronger the hydrophilicity, the more easily the peptide appears on the protein surface. Light blue represents flexibility; yellow represents surface accessibility; and pink represents the antigenic index. A peptide with high values ​​for all four indicators (SEQ ID NO.1 KVERKLMADKEELE) was selected as a potential antigenic epitope, and the polypeptide was biosynthesized for use in the next step of preparing polyclonal antibodies.

[0037] 3.8 Preparation of polyclonal antibodies and ELISA detection Immunization procedure: New Zealand white rabbits were immunized with Freund's complete adjuvant (750 mL) and the synthesized polypeptide antigen (400 µg). The interval between the first and second immunizations was 20 days, and the interval between the two subsequent booster immunizations was 14 days. On day 8 after the completion of the four immunizations, blood was collected from the carotid artery of the experimental rabbits, and the serum titer was detected by ElISA.

[0038] The primary antibody was diluted 1:1000, and subsequently diluted at different ratios (1:2000, 1:4000, 1:8000, etc.) with the rabbit serum. The secondary antibody was horseradish enzyme-labeled goat anti-rabbit IgG (H+L) antibody diluted 1:7500. After incubation and washing, the chromogenic substrate solution was added. After reacting for 20 minutes, an appropriate amount of 2 M sulfuric acid solution was added to stop the reaction. Then, 200 ml of the solution was taken, and its absorbance at 455 nm was measured to calculate the antibody titer.

[0039] The titer of the prepared polyclonal antibodies was determined using ELISA. The absorbance of the samples at 450 nm was measured, and a P / N ratio > 2.1 was used as the criterion for a positive result. Where P = absorbance of the diluted serum - absorbance of the blank; N = absorbance of the negative serum - absorbance of the blank. As shown in Table 6, when the serum dilution ratio was 1:512000, P / N = 8. Therefore, the polyclonal antibody titer was at least 1:512000, indicating a high antibody titer. Table 6. Results of indirect ELISA detection of antiserum titers ; .

[0040] 3.9 Modification and Coupling of PFOA Small Molecules In a 100 mL Erlenmeyer flask, add 0.414 g of PFOA, 10 mL of DMF, and 0.417 g of HBTU. Stir until fully dissolved at room temperature, then cool in an ice bath. Next, add 0.2 g of unilateral Boc-pentanediamine and 0.2 mL of DIEA, and stir overnight at room temperature. After extraction with an ethyl acetate / water mixture, dry the organic layer and prepare a colorless oil by high-performance liquid chromatography (HPLC). Add 20 mL of 20% TFA / DCM, stir for at least 1 h, suspend to dryness, and prepare the product by HPLC.

[0041] Mass spectrometry was used to identify the modified small molecules. The results showed two relatively distinct peaks: the substance at a relative molecular mass of 401 was the raw material PFOA, while the target relative molecular mass (498) had a single peak. Figure 5B The results are consistent with the predicted relative molecular mass of the modified small molecule, indicating that the PFOA small molecule modification was successful. The structural diagrams of the small molecule before and after modification are shown below. Figure 5A and Figure 5B .

[0042] The glutaraldehyde method was used to couple the carrier protein with the PFOA small molecule.

[0043] Add the magnetic rotor to the beaker. Under magnetic stirring at room temperature, add solution I (50 mg PFOA small molecule, 0.3 mL methanol, 0.6 mL distilled water) and solution III (100 µL 25% glutaraldehyde, 5 mL distilled water) dropwise to solution II (100 mg modified PFOA small molecule, 5 mg BSA, 350 µL 10 mM pH 7.2 PBS buffer solution) and stir overnight. Boil the dialysis bag first, then place the overnight stirred sample into the dialysis bag and clamp the bag tightly on both sides. Use 10-15 times the volume (200 mL) of pH 7.2 10 mM PBS buffer solution to suspend the sample. Change the dialysis solution every two hours for the first 12 hours, and every 6 hours thereafter until dialysis is complete. Store at 4°C for later use.

[0044] The modified small molecule, BSA, and the product resulting from the coupling of the small molecule and BSA were all diluted to 1 mg / mL, and UV spectra were performed. Scanning curves were then plotted. Figure 6 As shown in the figure. The coupling ratio was calculated according to the coupling ratio calculation formula, and the results showed that the coupling ratio between the modified PFOA small molecule and BSA was as high as 26:1.

