SiMYB4 gene in saussurea involucrata as well as encoding product and application thereof

By overexpressing the SiMYB4 gene to regulate the transcriptional level in snow lotus callus, the problem of insufficient flavonoid content in snow lotus callus was solved, and the flavonoid content was significantly increased, expanding the application potential of snow lotus in cosmetics and food.

CN121718554APending Publication Date: 2026-03-24NORTHWEST INST OF PLATEAU BIOLOGY CHINESE ACAD OF SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-16
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Snow lotus callus lacks flavonoids, and current technologies are insufficient to effectively increase their content, thus affecting its potential application in cosmetics and food.

Method used

By overexpressing the SiMYB4 gene to regulate the transcript level in snow lotus callus, a recombinant vector was constructed and transformed into plant cells. Enhanced promoters and translation enhancers were used to ensure the effective expression of the SiMYB4 gene and promote the synthesis of flavonoids.

Benefits of technology

It significantly increases the content of flavonoids in snow lotus callus, broadens the application prospects of snow lotus cell lines, and provides a new channel for the utilization of endangered Chinese herbal medicine resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121718554A_ABST
    Figure CN121718554A_ABST
Patent Text Reader

Abstract

The invention discloses a SiMYB4 gene in saussurea involucrata as well as a coding product and application thereof, and belongs to the technical field of plant genetic engineering. The saussurea involucrata SiMYB4 gene is one of the following nucleotide sequences: (1) the saussurea involucrata SiMYB4 gene has a nucleotide sequence as shown in SEQ ID NO.1; and (2) a homologous sequence obtained by adding, substituting, inserting or deleting one or more basic groups in the nucleotide sequence as shown in SEQ ID NO.1 or an allele of the homologous sequence and a nucleotide sequence derived from the allele. The SiMYB4 gene obtained in the invention is a key gene for regulating and controlling the synthesis of the flavonoids of Tianshan snow, which has huge value and production potential for obtaining an ideal saussurea involucrata engineering cell line with high flavonoids through directional genetic improvement; siMYB4 is subjected to molecular regulation and control, the content of saussurea involucrata flavonoid compounds can be improved, great significance is achieved for increasing saussurea involucrata flavonoid natural active ingredients, and the application prospect of saussurea involucrata cell lines is greatly widened.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the SiMYB4 gene in snow lotus and its encoded products and applications. Background Technology

[0002] Saussurea involucrata (Kar. & Kir.) Sch.Bip., belonging to the genus Saussurea in the family Asteraceae, is an endangered perennial alpine plant. Saussurea involucrata has evolved a series of unique secondary metabolites to adapt to the high-altitude environment of strong ultraviolet radiation, low temperatures, and thin air, giving it significant therapeutic effects in treating rheumatoid arthritis, tumors, and altitude sickness. Due to extreme growing conditions and overexploitation by humans, wild populations of Saussurea involucrata are on the verge of extinction, and the government has listed it as a Class II protected plant in China. In recent decades, with the continuous advancement of biotechnology and the widespread application of plant tissue and cell culture techniques, crucial roles have been played in the preservation and development of medicinal plant resources. Notably, cell cultures of Saussurea involucrata have become promising ingredients in cosmetics and food. In 2010, these cell cultures were approved as a new food resource, with the expectation that they will eventually become a substitute for wild Saussurea involucrata.

