Saccharomyces cerevisiae HLKJ-002, fungicide, fermentation culture, feed and application of saccharomyces cerevisiae HLKJ-002
By developing the HLKJ-002 strain of Saccharomyces cerevisiae adapted to the rumen of dairy cows and optimizing the fermentation process, the problems of weak colonization ability and high cost of yeast cultures in dairy farming have been solved, thereby improving the rumen microecology and resource utilization, and enhancing milk production performance and health indicators.
Patent Information
- Application Number
- CN202511843709.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-09
- Publication Date
- 2026-03-24
AI Technical Summary
In current dairy farming, commercially available yeast cultures do not use strains specifically screened for the rumen environment of dairy cows, resulting in weak colonization ability, unstable effects, high preparation costs, low raw material utilization, and serious waste of resources.
A *Saccharomyces cerevisiae* strain HLKJ-002 adapted to the rumen environment of dairy cows was developed. Using corn deep-processing by-products as the main raw material, a fermentation culture was prepared through a solid-state fermentation process of 'anaerobic followed by aerobic', ensuring a viable count of ≥10⁸ CFU/g, and applied to the feed of lactating dairy cows.
It significantly improves the rumen microecology of dairy cows, increases milk yield and quality, reduces the incidence of mastitis, lowers production costs, and enables resource utilization, making it suitable for large-scale dairy farming.
Abstract
Description
Technical Field
[0001] This invention relates to the intersection of biotechnology and animal husbandry, specifically to a brewer's yeast HLKJ-002, a microbial agent, a fermentation culture, feed, and their applications. Background Technology
[0002] In dairy farming, rumen microecological balance is a core factor affecting the digestion, absorption, health, and production performance of dairy cows. Yeast culture, as a high-quality microbial feed additive, is rich in live bacteria, enzymes, oligosaccharides, and unknown growth factors. It can improve the rumen fermentation environment by regulating rumen microbiota structure, promoting the proliferation of fiber-decomposing bacteria, and thus has been initially applied in dairy farming. However, existing technologies have the following key limitations:
[0003] 1. Insufficient strain adaptability: Most commercially available yeast cultures currently use general yeast strains and have not screened for specific strains for the special environment of high fiber and high ammonia nitrogen in the rumen of dairy cows. This results in weak colonization ability in the rumen and unstable efficacy. Some products even cannot survive and function normally in the rumen due to poor strain tolerance.
[0004] 2. High preparation cost and low raw material utilization: Most processes rely on pure grain raw materials (such as high-quality corn flour and soybean meal), with raw material costs accounting for more than 65%; at the same time, the by-products of deep processing of corn (such as corn husks and corn starch processing residues) are not fully utilized, which not only increases costs but also causes resource waste and environmental pollution.
[0005] Therefore, developing a specific brewing yeast strain adapted to the rumen environment of dairy cows, designing a low-cost preparation process using corn by-products, and clarifying its precise application in dairy cows are key to solving the current pain points in dairy farming. Summary of the Invention
[0006] To address the shortcomings of existing technologies, this invention provides a brewing yeast HLKJ-002, a microbial agent, a fermentation culture, feed, and their applications. These technologies can significantly improve the rumen microecological balance of dairy cows, increase the digestibility of roughage, reduce the incidence of mastitis, and improve milk yield and quality. Furthermore, this invention enables the resource utilization of corn by-products, reduces the production cost of the culture, and provides stable application effects, making it suitable for large-scale dairy farming.
[0007] To achieve the above objectives, the present invention provides the following technical solution:
[0008] A brewing yeast HLKJ-002, characterized in that: the strain was deposited at the China General Microbiological Culture Collection Center on September 1, 2025, with the accession number CGMCC No. 35790.
[0009] A microbial agent, characterized in that it comprises the above-mentioned brewer's yeast HLKJ-002.
[0010] A fermentation culture, characterized in that it is obtained by fermentation of the above-mentioned brewer's yeast HLKJ-002.