[0045] 4. Establishment of immunofluorescence technique Fresh tissue samples from the visceral mass of mussels were minced and mixed with 3 to 5 volumes of collagenase P working solution (prepared from collagenase P dry powder and TESCA buffer). The mixture was incubated at 37°C and 180 rpm for 30 minutes. After sufficient enzymatic hydrolysis, a tissue homogenate composed of cytoplasmic extraction reagent was added, and the mixture was placed on ice and homogenized thoroughly for 15 minutes. The mixture was then centrifuged, and the supernatant was discarded. Nuclear protein extraction reagent was added, and the mixture was vortexed at 3000 rpm for 2 minutes to fully suspend the precipitate. The mixture was then incubated on ice for 1-2 minutes, followed by vigorous shaking for 15-30 seconds. This process was repeated until a total of 30 minutes was reached. The vortexed solution was centrifuged at 4°C and 12000 rpm for 10 minutes, repeated twice. The supernatant, containing the mixture of nuclear proteins from the tissue, was collected and stored at -80°C for later use.

[0046] Establishment of the standard curve: The PFOA-BSA hapten and PPAR have been coupled together. γ Polyclonal antibodies were diluted 1:400 with 5% BSA solution. The plates were incubated overnight at 4°C, and the supernatant was discarded. 250 μL of ELISA washing buffer was used for three repeated washings with shaking, each lasting 5-10 minutes. After washing, any remaining liquid in the plate was gently patted onto absorbent paper. Then, 5% BSA blocking buffer was added, and the plate was shaken at 37°C and 120 rpm for 2 hours. The plates were then washed using the same method described above, and finally stored at 4°C for later use.

[0047] Preparation of PFOA standard solutions: Dissolve PFOA dry powder in 0.05% DMSO to prepare solutions with concentrations of 5, 10, 25, 50, 80, 100, and 150 μg / L, respectively. Use 0.05% DMSO as a control.

[0048] Synthesis of the double-stranded probe: The 5 OD biotin-labeled probe sequence was synthesized and quality-controlled by Shanghai Sangon Biotech Co., Ltd., and diluted with 10 μL of 10 mM sterile TAE buffer. The nucleotide sequence of the double-stranded probe is (positive strand SEQ ID NO. 2: 5'AAAAACTGGGTCAAAGGTCT3'; sense strand SEQ ID NO. 3: 5'AGACCTTTGACCCAGTTTTT3'). After dilution, the positive and negative strands were mixed at a 1:1 ratio in a PCR instrument, and the following conditions were set: 94°C for 1 min, 72°C for 3 min, 55°C for 3 min, 40°C for 2 min, and 10°C for 3 min. It was stored at 4 ºC for later use.

[0049] Preparation of fluorescent dye: Quantum dot fluorescent microspheres were diluted with TBS buffer at a ratio of 1:1000 and stored in a 4ºC refrigerator protected from light for later use.

[0050] The specific operating procedure is as follows: 4.1 Competitive Binding: 4 μL of nuclear protein extract and 200 μL of PFOA standards at different concentrations were added to an ELISA plate incubated with a quantitative amount of small molecule hapten, resulting in competitive binding. The reaction was incubated with shaking for 2 hours under the same conditions as the blocking procedure. 4.2 PPAR γ Antibody capture PPAR γ -RXR complex: Take the supernatant from the competitive binding reaction in step 4.1 and add it to the mixture incubated with PPAR. γ In the antibody-labeled ELISA plate, shake for 2 hours under the same conditions as above. Wash 3 times. 4.3 Biotin probe, PPAR γ - RXR complex binding: Add 200 μL of cell culture grade PBS buffer and 2 μL of nuclear protein to the ELISA plate in section 4.2, incubate at room temperature for half an hour, then add 4 μL of the double-stranded probe and shake at 37ºC and 120 rpm for 1 hour. 4.4 Binding of probe to quantum dot fluorescent microspheres: Add 200 μL of diluted quantum dot fluorescent microspheres to each well of the ELISA plate in step 4.3, shake at 4ºC in the dark for 2.5 hours, and then wash 5 times with sufficient ELISA washing buffer to ensure that free probes are washed away; 4.5 Construction of Standard Curve: Using a multi-functional microplate reader, select Endpoint reading mode, excitation light 370 nm, emission light 650 nm, and step size 10 nm for detection. Record the fluorescence intensity corresponding to different concentrations of PFOA standards to construct a standard curve.

