Zmiaa gene and application thereof in regulating size of corn ear

By introducing loss-of-function mutations or inhibiting the expression of the ZmIAA25, ZmIAA15, and ZmIAA33 genes into maize plants, and using CRISPR/Cas9 gene editing technology, the female ear traits of maize were significantly improved, solving the problem of low efficiency in traditional breeding and providing new breeding resources and research ideas.

CN121718569BActive Publication Date: 2026-05-29THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Filing Date
2026-02-26
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Traditional breeding methods are inefficient at improving maize ear traits, lacking molecular-level genetic improvement techniques, and are unable to significantly improve ear length, ear width, number of kernels per row, and ear weight.

Method used

By introducing loss-of-function mutations or inhibiting the expression of the ZmIAA25, ZmIAA15, and ZmIAA33 genes into maize plants, a three-gene knockout vector was constructed using CRISPR/Cas9 gene editing technology to achieve significant loss of gene function.

Benefits of technology

It significantly increases the length, width, number of kernels per row, and weight of maize ears, providing new breeding resources and insights into gene action mechanisms, and promoting sustainable development in maize breeding and agriculture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121718569B_ABST
    Figure CN121718569B_ABST
Patent Text Reader

Abstract

The application discloses a kind of ZmIAA Gene and its application in regulating the size of corn ear , Belong to the field of plant biotechnology breeding.The corn ZmIAA25, ZmIAA15, ZmIAA33 Gene, after the three endogenous genes each produce at least one functional loss mutation in plant, or ZmIAA25, ZmIAA15, ZmIAA33 After the expression of the gene is inhibited, the corn plant can obtain the significant increase of any one of the ear length, ear width, row grain number and / or ear weight.The aforementioned ZmIAA25, ZmIAA15, ZmIAA33 Gene and its functional loss mutant resource, application method, can effectively cultivate large-ear, high-yield corn variety, and have wide application prospect in the field of corn biotechnology breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology breeding, specifically involving the utilization of ZmIAA25, ZmIAA15, ZmIAA33 Methods and applications of regulating maize ear size by generating three loss-of-function mutations in the genes. Background Technology

[0002] Maize is one of the world's most important food and feed crops, and its continued yield increase is crucial to ensuring food security. The female ear, as the direct carrier of maize kernels, directly determines the number and weight of kernels in the ear through its morphogenesis and development, making it a core organ affecting final yield. Therefore, in-depth analysis of the genetic regulatory mechanisms of maize ear development and optimization of ear traits through genetic improvement have always been key directions in maize breeding and basic research.

[0003] The development of the female ear is a highly complex biological process involving continuous and precise stages, including the transformation of shoot apical meristem into inflorescence meristem, spikelet meristem formation, floral organ differentiation, and subsequent grain filling. This process is synergistically regulated by multi-level, multi-pathway genetic networks, involving key physiological processes such as plant hormone signal transduction, transcription factor cascade regulation, cell cycle and proliferation regulation, and sugar metabolism and transport. The spatial distribution dynamics of hormones such as auxin and cytokinin regulate meristem activity and organ primordia initiation; transcription factors such as MADS-box and AP2 / ERF family specifically regulate inflorescence structure and floral organ attributes; while sugar metabolism and transport genes simultaneously perform the dual functions of energy supply and sink strength signal transmission, synergistically affecting grain filling efficiency and final sink capacity. Although some related genes have been identified, the key pivot genes regulating the female ear and their synergistic mechanisms remain unclear. Traditional breeding for improving ear traits relies heavily on phenotypic selection, which is inefficient and time-consuming. There is an urgent need to elucidate its genetic basis at the molecular level to provide new targets for precision breeding.