[0003] Traditional Chinese medicine contains abundant flavonoids, which possess a wide range of pharmacological effects, including antioxidant, anticancer, antibacterial, anti-allergic, anti-inflammatory, wound-healing, and liver-protective properties. In wild snow lotus plants, the main bioactive components are predominantly flavonoids, such as farnesin and psyllium husk (Gong et al, Saussureae Involucrata Herba (Snow Lotus): Review of Chemical Compositions and Pharmacological Properties. frontiers in Pharmacology, 2020, 9: 2019). However, in snow lotus callus, the main bioactive components are phenolic acids, lacking flavonoids (Qiu et al, Metabolic engineering of the phenylpropanoid pathway enhances the antioxidant capacity of Saussurea involucrata. PLoS One, 2013, 8: e70665). Therefore, increasing the flavonoid content in snow lotus callus is a key issue for enhancing its application and is of great significance. MYB transcription factors are widely distributed in many plants, and MYB proteins have been found to participate in a variety of plant life processes, including primary metabolism, secondary metabolism, plant development, and responses to biotic and abiotic stresses. The role of MYB proteins as regulators of phenylpropanoid metabolism in plants has been extensively studied, for example, in the biosynthesis of proanthocyanidins, anthocyanins, flavonols, and lignin. The transcriptional level of the MYB4 transcription factor can significantly affect the synthesis of flavonoids in plants (Wang et al, Arabidopsis MYB4 plays dual roles in flavonoid biosynthesis. The Plant Journal, 2019, 101:637-652). Summary of the Invention

[0004] This invention provides the SiMYB4 gene, a gene related to the synthesis of flavonoids. By regulating the transcriptional level of SiMYB4 in snow lotus callus through overexpression technology, the role of SiMYB4 in flavonoids in snow lotus callus was identified. This has important reference value for the resource utilization and targeted molecular improvement of snow lotus and other rare and endangered species.

[0005] In a first aspect, the present invention provides the SiMYB4 gene of snow lotus, wherein the SiMYB4 gene of snow lotus is one of the following nucleotide sequences:

[0006] (1) It has the nucleotide sequence shown in SEQ ID NO.1;

[0007] (2) Homologous sequences of the nucleotide sequence shown in SEQ ID NO.1 with the addition, substitution, insertion or deletion of one or more bases, or their alleles and derived nucleotide sequences.

[0008] Secondly, the present invention provides a protein encoded by the SiMYB4 gene, wherein the amino acid sequence of the protein is one of the following sequences:

[0009] (1) It has the amino acid sequence shown in SEQ ID NO.2;

[0010] (2) Homologous protein sequences with one or more amino acids added, substituted, inserted or deleted from SEQ ID NO.2.

[0011] Thirdly, the present invention provides a recombinant vector containing the SiMYB4 gene.

[0012] Fourthly, the present invention provides a recombinant bacterium containing the SiMYB4 gene described in 1 or the recombinant vector described in 1.

[0013] In this invention, recombinant expression vectors containing the SiMYB4 gene can be constructed using existing plant expression vectors. These plant expression vectors include Agrobacterium-mediated transformation vectors and vectors suitable for plant microbombardment, such as pCAMBIA3301, pCAMBIA1300, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN, or other derived plant expression vectors. Plant expression vectors carrying the SiMYB4 gene of this invention can be transformed into plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation.

[0014] When constructing recombinant plant expression vectors using the SiMYB4 gene, any type of enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene promoter (pUbi), etc. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the SiMYB4 gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0015] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can express enzymes or luminescent compounds that produce color changes in plants (GUS gene, luciferase gene, etc.), antibiotic resistance markers (gentamicin marker, kanamycin marker, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes).

[0016] Fifthly, the present invention provides a primer pair for amplifying the full length or any fragment of the gene described above, the primer pair comprising:

[0017] The upstream primer has the following nucleotide sequence: ATGGGAAGGTCTCCTTGTTG (SEQ ID NO.3);

[0018] The downstream primer has the following nucleotide sequence: TTATTTCATCTCCAAGCCTC (SEQ ID NO.4).

[0019] In a sixth aspect, the present invention provides the application of the SiMYB4 gene and its encoded protein, the recombinant vector, or the recombinant bacteria in regulating the synthesis of flavonoids from snow lotus.

[0020] In a seventh aspect, the present invention provides a method for regulating flavonoids in snow lotus, comprising the step of transferring the SiMYB4 gene into snow lotus to increase the content of flavonoids in snow lotus.