[0051] Different concentrations of PFOA standard will excite quantum dot fluorescent microspheres to emit signals of different fluorescence intensities. Based on the different fluorescence intensity signals, a PFOA concentration-fluorescence intensity standard curve was constructed. Figure 7 The formula is y = 19.112x - 23.995, R 2 = 0.9456). R 2 The coefficient of determination, R, is used to estimate the goodness of fit of the regression equation. 2 The closer R is to 1, the better the fit. In this experiment, R... 2 The correlation coefficient (CQC) was 0.9456, indicating a good correlation between PFOA concentration and fluorescence intensity. The optimal linear range for this method was 5–80 ng / L, with a limit of detection of 1.5 ng / L, a recovery rate of 105.8%, and good reproducibility.

[0052] Example 3 Six farmers' markets with relatively concentrated populations and high consumption of aquatic products were selected as sampling points along the Jiaozhou Bay waters. Through traceability, it was ensured that these commercially available shellfish all came from nearby waters.

[0053] Thirty shellfish of each of the two species were collected from different sampling points and temporarily stored in tanks filled with seawater. Upon returning to the laboratory, they were immediately dissected, the edible parts were extracted, ground with liquid nitrogen, and stored in a -80°C freezer.

[0054] The chemiluminescent immunoassay technique established in this invention was used to detect and apply samples from the aforementioned different sources, and the results were validated using traditional liquid chromatography-mass spectrometry (LC-MS). The following is the verification process for the LC-MS method.

[0055] To prevent interference with background values, all experimental equipment in this experiment was made of polypropylene, ensuring it did not contain fluorinated components such as polytetrafluoroethylene or fluorinated polyurethane. All equipment was thoroughly rinsed with methanol and ultrapure water and dried before the pretreatment experiments.

[0056] Liquid chromatography / mass spectrometry conditions were performed according to the method of Cui et al. (Cui et al., 2019). Before sample detection, a blank test was conducted on the reagents and equipment to calculate the blank value. The final experimental data were the results after blank value correction. The limit of detection was determined with a signal-to-noise ratio of 3. The correlation coefficient (R0) of the PFOA standard curve was calculated. 2 The value was 0.99958, and the sample concentration range was 0.0100-20.0 µg·kg⁻¹. − The detection accuracy is best at this time, with a detection limit of 3 ng·kg. −1 The spiked recovery rate was 97.4%-103.6%.

[0057] Place 2 g of sample in an 18 mL centrifuge tube, add dimethyl methacrylate (DMSO) and mix well. Adjust the pH to 2.0 with 1:1 hydrochloric acid. Add 0.1 mL of freshly prepared pepsin solution (0.1 g pepsin in 0.1 M hydrochloric acid) to the centrifuge tube, place in a 37°C water bath shaker, and shake at 120 rpm for 2 h to simulate gastric digestion. Transfer the gastric juice to a 50 mL centrifuge tube and centrifuge at 13500 rpm for 30 min. Repeat three times. Collect the supernatant. The PFOA contained in this supernatant is the PFOA that can be absorbed and utilized by the human body in gastric juice.

[0058] Take 0.5 mL of the supernatant, add 3 mL of ddH2O, vortex for 1 min, shake for 15 min, and mix thoroughly. Centrifuge at 4℃ for 30 min at 8500 rpm. Activate the Oasis HLB (30 μm) column beforehand by sequentially passing it through 3 mL of methanol and 3 mL of deionized water. Pass the resulting supernatant through the column, then rinse thoroughly with 3 mL of 10% methanol aqueous solution and discard. Accurately pipette 3 mL of methanol to elute the target analyte, controlling the flow rate at 1-2 drops per second. Vortex the eluent, filter 1 mL through a 0.2 μm microporous membrane into a sample vial, and prepare for analysis.

[0059] Table 7 shows the PFOA accumulation in shellfish from different sampling points. The PFOA accumulation in clams from different sampling points ranged from 0.17 to 3.09 µg·kg. −1 The PFOA accumulation in scallops ranged from 0.23 to 3.36 µg·kg⁻¹. −1 The results of the two detection methods showed no significant difference. Table 7. Detection of PFOA accumulation in shellfish at different sampling points using the technique of this invention and liquid chromatography. ; .

Claims

1. A PPAR γ polypeptide, characterized in that, The amino acid sequence of the polypeptide is shown in SEQ ID NO.

1.

2. The PPAR as described in claim 1 γ Application of peptides as antigens in monitoring marine perfluorooctanoic acid (PFOA) pollution.