[0004] This study focused on members of the early response gene family of maize auxin. By creating multi-gene mutants and conducting phylogenetic analysis, key genes that significantly and synergistically enhance ear traits were successfully identified. This discovery not only deepens our understanding of the molecular mechanisms of maize ear development but also provides genetic resources and technical solutions with direct application value for molecular design breeding. Summary of the Invention

[0005] All references cited herein are incorporated herein by reference. Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Unless otherwise stated, the techniques used or mentioned herein are standard techniques known to one of ordinary skill in the art. Materials, methods, and examples are for illustrative purposes only and are not intended to be limiting.

[0006] This application's embodiments, through a series of experimental studies, have discovered that [the following process] occurs in corn plants. ZmIAA25, ZmIAA15, ZmIAA33 After functional loss mutations of the three genes, unexpected technical effects are achieved. The mutant plants have a phenotype with a significant increase in any one of the traits of ear length, ear width, number of kernels per row, and / or ear weight. The aforementioned gene resources and functions are of great significance to maize breeding.

[0007] Optionally, embodiments of this application provide a method for producing maize plants, wherein the maize plants have a phenotype with a significant increase in any one of the following traits: ear length, ear width, number of kernels per row, and / or ear weight. The method includes the following steps:

[0008] One or more maize plants are produced, and the maize plants shown have endogenous... ZmIAA25, ZmIAA15, ZmIAA33 Each of the three genes contains at least one loss-of-function mutation, or an endogenous mutation. ZmIAA25, ZmIAA15, ZmIAA33 The expression of the three genes was suppressed;

[0009] Obtain at least one seed from the corn plant produced in the aforementioned steps;

[0010] Optionally, wherein ZmIAA25 The gene's polynucleotide sequence is selected from one of the following groups of sequences:

[0011] (a) A polynucleotide sequence as shown in SEQ ID No: 1 or 2; or

[0012] (b) Its encoded amino acid sequence is the polynucleotide sequence shown in SEQ ID No:3.

[0013] Optionally, wherein ZmIAA15 The gene's polynucleotide sequence is selected from one of the following groups of sequences:

[0014] (c) A polynucleotide sequence as shown in SEQ ID No:4 or 5; or

[0015] (d) Its encoded amino acid sequence is the polynucleotide sequence shown in SEQ ID No:6.

[0016] Optionally, wherein ZmIAA33 The gene's polynucleotide sequence is selected from one of the following groups of sequences:

[0017] (e) A polynucleotide sequence as shown in SEQ ID No:7 or 8; or

[0018] (f) Its encoded amino acid sequence is a polynucleotide sequence as shown in SEQ ID No:9.

[0019] Optionally, the embodiments provided in this application... ZmIAA25, ZmIAA15, ZmIAA33Genes, including homologous genes or the same gene from different varieties that have at least 80%, 85%, 90%, 95%, 98%, or 99% sequence similarity to their polynucleotide sequences, or genes disclosed in the embodiments of this invention. ZmIAA25, ZmIAA15, ZmIAA33 The homologous gene or the same gene in different varieties has at least 90%, 95% or 98% sequence similarity in amino acid sequence, and the homologous gene, after endogenous homozygous loss-of-function mutation, has the function of significantly increasing any one of the traits of female ear length, ear width, number of grains per row and / or ear weight, and the homologous gene can be isolated from any plant.

[0020] Optionally, the method provided in this application can be applied to any substance containing ZmIAA25, ZmIAA15, ZmIAA33 Plants with homologous genes. Preferably, the plants include monocotyledonous plants such as corn, millet, wheat, barley, rye, rice, and sorghum, and dicotyledonous plants such as cotton, corn, peanut, sunflower, sweet potato, potato, apple, and tobacco.

[0021] The percentage of sequence similarity described in this application can be obtained using well-known bioinformatics algorithms, including the Myers and Miller algorithm, the Needleman-Wunsch global alignment method, the Smith-Waterman local alignment method, the Pearson and Lipman similarity search method, and the Karlin and Altschul algorithm, which are well known to those skilled in the art.