[0011] Furthermore, the fermentation culture parameters are as follows: viable cell count ≥ 10-1 8 CFU / g, dry basis crude protein content ≥28%, moisture content ≤12%.
[0012] Furthermore, the fermentation culture is obtained by fermentation using the following method:
[0013] S1. Activation of the strain: Take the brewing yeast HLKJ-002 out of the -80℃ freezer, thaw it at room temperature, and inoculate it into malt extract medium. Incubate at 30℃ and 180r / min for 48h. Pick the bacterial solution and streak it on malt extract agar medium. Incubate at 30℃ for 24-30h. Select sticky colonies with neat edges, smooth circles and raised edges. After microscopic examination to ensure no contamination, inoculate them into malt extract agar slant medium. Incubate at 30℃ and 180r / min with shaking for 24h. Store at 4℃ for later use.
[0014] S2. Gradient Expansion: Laboratory Expansion: Inoculate 3-5 mL of activated bacterial solution into 500 mL of malt extract liquid culture medium and incubate at 30℃ and 180 r / min for 48 h with shaking. Factory Expansion: After high-temperature and high-pressure sterilization of the inoculum tank, add water and heat to 80℃. Add 3%-3.5% molasses, 0.4%-0.5% glucose, and 0.05%-0.08% yeast extract by weight of the water. Stir for 5-10 min, cool to 30-33℃, and inoculate with the bacterial solution after laboratory expansion. The inoculation amount is 3%-5% of the fermentation substrate weight. Incubate at 32℃ and 180 r / min for 24 h.
[0015] S3. Solid fermentation: Inoculate the expanded culture liquid into the solid raw material at an inoculation rate of 10% of the substrate mass, control the initial moisture content to 40-41%, and ferment in the fermentation workshop (pile height 60-80cm). Record the material temperature every 3 hours. When the temperature reaches above 40℃ after 24 hours of fermentation, turn the material over once and continue fermentation to 72 hours, during which the maximum material temperature is controlled at 35-40℃.
[0016] S4. Finished Product Preparation: After fermentation, the product is tested to ensure it has a sour aroma, is loose and free of clumps, and has a viable count ≥10. 8 CFU / g.
[0017] Furthermore, the fermentation substrate, by weight, includes 10-15 parts corn, 23-25 parts corn husk, 13-15 parts wheat bran, 10-18 parts cottonseed meal, 13-15 parts peanut meal, 8-12 parts soybean meal, 2-2.5 parts molasses, 0.03-0.07 parts yeast extract, and 0.3-0.6 parts glucose.
[0018] A feed comprising the aforementioned fermented culture, or whose raw materials include the aforementioned fermented culture.
[0019] The present invention also provides the application of the above-mentioned brewing yeast HLKJ-002, characterized in that: the application includes, but is not limited to, the production and preparation of microbial agents, fermentation cultures and feed, and is applicable to lactating dairy cows.
[0020] This invention provides a brewing yeast HLKJ-002, a microbial agent, a fermentation culture, feed, and their applications, which have the following beneficial effects:
[0021] 1. Highly targeted strain: The Saccharomyces cerevisiae HLKJ-002 has been screened for rumen environment adaptability and can stably survive and colonize in the rumen of dairy cows. Its efficacy is significantly improved compared with ordinary yeast strains, solving the problem of insufficient strain adaptability.
[0022] 2. Low raw material cost and environmentally friendly: Using corn husks, a byproduct of deep processing of corn, as the main raw material, the raw material cost is reduced by 30%-40% compared with pure grain processing, while realizing the resource utilization of byproducts;
[0023] 3. Fermentation process optimization: Through solid-state fermentation with a "first anaerobic, then aerobic" approach, the stacking height, material temperature, and turning timing are precisely controlled, resulting in a culture viable count ≥10⁻⁶. 8 The CFU / g content of active substances (enzymes, oligosaccharides) is significantly increased compared with traditional processes;
[0024] 4. Significant economic benefits: After adding the supplement, the daily milk production of each lactating cow increases by 2.6-3.9 kg, the milk protein content increases by 0.2-0.33 percentage points, and the incidence of mastitis decreases by 5.5-8.5 percentage points. Each dairy cow can increase economic benefits by 1,800-3,000 yuan per year.
