Promoter of alfalfa malic acid transport protein gene MsALMT1 and application thereof

Overexpression of the MsALMT1 promoter-driven malate transporter gene in alfalfa enhanced its alkali tolerance, solved the problem of limited growth of alfalfa in saline-alkali land, and provided genetic resources for improving alkali tolerance.

CN121718541APending Publication Date: 2026-03-24LANZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511691071.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-18
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

There is insufficient research on the adaptation mechanism of existing alfalfa varieties to alkali stress, which leads to limited growth when planted on saline-alkali land and makes it difficult to create salt-alkali tolerant varieties through molecular design breeding.

Method used

The promoter of the alfalfa malate transporter gene MsALMT1 was used to drive its gene overexpression. A plant expression vector was constructed and transformed into alfalfa to enhance its alkali resistance.

Benefits of technology

It significantly improved the alkali tolerance of alfalfa, provided genetic resources for improving the plant's alkali tolerance, and made it suitable for planting on saline-alkali land.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a promoter of an alfalfa malic acid transport protein gene MsALMT1 and application of the promoter. The nucleotide sequence of the promoter is shown as SEQ ID No.1. The invention further discloses a preparation method of the promoter. The invention provides the nucleotide sequence of the alfalfa malic acid transporter gene MsALMT1 promoter, and the alkali resistance of the plant can be obviously improved after the promoter drives the overexpression of MsALMT1 in alfalfa, so that a gene resource is provided for the improvement of the alkali resistance of the plant, and the application value is wide.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a promoter for the alfalfa malate transporter gene MsALMT1 and its applications. Background Technology

[0002] Alfalfa (Medicago sativa), a legume forage crop, is known as the "King of Forages" due to its rich content of crude protein and vitamins, playing a crucial role in my country's livestock production. However, approximately 70% of my country's alfalfa production areas are located in five northern provinces, where soil salinization is a significant problem. Most existing alfalfa varieties have weak salt and alkali tolerance, requiring high yields and quality only when planted on fertile, high-quality land. This creates a conflict between food and forage crops and land use, thus necessitating the development of new alfalfa varieties suitable for planting on saline-alkali and other marginal lands.

[0003] Salt-alkali stress includes two types: salt stress caused by neutral salts and alkali stress caused by alkaline salts. Saline soils mainly contain neutral salts such as NaCl and Na₂SO₄, with a pH close to 7.0; while alkali soils are mainly caused by alkaline salts such as Na₂CO₃ and NaHCO₃, with a pH greater than 8.5. Alkaline soils account for approximately 60% of the world's saline-alkali land and cause more severe damage to crop growth than salt stress. Currently, there are numerous reports on the molecular mechanisms of alfalfa's adaptation to salt stress, and several salt-tolerant genes have been applied to the genetic improvement of alfalfa's salt tolerance. However, there is little research on the mechanisms of alfalfa's adaptation to alkali stress, which restricts the progress of creating salt- and alkali-tolerant alfalfa varieties through molecular design breeding.

[0004] Unlike salt stress, high pH levels outside the rhizosphere are a significant cause of plant growth and yield reduction under alkaline stress. Root accumulation and secretion of organic acids such as malic acid are important strategies for plants to adapt to alkaline stress. Studies have found that under alkaline-salt stress, wheat, rice, grapes, tomatoes, and other plants synthesize large amounts of malic acid in their roots to maintain intracellular pH homeostasis. More importantly, under alkaline stress, plant roots can secrete malic acid outside the rhizosphere to neutralize the high pH.

[0005] Aluminum-activated malate transporters (ALMTs) are a class of malate transporters widely found in plants. Wheat TaALMT1 is the earliest discovered and most functionally clear member of this protein family. It can be activated by aluminum in acidic soils. 3+ Activation, which in turn mediates the secretion of malic acid to chelate Al in the soil. 3+ Ultimately alleviates Al 3+ It is toxic to cells, thus playing an important role in plant aluminum tolerance. It is noteworthy that under alkaline pH conditions, even in the absence of external Al, aluminum can be absorbed and tolerated. 3+TaALMT1 activity in wheat roots can also be activated, mediating malic acid secretion to neutralize the high pH environment in the rhizosphere.