[0022] Those skilled in the art should know that single nucleotide polymorphisms (SNPs) exist for the same gene among different varieties of the same plant, meaning that the nucleotide sequence of the same gene often differs by a few bases. However, there are many varieties of the same crop, and it is impossible for the inventors to list them all. The embodiments of this application only provide sequences of representative varieties of maize. Therefore, those skilled in the art should know that sequences from different varieties may differ from those disclosed in this invention. ZmIAA25, ZmIAA15, ZmIAA33 The nucleotide sequences of genes and their nucleotide sequences containing SNPs, and the methods and applications for obtaining traits such as increased ear length, ear width, number of grains per row, and / or ear weight by utilizing their endogenous loss-of-function mutations, are also within the scope of protection of this invention.

[0023] Optionally, the loss-of-function mutations described in this application are obtained by mutation, which includes substitution, deletion, and / or addition of one or more nucleotides in the nucleotide sequence of the gene.

[0024] Optionally, the loss-of-function mutations include, but are not limited to, those obtained by methods such as physical mutagenesis, chemical mutagenesis, and gene editing. Physical mutagenesis includes, but is not limited to, radiation mutagenesis, space breeding, etc.; chemical mutagenesis methods include mutagenesis caused by treatment with mutagens such as EMS; gene editing methods include, but are not limited to, methods such as ZFN, TALEN, and / or CRISPR / Cas.

[0025] Those skilled in the art know that the main principle of the CRISPR / Cas gene editing system or gene editing method is to find the position for gene editing in the host genome through a nucleic acid fragment called guide RNA (gRNA), that is, the target DNA sequence, and then cut the DNA through the Cas protein. In this application, the Cas protein includes, but is not limited to, proteins such as Cas9, Cas12, Cas12a, Cas12j, Cas12e, Cas13, and / or Cas14.

[0026] Optionally, when the gene editing system used is CRISPR / Cas9, the target sequence used in the CRISPR / Cas9 method for the mutant gene sequence is selected from one of the sequences in the following group:

[0027] (a) A fragment conforming to the 5'-Nx-NGG-3' sequence arrangement rule in the nucleotide sequences shown in SEQ ID No.: 1, 2, 4, 5, 7, or 8, where N represents any one of A, G, C, and T, 14 < X < 30, and X is an integer, and Nx represents X consecutive nucleotides; or (b) a nucleotide sequence complementary to the polynucleotide sequence described in (a).

[0028] Optionally, the target sequence of the CRISPR / Cas9 technology is as shown in SEQ ID NO: 10, 11, 12, 13, 14, or 15.

[0029] Optionally, the loss-of-function mutation is the insertion of 1 base at the 632nd base or the insertion of 1 base at the 992nd base of SEQ ID NO: 1; and the deletion of 1 base at the 133rd base or the insertion of 1 base at the 135th base of SEQ ID NO: 4; and the deletion of 2 bases at the 176th base, or the deletion of 9 bases at the 427th base, or the deletion of 39 bases at the 424th base, or the deletion of 4 bases at the ills base, or the deletion of 1 base at the 435th base of SEQ IDNO: 7. Optionally, the loss-of-function mutant plants described in the embodiments of this application can also be obtained by hybridizing with maize plants having such loss-of-function mutations or overexpressions.

[0030] [[ID=http: / / www.wipo.int / ipcpub / wo / 2018 / 180476 / 180476.html]]Optionally, in the method described in the embodiments of this application, the reduction or inhibitionZmIAA25, ZmIAA15 and ZmIAA33 Normal expression or protein function of homologous genes can be achieved through RNA interference (RNAi) and / or mutation, or by altering the promoter of functional genes using natural variation, molecular biology methods, or gene editing to obtain a phenotype with reduced expression levels or protein content. Those skilled in the art will recognize that RNAi technology is a conventional technique in the field, which involves the specific binding of 21-23 bp short double-stranded RNA (siRNA: small interfering RNA) or long double-stranded RNA (dsRNA: double-stranded RNA) to the homologous region of the mRNA expressing the target gene, causing mRNA degradation and thus inhibiting gene expression.