[0025] The preservation information for Saccharomyces cerevisiae HLKJ-002 provided by this invention is as follows:
[0026] Preservation institution: China General Microbiological Culture Collection Center (CGMCC);
[0027] Deposit date: September 1, 2025;
[0028] Accession number: CGMCC No. 35790;
[0029] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Detailed Implementation
[0030] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0031] Example 1: Isolation and Identification of Strains
[0032] 1. Preliminary screening of brewing yeast
[0033] Weigh 10g of the sample to be separated (soil sample from farmland in Horqin District, Tongliao, Inner Mongolia; this farmland is used for intermittent grazing to increase fertilizer application and alleviate grassland pressure, and the resulting manure provides a potential source for screening beneficial bacteria tolerant to the rumen environment), add it to an Erlenmeyer flask containing 90mL of sterile physiological saline, and place it on a shaker at 30℃ and 200rpm for 20min to mix thoroughly and prepare an initial bacterial suspension; take 200μL of the above initial bacterial suspension and add it to a 1.5mL EP tube containing 800μL of sterile physiological saline, and gradually dilute it to 10 using a 10-fold serial dilution method. -7 Concentration gradient to ensure that the bacterial solution concentration is suitable for subsequent coating requirements;
[0034] Take 150 μL of each dilution at different concentration gradients and spread it evenly on the surface of YEPD enrichment medium containing 50 μg / mL chloramphenicol (formulation: 10 g yeast extract, 20 g peptone, 20 g glucose, 20 g agar, and water to 1000 ml). Invert the medium and incubate it in a 30°C constant temperature incubator for 72 h to inhibit the growth of other bacteria and enrich yeast.
[0035] After the culture is completed, suspected yeast colonies with regular edges, milky white or yellowish color and viscous texture (typical characteristics of Saccharomyces cerevisiae colony morphology) are picked from the culture medium, stained with methylene blue and observed under a microscope. Several target cells with oval shape and budding characteristics (typical cell reproduction mode of Saccharomyces cerevisiae) are selected.
[0036] 2. Pre-screening for rumen environment tolerance
[0037] 150 μL of each of the target cells obtained from the initial screening were added to artificial rumen fluid and cultured statically at 39°C under strict anaerobic conditions for 48 hours, retaining OD. 600 Strains with a value ≥ 0.8;
[0038] The artificial rumen fluid formulation is as follows: volatile fatty acids (acetic acid:propionic acid:butyric acid = 65:20:15, total concentration 120mmol / L), yeast extract 5g / L, and glucose 10g / L are added to a buffer solution (KH2PO4 1.0g, Na2HPO4 1.5g, NaCl 0.5g, MgSO4・7H2O 0.1g, CaCl2・2H2O 0.1g, water added to 1L). The final solution pH is adjusted to 5.8±0.2.
[0039] The well-growing strains obtained through screening were further supplemented with bile salts (sodium taurocholate) at 0.3% (g / 100ml) in their artificial rumen fluid, and the concentration of volatile fatty acids was adjusted to 150mmol / L. Strains with a survival rate of ≥85% were retained (detected by plate count method).
[0040] The strains with good tolerance to rumen inhibitors obtained through screening were each inoculated with 150 μL into YPD medium, cultured at pH 4.5 and 39℃ for 24 h, and strains with a survival rate ≥90% were screened.
[0041] 3. Screening for planting ability
[0042] Rumen epithelial cells (in vitro cultured bovine rumen epithelial cell lines) and strains obtained through rumen environment tolerance screening were inoculated into colonization screening medium, with the former at a concentration of 1×10⁻⁶. 6 The latter strain concentration was 1×10⁶ / mL. 8 CFU / mL, incubated at 37℃ for 2 h, washed 3 times with PBS and plate counted; (number of adhered strains / initial inoculated strains × 100%), retaining the top 30% of strains with the highest adhesion rate.