[0006] Deji Zhuoma (Metabolic and Transcriptomic Analysis of Alfalfa in Response to Salt-Alkali Stress, 2025) found through metabolomic analysis that malic acid content in alfalfa roots significantly increased under alkali stress; simultaneously, transcriptomic analysis revealed that the expression of the malic acid transporter gene MsALMT1 in alfalfa roots was significantly upregulated under alkali stress, while its expression abundance did not change significantly under salt stress. Based on this, it is speculated that the specific upregulation of the MsALMT1 gene in roots may play a role in the alkali tolerance of alfalfa.

[0007] Given that gene expression is regulated by its promoter, the inventors obtained the promoter of the malate transporter gene MsALMT1 from alfalfa, constructed a plant expression vector driving MsALMT1 gene expression with this promoter, and transformed it into alfalfa to analyze its effect on plant alkali tolerance. The results showed that overexpression of the MsALMT1 gene in alfalfa significantly enhanced the plant's alkali tolerance. This provides a gene resource for improving plant alkali tolerance and has significant application prospects. Summary of the Invention

[0008] To address the shortcomings of existing technologies, the present invention aims to provide a promoter for the alfalfa malate transporter gene MsALMT1 and its application, which can drive the overexpression of the MsALMT1 gene in alfalfa to significantly enhance the plant's alkali tolerance.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0010] In a first aspect, the present invention proposes a promoter for the alfalfa malate transporter gene MsALMT1, the key feature of which is that the nucleotide sequence of the promoter is shown in SEQ ID No.1.

[0011] Furthermore, the amplification primers used during promoter isolation include a first primer and a second primer, wherein:

[0012] The nucleotide sequence of the first primer P1 is: GAAGATGAATTGTTGATCAAA;

[0013] The nucleotide sequence of the second primer P2 is: ATTGTATGCACTAGAAGAAAATTA.

[0014] In a second aspect, the present invention provides a method for obtaining the promoter of the alfalfa malate transporter gene MsALMT1 described in the first aspect, the method comprising:

[0015] DNA from alfalfa was obtained as a template;

[0016] Construct the first and second primers;

[0017] PCR amplification was performed using alfalfa DNA as a template, with the first and second primers as the primers.

[0018] Thirdly, this invention proposes the application of the MsALMT1 promoter of alfalfa malate transporter gene as described in the first aspect in improving the alkali tolerance of plants.

[0019] Fourthly, this invention proposes the application of the MsALMT1 promoter of alfalfa malate transporter gene as described in the first aspect in the breeding of alkali-tolerant alfalfa.

[0020] Fifthly, this invention proposes the application of the MsALMT1 promoter of alfalfa malate transporter gene as described in the first aspect in the selection of transgenic crops with enhanced alkali tolerance.

[0021] In a sixth aspect, the present invention provides a plant expression vector containing the promoter of the alfalfa malate transporter gene MsALMT1 as described in the first aspect.

[0022] In a seventh aspect, the present invention proposes the application of a plant expression vector as described in the sixth aspect in improving the alkali tolerance of plants.

[0023] Eighthly, the present invention proposes the application of a plant expression vector as described in the sixth aspect in the breeding of alkali-tolerant alfalfa.

[0024] In a ninth aspect, the present invention proposes the application of a plant expression vector as described in the sixth aspect in the selection of transgenic crops with enhanced alkali tolerance.

[0025] The significant effects of this invention are:

[0026] 1. This invention provides a promoter for the alfalfa malate transporter gene MsALMT1 and a plant expression vector containing it. Experiments have shown that the overexpression of the MsALMT1 gene driven by the promoter in alfalfa can significantly enhance the plant's alkali tolerance.

[0027] 2. The promoter of the alfalfa malic acid transporter gene MsALMT1 provides a gene resource for improving the plant's alkali tolerance and has broad application value. Attached Figure Description

[0028] Figure 1This study analyzed the expression level of the MsALMT1 gene in alfalfa overexpression lines driven by the MsALMT1 promoter. WT represents wild-type plants without transgenesis, and A1-A10 represent transgenic lines. Different letters on the columns indicate significant differences at the P < 0.05 level; the same applies below.