[0031] Alternatively, in this application, endogenous maize can be inhibited using RNAi. ZmIAA25, ZmIAA15 and ZmIAA33 Gene expression, thereby affecting the activity of the aforementioned genes, and inhibiting gene expression, can significantly increase any of the traits of female ear length, ear width, number of grains per row, and / or ear weight.

[0032] Optionally, this application also provides ZmIAA25, ZmIAA15 and ZmIAA33 Application of genes in producing maize plants with a significant increase in any of the traits of ear length, ear width, number of kernels per row, and / or ear weight.

[0033] Optionally, this application also provides a method for obtaining this application by means of any of the foregoing. ZmIAA25, ZmIAA15 and ZmIAA33 The application of gene loss mutants in maize breeding, preferably, includes, but is not limited to, applications that significantly increase any of the traits of ear length, ear width, number of kernels per row, and / or ear weight in maize plants.

[0034] Optionally, embodiments of this application also provide feed, coarse flour, protein, or oil products made from corn, wherein the feed, coarse flour, protein, or oil products contain... ZmIAA25, ZmIAA15 and ZmIAA33 Loss-of-function mutants of genes, the ZmIAA25, ZmIAA15 and ZmIAA33 Each contains at least one loss-of-function mutation, or endogenous mutation. ZmIAA25, ZmIAA15 and ZmIAA33 Gene expression is suppressed. The loss-of-function mutation includes the substitution, deletion, and / or addition of one or more nucleotides in the nucleotide sequence of the aforementioned gene.

[0035] Optionally, embodiments of this application also provide a gene mutant, wherein the gene mutant is... ZmIAA25, ZmIAA15 and ZmIAA33A loss-of-function mutant, characterized by endogenous mutations in the maize plant. ZmIAA25, ZmIAA15 and ZmIAA33 After gene mutation, it has the function of significantly increasing any one of the traits of female ear length, ear width, number of kernels per row, and / or ear weight, optionally, wherein... ZmIAA25 The gene's polynucleotide sequence is selected from one of the following groups of sequences:

[0036] (a) A polynucleotide sequence as shown in SEQ ID No: 1 or 2; or

[0037] (b) Its encoded amino acid sequence is the polynucleotide sequence shown in SEQ ID No:3.

[0038] Optionally, wherein ZmIAA15 The gene's polynucleotide sequence is selected from one of the following groups of sequences:

[0039] (c) A polynucleotide sequence as shown in SEQ ID No:4 or 5; or

[0040] (d) Its encoded amino acid sequence is the polynucleotide sequence shown in SEQ ID No:6.

[0041] Optionally, wherein ZmIAA33 The gene's polynucleotide sequence is selected from one of the following groups of sequences:

[0042] (e) A polynucleotide sequence as shown in SEQ ID No:7 or 8; or

[0043] (f) Its encoded amino acid sequence is the polynucleotide sequence shown in SEQ ID No:9.

[0044] Optionally, the methods described in the embodiments of this application for transferring nucleotide sequences, vectors, constructs, or expression cassettes into plants, introducing them into plants, or transforming plants all refer to transferring the target nucleotide sequence, construct, vector, or expression cassette into recipient cells or recipient plants through conventional transgenic methods or methods of hybridization with target transgenic plants. Any transgenic method known to those skilled in the art can be used to transform recombinant expression vectors into plant cells to produce transgenic plants or mutants of the embodiments of this application. Transformation methods may include direct or indirect transformation methods. Specifically, the transformation methods include, but are not limited to, polyethylene glycol-induced DNA uptake, liposome-mediated transformation, gene gun introduction, electroporation, microinjection, and Agrobacterium-mediated plant transformation methods.

[0045] Compared with the prior art, this application has the following beneficial effects:

[0046] (1) This application provides a method for producing maize plants and its application, by obtaining ZmIAA25,ZmIAA15, ZmIAA33 Three-gene loss-of-function mutants, or those that suppress function in plants ZmIAA25, ZmIAA15, ZmIAA33 The expression levels of the aforementioned genes were measured to obtain plants with a significant increase in any one of the following traits: ear length, ear width, number of kernels per row, and / or ear weight. These genes, methods, and their applications provide new germplasm resources and breeding strategies for maize breeding, which are of great significance to global food security and sustainable agricultural development.