[0043] The colonization screening medium formula was: serum-free DMEM / F12 medium (1:1 mixture), with 5 g / L glucose added and the pH adjusted to 5.8±2.
[0044] The strains with better adhesion effects obtained through screening were cultured in a continuous flow artificial rumen at a flow rate of 0.05-0.1 L / h, anaerobic at 39℃ for 72 h, with an initial inoculum size of 1×10⁻⁶. 7 CFU / mL, after 72 h, the number of strains is ≥1×10⁻⁶. 6 The strain was finally obtained at CFU / mL and internally named CLJSJM-HL-2502 (the same strain as the preserved HLKJ-002).
[0045] 4. Strain identification
[0046] Using the genomic DNA of strain CLJSJM-HL-2502 as a template, PCR amplification was performed using universal primers for strain identification (NL1: GCATATCAATAAGCGGAGGAAAAG; NL4: GGTCCGTGTTTCAAGACGG). After the PCR product passed the test, the target band was cut and purified. The recovered product was then subjected to Sanger sequencing. The sequenced 26S rDNA gene sequence was then submitted to the NCBI database, and sequence homology analysis was performed using BLAST. Combining the morphological characteristics and gene sequence analysis results, strain CLJSJM-HL-2502 was identified as *Saccharomyces cerevisiae*.
[0047] Example 2: Preparation of Saccharomyces cerevisiae culture
[0048] This embodiment was carried out on the 5,000-ton-per-year yeast culture production line of Inner Mongolia Hailin Technology Development Co., Ltd., and the specific steps are as follows.
[0049] 1. Preparation of solid raw materials
[0050] Prepare the raw materials according to the following weight ratio: 600 kg of corn, crushed to 2-3 mm; 1200 kg of corn husks, passed through a 20-mesh sieve; 700 kg of wheat bran; 750 kg of cottonseed meal; 700 kg of peanut meal; 500 kg of soybean meal; 110 kg of molasses; 2.5 kg of yeast extract; and 27.5 kg of glucose. Mix them evenly and set aside.
[0051] 2. Activation and propagation of microbial strains
[0052] Activation: Take 10g of Saccharomyces cerevisiae HLKJ-002 powder, thaw it at room temperature, and inoculate it into 1L of malt extract medium (14Bx, pH 5.8). Incubate at 30℃ and 180r / min for 48h. Microscopic examination confirms the absence of contaminating bacteria.
[0053] Laboratory expansion: 5 mL of activated bacterial solution was taken from each Erlenmeyer flask and inoculated into 500 mL of malt extract liquid culture medium. The mixture was incubated at 30°C and 180 rpm for 48 hours until the viable bacterial count reached 1.2 × 10⁻⁶. 7 CFU / mL;
[0054] Factory expansion: After sterilizing the inoculum tank, add 300L of sterile water and heat to 80℃. Add 10.5kg of molasses, 1.5kg of glucose, and 0.2kg of yeast extract, stir for 8 minutes, and cool to 32℃ to obtain the fermentation substrate. Inoculate with laboratory expansion culture solution at an inoculum size of 5% of the fermentation substrate mass. Incubate at 32℃ and 180r / min for 24 hours to obtain a viable count of 1.5×10⁻⁶. 7 Fermentation broth with CFU / mL.
[0055] 3. Solid-state fermentation
[0056] Inoculation: Take 2500 kg of the solid raw material prepared in step 1 and spray the fermentation liquid (10% of the substrate mass) after factory expansion evenly onto the solid raw material.
[0057] Heaping: The material is piled up in the fermentation workshop to a height of 70cm, a width of 1.8m, and a length of 10m for initial anaerobic fermentation;
[0058] Temperature control and turning: The material temperature is 28℃ after 3 hours of fermentation, 32℃ after 6 hours, 36℃ after 12 hours, and 41℃ after 24 hours. Turn the material once with a turning machine. After turning, the material temperature drops to 35℃. Continue fermentation until the material temperature is 38℃ after 48 hours and 37℃ after 72 hours. The material also emits a strong sour aroma. Then, stop fermentation.