[0029] Figure 2 RT-PCR detection of the basta gene (Bar) in A4 and A6 strains. MsActin was used as an internal reference gene.

[0030] Figure 3 The growth status of transgenic alfalfa lines (A4 and A6) and wild-type (WT) after 4 days of alkali treatment (45 mM NaHCO3 + 5 mM Na2CO3). (A) Growth phenotype; (B) Plant height; (C) Fresh weight.

[0031] Figure 4 The growth status of transgenic alfalfa lines (A4 and A6) and wild-type (WT) after 7 days of alkali treatment (45 mM NaHCO3 + 5 mM Na2CO3). (A) Growth phenotype; (B) Plant height; (C) Fresh weight. Detailed Implementation

[0032] The specific embodiments and working principles of the present invention will be further described in detail below with reference to the accompanying drawings.

[0033] Example 1: Obtaining the promoter of the alfalfa malate transporter gene MsALMT1

[0034] The promoter of MsALMT1 was identified based on the alfalfa genome sequence. Amplification primers P1 and P2 were designed based on this sequence, with P1 containing the sequence: GAAGATGAATTGTTGATCAAA and P2 containing the sequence: ATTGTATGCACTAGAAGAAAATTA. Genomic DNA was extracted from alfalfa leaves and used as a template for PCR amplification using the primers. The PCR amplification program was: 94°C for 3 min; 94°C for 30 s, 48°C for 30 s, 72°C for 80 s, 30 cycles, followed by a 10-min extension at 72°C. The 2122 bp MsALMT1 promoter was successfully obtained, and its nucleotide sequence is shown in SEQ ID No. 1.

[0035] Example 2: Construction of a plant expression vector for MsALMT1 expression driven by the promoter of the alfalfa malate transporter gene MsALMT1.

[0036] The PCR product of the MsALMT1 promoter (hereinafter referred to as ProMsALMT1) from "Example 1" was purified and ligated into the pMD19-T vector to obtain the pMD19-T-ProMsALMT1 vector. Using this vector plasmid as a template, PCR amplification was performed using primers P3 (sequence: ACCCGGGGATCCTCTAGA GAAGATGAATTGTTGATCAAA) and P4 (sequence: AAAGTTCTTCTCCTTTACTAGTATTGTATGCACTAGAAGAAAATTA) to obtain the ProMsALMT1 fragment containing an XbaI restriction site at the 5' end and an SPeI restriction site at the 3' end. Simultaneously, the plant expression vector pCAMBIA1302-BASTA plasmid was double-digested with restriction endonucleases XbaI and SPeI to obtain the linearized pCAMBIA1302-BASTA vector. Finally, the ProMsALMT1 fragment was ligated to the pCAMBIA1302-BASTA linearized vector using In-Fusion HD cloning enzyme to construct the pCAMBIA1302-BASTA-ProMsALMT1 recombinant vector.

[0037] RNA was extracted from alfalfa roots and cDNA was obtained via reverse transcription. Using this cDNA as a template, PCR amplification was performed using primers P5 (sequence: ATGGTAGATCTGACTAGTATGGTGTCTCCAAACATGGACC) and P6 (sequence: ATTCGAGCTGGTCACCTCATTTGTCGTCATCGTCTTTGTAGTCAATTTTGTTACATTTAT) to obtain a PCR product containing the full-length coding sequence of MsALMT1 with an SPeI restriction site at the 5' end and a BstEII restriction site at the 3' end. The pCAMBIA1302-BASTA-ProMsALMT1 plasmid was double-digested with restriction endonucleases SPeI and BstEII to obtain a linearized vector. Finally, the above MsALMT1 fragment was ligated to the linearized vector pCAMBIA1302-BASTA-ProMsALMT1 using the In-Fusion HD cloning enzyme, and the plant expression vector pCAMBIA1302-BASTA-ProMsALMT1-MsALMT1 (selected as basta) was successfully constructed to drive MsALMT1 expression by the MsALMT1 promoter.

[0038] Example 3: Functional verification of the MsALMT1 promoter of alfalfa malate transporter in improving plant alkali tolerance.