[0047] (2) It was clarified that corn ZmIAA25, ZmIAA15, ZmIAA33 The functions resulting from gene mutations provide new genetic resources for crop species and offer new insights into the study of gene action mechanism networks.

[0048] Term definitions involved in the present invention

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods, apparatus, and materials similar to or equivalent to those described herein may be used in the practice or testing of this invention, preferred methods, apparatus, and materials are now described.

[0050] In the context of this application, the terms "polynucleotide" or "nucleotide" mean deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and their polymers in single-stranded or double-stranded form. Unless specifically limited, the term covers nucleic acids containing known analogs of natural nucleotides, which have similar binding properties to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.

[0051] In this application, the term "homologous gene" refers to two or more gene sequences with a sequence similarity of 80%, including orthologous genes (also known as vertical homologous genes, positive homologous genes, or directed evolutionary homologous genes), transverse homologous genes (also known as paralogous genes, paralogous homologous genes, or parallel evolutionary homologous genes), and / or heterologous genes.

[0052] The term "sequence similarity" refers to the degree of similarity between two sequences. It is a quantitative concept used to compare the similarity between different sequences, thereby discovering and analyzing the association between the two sequences. Sequence similarity can be used to compare gene sequences, protein sequences, DNA sequences, etc.

[0053] The term "strict hybridization conditions" as used in this application refers to conditions of low ionic strength and high temperature known in the art. Typically, under strict conditions, the detectability of a probe hybridizing with its target sequence is significantly higher than that with other sequences (e.g., at least twice the background level). Strict hybridization conditions are sequence-dependent and will vary under different environmental conditions; longer sequences hybridize specifically at higher temperatures. Target sequences that are 100% complementary to the probe can be identified by controlling the strictness of hybridization or washing conditions. Detailed guidance on nucleic acid hybridization can be found in relevant literature (Tijssen, ...). Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Probes, (Overview of principles of hybridization and the strategy of nucleic acid assays. 1993). More specifically, the stringent conditions are typically chosen to be below the melting point (T0) of the specific sequence at a specified ionic strength pH. m Approximately 5-10℃. m The temperature at which 50% of the probe complementary to the target sequence hybridizes to the target sequence under equilibrium conditions (at specified ionic strength, pH, and nucleic acid concentration) (because the target sequence is present in excess, therefore at T...). m (Under equilibrium conditions, 50% of the probe is occupied). Strict conditions may include: a salt concentration of less than about 1.0 M sodium ions at pH 7.0 to 8.3, typically about 0.01 to 1.0 M sodium ions (or other salts), and a temperature of at least about 30°C for short probes (including, but not limited to, 10 to 50 nucleotides) and at least about 60°C for long probes (including, but not limited to, greater than 50 nucleotides). Strict conditions can also be achieved by adding a destabilizing agent such as formamide. For selective or specific hybridization, the positive signal may be at least twice the background hybridization, and, where appropriate, 10 times the background hybridization. Exemplary strict hybridization conditions may be: 50% formamide, 5×SSC and 1% SDS, incubated at 42°C; or 5×SSC, 1% SDS, incubated at 65°C, washed in 0.2×SSC and washed in 0.1% SDS at 65°C. The washing can be performed for 5, 15, 30, 60, 120 minutes or longer.

[0054] The term "recombinant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, along with vectors containing helper plasmids, are commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: the cis-acting sequence required for T-DNA transfer, a selection marker engineered for expression in plant cells, and the heterologous DNA sequence to be transcribed.

[0055] The term "hybridization" is used in a broad sense to refer to the process by which gametes from different populations or genotypes combine to produce hybrids. Depending on the parental relationship, it includes close hybridization and distant hybridization.