[0021] The flavonoids include: Albanin A, Jaceosidin, Narcissin, Hispidulin, Rhamnazin, Chrysoeriol, Nobiletin, 3,5,6,7,8,3′,4′-Heptemthoxyflavone, Diosmetin-7-O-β-D-Glucopyranoside, Diosmetin, and Homoplantaginin.

[0022] The beneficial effects of this invention compared to the prior art are as follows:

[0023] (1) The SiMYB4 gene obtained in this invention is a key gene that regulates the synthesis of flavonoids in Tianshan snow lotus, which has great value and production potential for obtaining ideal high flavonoids in snow lotus engineered cell lines through targeted genetic improvement.

[0024] (2) Molecular regulation of SiMYB4 can improve the content of flavonoids in snow lotus, which is of great significance for increasing the natural active ingredients of flavonoids in Tianshan snow lotus and greatly broadens the application prospects of snow lotus cell lines.

[0025] (3) The genetically modified cell lines generated in this invention can be integrated into the improvement and production projects of conventional Chinese herbal medicine natural active products, thereby providing a new channel for the utilization of endangered and precious Chinese herbal medicine resources. Attached Figure Description

[0026] Figure 1 Image of gel electrophoresis of PCR amplification of the SiMYB4 gene coding sequence;

[0027] Figure 2 Map of the pEarley100-GFP-SiMYB4 overexpression vector for Saussurea involucrata;

[0028] Figure 3 The results of callus fluorescence identification for transgenic snow lotus overexpressing pEarley100-GFP-SiMYB4 ((A) detailed image of regenerated seedlings observed under blue excitation light; (B) detailed image of regenerated seedlings observed under natural light).

[0029] Figure 4The results of qRT-PCR for the SiMYB4 gene in callus of *Saussurea involucrata* overexpressing pEarley100-GFP-SiMYB4 (Control represents pEarley100-GFP empty vector transgenic callus, and SiMYB4_OE1 / 2 / 3 / 4 / 5 / 6 represent six independent positive overexpression transgenic cell lines).

[0030] Figure 5 PCA diagram for metabolome analysis of pEarley100-GFP-SiMYB4 overexpressing transgenic snow lotus callus (Control represents pEarley100-GFP empty vector transgenic callus, and SiMYB4_OE represents four independent positive overexpressing transgenic cell lines).

[0031] Figure 6 KEGG classification map of callus metabolome analysis for transgenic snow lotus pEarley100-GFP-SiMYB4 overexpression;

[0032] Figure 7 Cluster heatmap showing the effect of SiMYB4 gene overexpression on flavonoid content in snow lotus callus. Detailed Implementation

[0033] The technical solution of the present invention will now be clearly and completely described. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0034] Example 1: Amplification of the SiMYB4 sequence and construction of the expression vector

[0035] According to NCBI ( https: / / www.ncbi.nlm.nih.gov / Based on the published snow lotus genome information on the website, SiMYB-F and SiMYB-R primers were designed according to the obtained SiMYB4 gene sequence information. Using the snow lotus genomic cDNA library as a template, PCR amplification was performed using the following primers.

[0036] The primer sequences are as follows:

[0037] SiMYB4-F: ATGGGAAGGTCTCCTTGTTG

[0038] SiMYB4-R: TTATTTCATCTCCAAGCCTC

[0039] The PCR reaction system for amplifying the target fragment consisted of: 2 μL cDNA, 2.5 μL SiMYB4-F forward primer (10 μM), 2.5 μL SiMYB4-R reverse primer (10 μM), 25 μL PrimeSTAR Max Premix (2X) polymerase, and 18 μL ddH2O. The PCR reaction conditions were: 98 °C. o C 3 min; 98 o C 10 s, 55 o C 15 s; 72 o C 1 min, 35 cycles; 72 o C 10 min.