3. The PPAR according to claim 2 γ The application of peptides in monitoring marine perfluorooctanoic acid (PFOA) pollution is characterized by, The application method is as follows: (1) Using PPAR γ Polypeptides are used to prepare polypeptide antigens, which are then used to prepare polyclonal antibodies via rabbit immunization. (2) Modify the molecular structure of PFOA to prepare modified PFOA small molecules; (3) The modified PFOA small molecule was coupled with bovine serum carrier protein to obtain PFOA-BSA hapten; (4) Establish a standard curve using PFOA-BSA hapten preparation.

4. The application according to claim 3, characterized in that, In (2), the method for molecularly modifying PFOA involves adding 0.414 g of PFOA, 10 mL of N,N-dimethylformamide, and 0.417 g of O-benzotriazole-tetramethylurea hexafluorophosphate to a container, stirring at room temperature until fully dissolved, and then cooling in an ice bath; then adding 0.2 g of unilateral Boc-pentanediamine and 0.2 mL of N,N-diisopropylethylamine, stirring at room temperature overnight; after extraction with an ethyl acetate / water mixture, the organic layer is dried, and a colorless oil is obtained by high performance liquid chromatography; 20 mL of 20% trifluoroacetic acid / dichloromethane is added, stirred, suspended, and the product is obtained by high performance liquid chromatography.

5. The application according to claim 3, characterized in that, The coupling process is as follows: PFOA and BSA are coupled using the glutaraldehyde method; solutions I and III are added dropwise to solution II and stirred overnight; the overnight stirred sample is then placed in a dialysis bag, and the dialysis bag is placed in 10 mM PBS buffer at pH 7.2 to suspend the sample in the dialysis solution; the dialysis solution is changed every two hours for the first 12 hours; for the remaining time, it is changed every 6 hours until dialysis is complete; the sample is stored at 4°C for later use; solution I consists of 50 mg PFOA, 0.3 mL methanol, and 0.6 mL distilled water; solution III consists of 100 µL 25% glutaraldehyde and 5 mL distilled water; solution II consists of 100 mg of modified PFOA, 5 mg BSA, and 350 µL 10 mM pH 7.2 PBS buffer solution.

6. The application according to claim 3, characterized in that, The process of establishing the standard curve is as follows: Step 1: Combine the conjugated PFOA-BSA hapten with PPAR γ The polyclonal antibodies were diluted 1:400 by volume with 5% BSA solution; incubated overnight at 4°C, the supernatant was discarded, and the antibodies were washed and ready for use. Step 2: Extract a mixture of cell nuclear proteins from fresh tissue samples of mussel visceral mass; Step 3: Prepare PFOA standard solutions: Dissolve PFOA dry powder in 0.05% DMSO to prepare solutions with concentrations of 5, 10, 25, 50, 80, 100, and 150 μg / L, respectively, with 0.05% DMSO as a control. Step 4, Competitive Binding: Add the cell nuclear protein extract and PFOA standard solutions of different concentrations to the ELISA plate incubated with a quantitative PFOA-BSA hapten, and competitive binding occurs; Step 5, PPAR γ Antibody capture PPAR γ -RXR complex: Add the supernatant from the reaction in section 4.4 to the mixture incubated with PPAR γ In the antibody-labeled ELISA plate, after shaking the reaction, wash. Step 6, Biotin probe, PPAR γ Binding of the RXR complex: Add cell culture grade PBS buffer and nuclear protein to the ELISA plate in step 4.5 and incubate at room temperature for half an hour, then add the double-stranded probe and oscillate; the nucleotide sequence of the double-stranded probe is shown in SEQ ID NO.2-3; Step 7, binding of probe to quantum dot fluorescent microspheres: Add diluted quantum dot fluorescent microsphere solution to each well of the ELISA plate in step 4.6, shake in the dark, and then wash with sufficient ELISA washing buffer; Step 8: Using a multi-functional microplate reader, select Endpoint reading mode and perform detection on the microplate prepared in step 4.7 using excitation light at 370 nm, emission light at 650 nm, and a step size of 10 nm. Record the fluorescence intensity corresponding to different concentrations of PFOA standards, and construct a PFOA concentration-fluorescence intensity standard curve with the formula: y = 19.112x - 23.995, R 2 = 0.9456; y is the ordinate, representing relative fluorescence intensity, x is the abscissa, representing PFOA concentration, R 2 The coefficient of determination reflects the degree of fit of the regression equation; the closer its value is to 1, the higher the degree of fit.

7. An ELSA kit, characterized in that, The kit contains the polypeptide of claim 2, which is used as an antigen.

Citation Information

Patent Citations

  • Enzyme-linked immunologic detection method of full fluorine caprylic acid

    CN101413944A