[0056] The term "mutation" as used in this application refers to a "loss-of-function mutation" or "loss-of-function mutation," which is a mutation in the coding sequence of a gene that causes a reduction or complete loss of function in the gene product (usually a protein). Loss-of-function mutations can be caused, for example, by truncation of the gene product (due to frameshift or nonsense mutations), and the phenotype associated with an allele having a loss-of-function mutation can be recessive or dominant.

[0057] The term "RNA interference" (RNAi) is a gene blocking technology that uses a double-stranded RNA (dsRNA) molecule to block or silence the expression of a specific gene at the mRNA level; it is also known as sequence-specific post-transcriptional gene silencing (PTGS). Attached Figure Description

[0058] Figure 1 for ZmIAA25, ZmIAA15, ZmIAA33 A schematic diagram of the gene-editing CRISPR / Cas9 vector.

[0059] Figure 2 for ZmIAA25, ZmIAA15, ZmIAA33 A schematic diagram of the linear structure of the T-DNA region elements and target sites in the CRISPR / Cas9 vector for gene knockout.

[0060] Figure 3 for ZmIAA25 A schematic diagram of mutation types in gene-edited mutant materials.

[0061] Figure 4 for ZmIAA15 A schematic diagram of mutation types in gene-edited mutant materials.

[0062] Figure 5 for ZmIAA33 A schematic diagram of mutation types in gene-edited mutant materials.

[0063] Figure 6 For Hainan field in 2022 ZmIAA25, ZmIAA15, ZmIAA33 The three-gene edited mutant materials and their corresponding wild-type control female ear phenotypes are shown, where WWW is the wild-type control and MMM1, MMM2, and MMM3 are three different three-gene mutant materials.

[0064] Figure 7 For the 2023 Langfang fieldsZmIAA25, ZmIAA15, ZmIAA33 The overall plant phenotype of the three gene-edited mutant material and its corresponding wild-type control.

[0065] Figure 8 For the 2023 Langfang fields ZmIAA25, ZmIAA15, ZmIAA33 The phenotypic observation of the three gene-edited mutant materials and their corresponding wild-type control female ears (A), as well as the statistics of ear length (B), ear width (C), number of grains per row (D), and ear weight (E).

[0066] Figure 9 For the 2024 Langfang fields ZmIAA25, ZmIAA15, ZmIAA33 Three gene-edited mutant materials and their corresponding wild-type control female ear phenotypes. Detailed Implementation

[0067] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0068] The inbred lines and maize varieties used in the following examples can be obtained from the "China Crop Germplasm Information Network" and the corresponding seeds can be obtained by applying for them.

[0069] Example 1. ZmIAA25 / ZmIAA15 / ZmIAA33 Construction of a three-gene knockout vector

[0070] corn ZmIAA25 The genomic DNA sequence is shown in SEQ ID NO:1, which has 4 transcripts, with the dominant transcript being the P4 transcript. The corresponding CDS sequence is shown in SEQ ID NO:2, and the corresponding protein amino acid sequence is shown in SEQ ID NO:3. ZmIAA15 The genomic DNA sequence is shown in SEQ ID NO:4, which has two transcripts, with the dominant transcript being the P2 transcript. The corresponding CDS sequence is shown in SEQ ID NO:5, and the corresponding protein amino acid sequence is shown in SEQ ID NO:6. ZmIAA33 The genomic DNA sequence is shown in SEQ ID NO:7, containing three transcripts, with the dominant transcript being P1. The corresponding CDS sequence is shown in SEQ ID NO:8, and the corresponding protein amino acid sequence is shown in SEQ ID NO:9. For further research... ZmIAA25 / ZmIAA15 / ZmIAA33 The function of genes, as described in this embodiment, is constructed. ZmIAA25 / ZmIAA15 / ZmIAA33 CRISPR / Cas9 gene knockout vector for the gene, in order to simultaneously obtain ZmIAA25, ZmIAA15, ZmIAA33In the triple mutant, we constructed the target sites of three genes onto the same CRISPR-Cas9 vector.