[0040] The obtained PCR amplification product was subjected to agarose DNA gel electrophoresis, yielding a result of approximately 930 bp. Figure 1 The amplified DNA fragment was purified and recovered using the Novizan FastPure® Gel DNA Extraction MiniKit. The recovered product was then subjected to Sanger DNA sequencing (Qingdao Branch of Beijing Qingke Biotechnology Co., Ltd.). The sequencing results show that the SiMYB sequence is shown in SEQ ID NO.1, with a full-length gene sequence of 930 bases. The amino acid sequence encoding the amino acid residues is shown in SEQ ID NO.2, with a full-length amino acid sequence of 310 amino acid residues.

[0041] Example 2: Obtaining the SiMYB4 overexpression vector

[0042] Using the sequence fragment of SEQ ID NO.1 obtained in Example 1 as a template, adapter primers for SiMYB4 that are seamlessly connected to the entry intermediate vector pGWC were designed. PCR amplification was performed using the primers described below.

[0043] The primer sequences are as follows:

[0044] SiMYB-pGWC-F:AAAGCAGGCTTTGACTTTATGGGAAGGTCT

[0045] SiMYB-pGWC-R: GCTGGGTCTAGAGACTTTTATTTCATCTCCA

[0046] The PCR reaction system and conditions for amplifying the target fragment were as described in Example 1. The intermediate vector pGWC was digested with the restriction endonuclease BanHI. The SiMYB4 gene fragment and the pENTR-digested vector fragment were purified and recovered. The fragments and digested vectors were then seamlessly cloned (Novizan ClonExpress II One Step Cloning Kit). The directional cloning product was transformed into *E. coli* DH5α. Positive single-clone DNA was selected for sequencing verification, yielding the recombinant plasmid pGWC-SiMYB4. The successfully constructed recombinant vector pGWC-SiMYB4 was cloned into the pEarley100-GFP vector using Gateway® LR Clonase™ Enzyme II Mix (Thermo Scientific) and then via attL-attR recombination. The reaction system consisted of: 100 ng pGWC-SiMYB4 vector plasmid, 50 ng pEarley100-GFP vector plasmid, 1 μL Gateway® LR Clonase™ Enzyme II Mix, and ddH2O was added to bring the total volume to 10 μL. The reaction was carried out at 25°C. o The reaction was carried out at C for 4-6 hours. The recombinant product was transformed into *E. coli* DH5α. Positive monoclonal DNA was selected for sequencing verification, yielding the recombinant plasmid pEarley100-GFP-SiMYB4 (…). Figure 2 The successfully constructed recombinant vector pEarley100-GFP-SiMYB4 was transformed into Agrobacterium EHA105 at -80°C. o Preserve the bacterial strain at C for later use.

[0047] Example 3: Obtaining SiMYB4 transgenic material

[0048] A genetic transformation method for Saussurea involucrata suspension callus mediated by Agrobacterium was employed (Rapid Suspension Culture and Genetic Transformation of Saussurea involucrata Cells, 2023, CN 115786232 B). pEarley100-GFP-SiMYB4 was introduced into Saussurea involucrata callus, and DNA was extracted from resistant callus. PCR detection was performed using primers for the pEarley100-GFP vector and primer SiMYB4-R for the SiMYB4 gene.

[0049] The primer sequences are as follows:

[0050] pEarley100-GFP-F: CACGAGGAGCATCGTGGAA

[0051] SiMYB4-R: TTATTTCATCTCCAAGCCTC

[0052] The PCR reaction system for amplifying the target fragment was as follows: 2 μL DNA, 1 μL pEarley100-GFP-F forward primer (10 μM), 1 μL SiMYB-R reverse primer (10 μM), 25 μL PrimeSTAR Max Premix (2X) polymerase, and 18 μL ddH2O. The PCR reaction conditions were: 95 °C. o C 3 min; 94 o C 30 s, 56 o C 30 s; 72 o C 1 min, 30 cycles; 72 o C 5min. After identification, the callus fluorescence status was observed using a fluorescence inverted microscope to finally determine the positive transgenic line ( Figure 3 ).