[0039] The plant expression vector pCAMBIA1302-BASTA-ProMsALMT1-MsALMT1 obtained in "Example 2" was transformed into alfalfa using the leaf disc method, and resistance screening was performed using 1‰ (v / v) Basta solution. After obtaining transgenic lines, the transcription level of MsALMT1 in the roots of 10 transgenic lines (named A1-A10) was analyzed using RT-qPCR. The results showed that, except for line A1, the expression level of MsALMT1 in the roots of the other 9 lines was significantly higher than that in the untransgenic wild-type plants (WT) (e.g., ...). Figure 1 (As shown). Based on this, the two lines with the highest MsALMT1 expression levels (A4 and A6) were selected for further research.

[0040] First, the expression of the basta gene (Bar) in the A4 and A6 lines was detected by RT-PCR. The results showed that the Bar gene was expressed in both lines, and the Bar gene was not detected in WT (e.g., Figure 2 As shown in the figure, this further demonstrates that lines A4 and A6 are transgenic lines into which the plant expression vector pCAMBIA1302-BASTA-ProMsALMT1-MsALMT1 was successfully introduced in “Example 2”.

[0041] Subsequently, the alkali tolerance of 3-week-old WT, A4, and A6 lines was analyzed by treating them with an alkaline solution (45 mM NaHCO3 + 5 mM Na2CO3). The results showed that under control conditions, there was no significant difference in growth among the WT, A4, and A6 lines (e.g., ...). Figure 3 , Figure 4 (As shown). However, after 4 days of alkali treatment, the fresh weight of strains A4 and A6 was significantly higher than the WT (as shown). Figure 3 After 7 days of alkali treatment, the plant height and fresh weight of strains A4 and A6 were significantly higher than those of WT (e.g., ...). Figure 4 (As shown).

[0042] The results above demonstrate that overexpression of MsALMT1 in alfalfa using the MsALMT1 promoter effectively improves the plant's alkali tolerance. This provides a gene resource for improving plant salt tolerance and has broad application value.

[0043] The technical solution provided by this invention has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of this invention. The descriptions of the embodiments above are only for the purpose of helping to understand the method and core ideas of this invention. It should be noted that those skilled in the art can make several improvements and modifications to this invention without departing from the principles of this invention, and these improvements and modifications also fall within the protection scope of the claims of this invention.

Claims

1. A promoter for the alfalfa malate transporter gene MsALMT1, characterized in that: The nucleotide sequence of the promoter is shown in SEQ ID No.

1.

2. The promoter of the alfalfa malate transporter gene MsALMT1 according to claim 1, characterized in that: The amplification primers used during promoter separation include a first primer and a second primer, wherein: The nucleotide sequence of the first primer P1 is: GAAGATGAATTGTTGATCAAA; The nucleotide sequence of the second primer P2 is: ATTGTATGCACTAGAAGAAAATTA.

3. A method for obtaining the promoter of the alfalfa malate transporter gene MsALMT1 as described in claim 1 or 2, characterized in that, The method includes: DNA from alfalfa was obtained as a template; Construct the first and second primers; PCR amplification was performed using alfalfa DNA as a template, with the first and second primers as the primers.

4. The application of the MsALMT1 promoter of alfalfa malate transporter gene as described in claim 1 or 2 in improving the alkali tolerance of plants.

5. The application of the MsALMT1 promoter of alfalfa malate transporter gene as described in claim 1 or 2 in the breeding of alkali-tolerant alfalfa.

6. The application of the MsALMT1 promoter of alfalfa malate transporter gene as described in claim 1 or 2 in the selection of transgenic crops with enhanced alkali tolerance.

7. A plant expression vector containing the promoter of the alfalfa malate transporter gene MsALMT1 as described in claim 1 or 2.

8. The application of the plant expression vector as described in claim 7 in improving the alkali tolerance of plants.

9. The application of the plant expression vector as described in claim 7 in the breeding of alkali-tolerant alfalfa.

10. The application of the plant expression vector as described in claim 7 in the selection and breeding of transgenic crops with enhanced alkali tolerance.