[0059] 4. Finished product inspection and packaging
[0060] Test results: Sensory characteristics: yellowish-brown, loose and without lumps, with a strong sour aroma; moisture 10.5%, crude protein (dry basis) 29.2%, ash 7.5%, crude fiber 10.8%, acid-soluble protein accounting for 16.3% of crude protein; viable count 1.8 × 10⁻⁶. 8 CFU / g; Toxins: Aspergillus flavus 3.2μg / kg, zearalenone 85μg / kg, vomitoxin 920μg / kg, all meet the standards;
[0061] Packaging: After crushing, the product is packaged in 25kg woven bags, with a yield / output rate of 94.4%.
[0062] Example 3: Application trial of Saccharomyces cerevisiae culture in lactating dairy cows
[0063] 1. Test materials
[0064] Experimental animals: 100 Holstein lactating cows with 2-3 parities, 60-90 days postpartum, and an average daily milk yield of 28-30 kg were selected from a large-scale dairy farm and randomly divided into 5 groups of 20 cows each. There were no significant differences in initial milk yield and milk protein content among the groups (P>0.05).
[0065] Experimental group 1: Basal diet + Saccharomyces cerevisiae culture from Example 2 (added at 1% of diet weight);
[0066] Experimental group 2: basal diet + Saccharomyces cerevisiae culture from Example 2 (added at 2% of diet weight);
[0067] Control group 1: Basal diet (without yeast culture);
[0068] Control group 2: Basal diet + Angel Yeast culture (added at 2% of diet weight)
[0069] Control group 3: Basal diet + commercially available brewer's yeast culture (added at 5% of diet weight)
[0070] Basic ration: By weight, mix 35 parts corn silage, 14 parts sheep grass, 10 parts alfalfa hay, 24 parts corn, 12 parts soybean meal, and 5 parts cottonseed meal, and then add 3% premix according to the weight of the above mixed materials.
[0071] Angel brewing yeast culture: Angel high-temperature resistant brewing high-activity dry yeast was used, and the same preparation method as in Example 2 was adopted.
[0072] Commercially available brewer's yeast culture, Yipinfeng Mu yeast culture (ruminant).
[0073] 2. Test Methods
[0074] Trial period: 7 days for pre-trial (adaptation diet), 30 days for formal trial;
[0075] Feeding method: Feed 3 times a day (06:00, 14:00, 22:00), mix the brewer's yeast culture with TMR evenly before feeding, and allow free access to food and water;
[0076] Detection indicators: ① Milk yield: Record the total milk yield of each group daily and calculate the average daily milk yield; ② Milk quality: Collect milk samples every 10 days and test the milk protein content and milk fat percentage (using a milk composition analyzer); ③ Rumen indicators: After the experiment, randomly select 3 cows from each group, collect rumen fluid, and test the pH value, total rumen bacteria count, and number of fiber-decomposing bacteria (using the plate count method); ④ Health indicators: Record the incidence of mastitis in cows during the experiment (using the California Mastitis Detection Method, CMT).
[0077] 3. Test Results
[0078] index Control group 1 (no additives) Experimental group 1 (1% added) Experimental group 2 (2% added) Control group 2 (Angel yeast, 2% added) Control group 3 (commercially available yeast, 5% added) Average daily milk production (kg / head) 28.6±1.2 31.2±1.1 32.5±1.3 29.0±1.1 30.5±1.2 Milk protein content (%) 3.02±0.08 3.22±0.07 3.35±0.09 3.05±0.07 3.18±0.08 Milk fat percentage (%) 3.55±0.10 3.75±0.09 3.82±0.11 3.58±0.09 3.70±0.10 Rumen pH 5.8±0.2 6.2±0.1 6.3±0.1 5.9±0.2 6.1±0.1 <![CDATA[Total rumen bacteria (10¹ 0 CFU / mL)]]> 4.2±0.5 7.0±0.6 8.2±0.7 4.5±0.5 6.0±0.6 <![CDATA[Number of cellulolytic bacteria (10 8 CFU / mL)]]> 3.5±0.4 6.5±0.5 7.8±0.6 3.7±0.4 5.2±0.5 Mastitis incidence (%) 15 9.5 6.5 14 11
[0079] 4. Results Analysis
[0080] Milk yield and milk quality: The average daily milk yield of experimental groups 1 and 2 and control groups 2 and 3 increased by 9.1%, 13.6%, 1.4%, and 6.6% respectively compared with control group 1, and the milk protein content increased by 6.6%, 10.9%, 1.0%, and 5.3% respectively. The effects of experimental groups 1 and 2 of this invention were better than those of control groups 2 and 3, and the effect of experimental group 2 was better than that of experimental group 1, indicating that the addition of brewer's yeast culture of this invention is more conducive to improving lactation performance.