[0053] Example 4: Molecular identification of SiMYB4 transgenic material

[0054] The positive callus line obtained in Example 3 was selected, and RNA was extracted from the positive callus line using TransZol (TransGen Biotech). The positive callus line was then cryogenically ground in liquid nitrogen until powder was formed, transferred to a 1.5 mL centrifuge tube, and 1 mL of TransZol was added. The mixture was vortexed and incubated at room temperature for 5 min. Then, 200 μL of RNA Extraction Agent was added, and the mixture was vigorously vortexed for 15 s and incubated at room temperature for 3 min. o Centrifuge at 12000 rpm for 15 min. Transfer the colorless supernatant to a new centrifuge tube, add 500 μL of isopropanol, mix by inverting, and incubate at room temperature for 10 min to precipitate RNA. o Centrifuge at 12000 rpm for 10 min. Discard the liquid and retain the precipitate. Add 1 ml of 75% ethanol (prepared with DEPC-treated water), vortex to wash away impurities, 4 o Centrifuge at 1000 rpm for 5 min. Discard the liquid and allow the precipitate to air dry at room temperature. Dissolve the precipitate in 50 μL of RNA lysis buffer and store the sample at -80°C. oStore at C for later use. Reverse transcription of the extracted RNA was performed using TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech Ltd.). The reverse transcription reaction steps were performed according to the instructions for the TransScript One-Step gDNA Removal and cDNA Synthesis Kit. The cDNA product was analyzed using real-time quantitative PCR with primers SiMYB4-qRT-F and SiMYB4-qRT-R to detect the transcriptional abundance of the target gene. The internal control gene was the Saussurea involucrata GAPDH gene. Primer sequences are as follows:

[0055] SiMYB4-qRT-F:ACAATTTCAGGCCGTCGAGTATC

[0056] SiMYB4-qRT-R: AACTGCATTCCTTGCTGTTCGG

[0057] GAPDH-F: TAGCAAGGATGCTCCCATGTTCGT

[0058] GAPDH-R: AAAGGAGCAAGGCAGTTGGTTGTG

[0059] The real-time quantitative PCR reaction system consisted of: 2 μL cDNA, 1 μL SiMYB4-qRT-F forward primer (10 μM), 1 μL SiMYB4-qRT-R reverse primer (10 μM), 10 μL 2X SYBR Green Pro Taq HS Premix* (Hunan Aike Rui Biotechnology Co., Ltd.), and 16 μL ddH2O. The real-time quantitative PCR reaction was detected using a LightCycler® 480 real-time fluorescence quantitative PCR instrument (Roche), and the reaction conditions were as follows: 95 °C. o C pre-denaturation 30 s; 95 o C denaturation 5 s, 60 o Annealing at C for 30 s, extension for 45 cycles. Melt curve determination: 65 o C to 95 o C. Baseline and cycle threshold (Ct value) were automatically generated by the instrument software. The results showed that, compared with the Control pEarley100-GFP empty vector transgenic callus, the expression level of SiMYB4 in the overexpressing callus lines SiMYB4_OE1 / 2 / 3 / 4 / 5 / 6 was significantly increased.

[0060] Example 5: Identification of Metabolic Components of SiMYB4 Transgenic Material

[0061] 1. Experimental Methods

[0062] SiMYB4 transgenic material was flash-frozen in liquid nitrogen. After freeze-drying under vacuum, 50 mg of the sample was weighed and added to 1000 μL of extraction buffer (methanol:acetonitrile:water = 2:2:1). The mixture was vortexed for 30 s. The mixed sample was then ground with steel balls at 45 Hz for 10 min, sonicated for 10 min, and then cooled to -20°C. o Let it stand for 1 hour. After standing, 4 o Centrifuge at 12000 rpm for 15 min, take 500 μL of the supernatant and vacuum dry it in a centrifuge tube. Add 160 μL of reconstitution solution (acetonitrile-water volume ratio = 1:1) to the dried tube to reconstitute. The reconstitution conditions are: vortex for 30 s, then sonicate in an ice-water bath for 10 min. Finally, transfer the reconstituted product 4... o Centrifuge at 12000 rpm for 15 min, and transfer 120 μL of supernatant to a 2 mL sample vial. Take 10 μL of each sample for analysis. Detection was performed using an Acquity I-Class PLUS ultra-high performance liquid chromatography-tandem mass spectrometer and an AB Sciex Qtrap 6500+ high-sensitivity mass spectrometer (Waters). Metabolite analysis was conducted based on a self-built database (Beijing Biomarker Biotechnology Co., Ltd.) and via the Biomarker Cloud Platform (…). http: / / www.biomarker.com.cn / biocloud PCA (principal component analysis) was performed, and differential metabolite pathway enrichment analysis was conducted using the KEGG (Kyoto Encyclopedia of Genes and Genomes) database. For differential flavonoid metabolites, cluster analysis was used to construct heatmaps to visually present the relative differences in the content of various flavonoid compounds in different samples.

[0063] 2. Results Analysis

[0064] (1) Overall differences in the metabolome of the samples: Principal component analysis (PCA) results (Figure 5) showed that the Control group and the SiMYB4_OE group samples showed obvious clustering trend on the score map. The samples within the group had good repeatability and the separation between the groups was significant, indicating that the metabolomics characteristics of snow lotus callus were significantly changed after overexpression of SiMYB4 gene.

[0065] (2) Enrichment of differential metabolite pathways: KEGG pathway analysis results (Figure 6) show that, compared with the Control group, the differential metabolites of SiMYB4_OE material are significantly enriched in the pathways related to flavonoid synthesis, confirming that overexpression of this gene can promote the large accumulation of flavonoids in secondary metabolism.

[0066] (3) Specific differences in flavonoids (refer to Figure 7, cluster heatmap): The cluster heatmap visually shows the relative differences in the content of 18 flavonoids between the Control group and the SiMYB4_OE group; among them, 11 compounds showed a significant upregulation trend in the overexpression lines, including Albanin A. A) Jaceosidin, Narcissin, Hispidulin, Rhamnazin, Chrysoeriol, Nobiletin, 3,5,6,7,8,3′,4′-Heptemthoxyflavone, Diosmetin-7-O-β-D-Glucopyranoside, Diosmetin, and Homoplantaginin.

[0067] The above results further confirm that the SiMYB4 gene is a key positive regulator of the synthesis of flavonoids in snow lotus, and its overexpression can specifically promote the accumulation of various flavonoids.

[0068] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. The SiMYB4 gene of snow lotus, characterized by, The SiMYB4 gene of the snow lotus is one of the following nucleotide sequences: (1) It has the nucleotide sequence shown in SEQ ID NO.1; (2) Homologous sequences of the nucleotide sequence shown in SEQ ID NO.1 with the addition, substitution, insertion or deletion of one or more bases, or their alleles and derived nucleotide sequences.

2. The protein encoded by the SiMYB4 gene according to claim 1, characterized in that, The amino acid sequence of the protein is one of the following sequences: (1) It has the amino acid sequence shown in SEQ ID NO.2; (2) Homologous protein sequences with one or more amino acids added, substituted, inserted or deleted from SEQ ID NO.

2.

3. A recombinant vector, characterized in that, The recombinant vector contains the SiMYB4 gene as described in claim 1.

4. A recombinant bacterium, characterized in that, The recombinant bacteria contain the SiMYB4 gene as described in claim 1 or the recombinant vector as described in claim 3.

5. A primer pair for amplifying the full length or any fragment of the gene described in claim 1, characterized in that, The primer pair includes: The upstream primer has the following nucleotide sequence: SEQ ID NO.3; The downstream primer has the following nucleotide sequence: SEQ ID NO.

4.

6. The application of the SiMYB4 gene and its encoded protein as described in claim 1, the recombinant vector as described in claim 3, or the recombinant bacteria as described in claim 4 in regulating the synthesis of flavonoids from snow lotus.

7. A method for regulating flavonoid compounds from snow lotus, characterized in that, The SiMYB4 gene described in claim 1 is transferred into snow lotus to increase the content of flavonoids in snow lotus.