[0081] Rumen microecology: The rumen pH values of experimental groups 1 and 2 and control group 3 were closer to the suitable range (6.0-6.5), and the total number of bacteria and the number of fiber-decomposing bacteria were significantly increased compared with control group 1 (P<0.05), proving that the present invention and commercially available brewer's yeast culture can effectively improve the rumen fermentation environment;
[0082] Health status: The incidence of mastitis in experimental groups 1 and 2, and control groups 2 and 3 was significantly lower than that in control group 1. Among them, the incidence of mastitis in experimental group 2 was reduced by 56.7% compared with control group 1, indicating that the culture can enhance the immunity of dairy cows and reduce intestinal-related diseases. Moreover, the reduction in experimental group 2 was twice that of control group 3.
[0083] Example 4: Application trial of Saccharomyces cerevisiae culture in gilts
[0084] 1. Test materials
[0085] Experimental animals: Sixty 10-month-old Holstein replacement calves were randomly divided into 4 groups of 15 each. There was no significant difference in initial weight (P>0.05).
[0086] Experimental group: basal diet + brewer's yeast culture (added at 1.2% of diet weight);
[0087] Control group 1: Basal diet (without yeast culture);
[0088] Control group 2: Basal diet + Angel Yeast culture (added at 2% of diet weight)
[0089] Control group 3: Basal diet + commercially available brewer's yeast culture (added at 5% of diet weight)
[0090] Basal ration: By weight, 42 parts corn silage, 25 parts sheepgrass, 15 parts corn, 12 parts soybean meal, and 6 parts wheat bran are mixed together. Then, 3% premix is added according to the weight of the above mixed materials (to adjust the dry matter content, crude protein content, and crude fiber content of the ration, taking into account the different nutritional requirements of lactating dairy cows and replacement dairy cows).
[0091] Angel brewing yeast culture: Angel high-temperature resistant brewing high-activity dry yeast was used, and the same preparation method as in Example 2 was adopted.
[0092] Commercially available brewer's yeast culture, Yipinfeng Mu yeast culture (ruminant).
[0093] 2. Test Methods
[0094] Experiment duration: 60 days, with free access to food and water;
[0095] Test indicators: ① Body weight: Weigh animals every 30 days and calculate the average daily weight gain; ② Feed digestibility: Use the full manure collection method to test the digestibility of crude fiber and crude protein; ③ Rumen development: After the experiment, three animals were randomly selected from each group, and the length and density of rumen papillae were observed after slaughter.
[0096] 3. Test Results
[0097] index Control group 1 (no additives) Experimental group (1.2% added) Control group 2 (Angel yeast, 1.2% added) Control group 3 (high-quality commercially available yeast, 1.2% added) Average daily weight gain (g / head) 680±50 770±45 690±45 755±50 Crude fiber digestibility (%) 52.3±2.1 61.5±1.8 53.5±2.0 59.5±2.0 Crude protein digestibility (%) 65.8±1.5 71.0±1.3 66.5±1.4 70.5±1.5 Rumen papilla length (mm) 3.2±0.3 4.0±0.4 3.3±0.3 3.9±0.3 Rumen papilla density (numbers / cm²) 28±3 35±4 29±3 33±3
[0098] 4. Results Analysis
[0099] The average daily weight gain of the experimental group was 13.2% higher than that of the control group, and the digestibility of crude fiber and crude protein increased by 17.6% and 7.9% respectively. The length and density of rumen papillae were significantly increased (P<0.05), which proves that the culture of Saccharomyces cerevisiae can promote rumen development and feed digestion in gilts, laying a good foundation for later lactation.
[0100] The experimental group showed only slight advantages over control group 3 in terms of average daily weight gain, crude fiber digestibility, crude protein digestibility, rumen papilla length, and rumen papilla density. In Example 3 (lactating dairy cows), the product of this application showed significant and consistent advantages in all key indicators, and the differences reached statistical significance levels, indicating that the above-mentioned brewer's yeast culture of this invention is more suitable for feeding lactating dairy cows.
[0101] It should be noted that, in this document, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.
[0102] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A brewing yeast HLKJ-002, characterized in that: This strain was deposited on September 1, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 35790.
2. A microbial agent, characterized in that: Includes the brewing yeast HLKJ-002 as described in claim 1.
3. A fermentation culture, characterized in that: It is obtained by fermentation of the brewing yeast HLKJ-002 as described in claim 2.
4. The fermentation culture as described in claim 3, characterized in that: The fermentation culture parameters are as follows: viable cell count ≥ 10-10 8 CFU / g, dry basis crude protein content ≥28%, moisture content ≤12%.
5. A fermentation culture as described in claim 3, characterized in that: The fermentation culture was obtained by the following method: S1. Activation of the strain: Take the brewing yeast HLKJ-002 out of the -80℃ freezer, thaw it at room temperature, and inoculate it into malt extract medium. Incubate at 30℃ and 180r / min for 48h. Pick the bacterial solution and streak it on malt extract agar medium. Incubate at 30℃ for 24-30h. Select sticky colonies with neat edges, smooth circles and raised edges. After microscopic examination to ensure no contamination, inoculate them into malt extract agar slant medium. Incubate at 30℃ and 180r / min with shaking for 24h. Store at 4℃ for later use. S2. Gradient Expansion: Laboratory Expansion: Inoculate 3-5 mL of activated bacterial solution into 500 mL of malt extract liquid culture medium and incubate at 30℃ and 180 r / min for 48 h with shaking. Factory Expansion: After high-temperature and high-pressure sterilization of the inoculum tank, add water and heat to 80℃. Add 3%-3.5% molasses, 0.4%-0.5% glucose, and 0.05%-0.08% yeast extract by weight of the water. Stir for 5-10 min, cool to 30-33℃, and inoculate with the bacterial solution after laboratory expansion. The inoculation amount is 3%-5% of the fermentation substrate weight. Incubate at 32℃ and 180 r / min for 24 h. S3. Solid fermentation: Inoculate the expanded culture liquid into the solid raw material at an inoculation rate of 10% of the substrate mass, control the initial moisture content to 40-41%, and ferment in the fermentation workshop (pile height 60-80cm). Record the material temperature every 3 hours. When the temperature reaches above 40℃ after 24 hours of fermentation, turn the material over once and continue fermentation to 72 hours, during which the maximum material temperature is controlled at 35-40℃. S4. Finished Product Preparation: After fermentation, the product is tested to ensure it has a sour aroma, is loose and free of clumps, and has a viable count ≥10. 8 CFU / g.
6. The fermentation culture as described in claim 5, characterized in that: The fermentation substrate, by weight, includes 10-15 parts corn, 23-25 parts corn husk, 13-15 parts wheat bran, 10-18 parts cottonseed meal, 13-15 parts peanut meal, 8-12 parts soybean meal, 2-2.5 parts molasses, 0.03-0.07 parts yeast extract, and 0.3-0.6 parts glucose.
7. A feed, characterized in that: Includes the fermentation culture described in any one of claims 3-6.
8. The application of the brewing yeast HLKJ-002 as described in claim 1, characterized in that: This application includes, but is not limited to, the production and preparation of microbial agents, fermentation cultures, and feed, and is applicable to lactating dairy cows.