[0071] choose ZmIAA25 The target region is located between the second and third exons of the (Zm00001eb271530_T004) gene, based on... ZmIAA25 The nucleotide sequence of the gene (SEQ ID NO:1) was used to identify target 1 and target 2 using the online tool GRISPR-P2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The target sequences are as follows: ZmIAA25 -Target1: 5'-CCATCGGGCGGAAGGTGGACGTG-3' (SEQ ID NO: 10); ZmIAA25 -Target2: 5'-GAAGGGGACTGGTTGCTCGTCGG-3' (SEQ ID NO: 11). choose ZmIAA15 The target region is located between the first and second exons of the (Zm00001eb169210_T002) gene, based on... ZmIAA15 The nucleotide sequence of the gene (SEQ ID NO:4) was used to identify target sites 3 and 4 using the online tool GRISPR-P2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The target site sequences are as follows: ZmIAA15 -Target3: 5'-CCACTCACCAGAACTATGCCTCG-3' (SEQ ID NO: 12); ZmIAA15 - Target4: 5'-CCATCATGCGAGCTTAATGGGTT-3' (SEQ ID NO: 13). choose ZmIAA33 The target region is located between the first and second exons of the (Zm00001eb319470_T001) gene, based on... ZmIAA33 The nucleotide sequence of the gene (SEQ ID NO:7) was used to identify target sites 5 and 6 using the online tool GRISPR-P2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The target site sequences are as follows: ZmIAA33 -Target5: 5'-GACCTCACGGAGCTGACGCTGGG-3' (SEQ ID NO: 14); ZmIAA33-Target6: 5'-TGGACGGGACGCCGTACCTGAGG-3' (SEQ ID NO:15). Next, an sgRNA (single guide RNA) sequence targeting the target gene was designed. The specific nucleotide sequence of the sgRNA is: GTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:16). Homologous recombination technology was used to ligate the sgRNA into the pCPB vector (see the literature RNA-guided Cas9 as an in vivo desired-target mutator in maize. Plant Biotechnol J. 2017 Dec;15(12):1566-1576. doi: 10.1111 / pbi.12739.). The target sites of the three genes were constructed on the same CRISPR-Cas9 vector, resulting in... ZmIAA25, ZmIAA15, ZmIAA33 The three-gene knockout vector was named pCPB-Ubi::hspCas9. ZmIAA25, ZmIAA15, ZmIAA33 The structure of the three-gene knockout vector is as follows: Figure 1 As shown, the component structure between LB and RB is as follows: Figure 2 As shown.

[0072] Example 2. ZmIAA25 / ZmIAA15 / ZmIAA33 Identification of gene-edited materials

[0073] Using Agrobacterium-mediated transformation ZmIAA25, ZmIAA15, ZmIAA33 The three-gene knockout vector pCPB-Ubi::hspCas9 was genetically transformed into maize plants (maize inbred line ZC01). The obtained T0 generation transgenic seeds were planted in an experimental field. At stage V5, 0.02% glufosinate was applied to the leaves to determine whether the plants carried the CRISPR-Cas9 vector (positive or negative). Plants that were negative (not carrying the CRISPR-Cas9 vector) were preferentially selected for mutant identification. The obtained maize plants were subjected to PCR identification and Sanger sequencing of nucleotide sequences. Plants with frameshift mutations were selected for self-pollination and seed saving. The harvested T1 generation seeds were sown in the experimental field, and the above operations were repeated to obtain stable, homozygous mutants, which were then self-pollinated and saved for future use. ZmIAA25 Specific primers were designed upstream and downstream of the two targets, with primer sequences as follows: ZmIAA25 -F: 5'-GAAGGGGACTGGTTGCTCGTCGG-3' (SEQ ID NO: 17), ZmIAA25-R: 5'-GTACGTACTGCTACGGGCAC-3' (SEQ ID NO: 18), ZmIAA25 There are two mutation types, named respectively. ZmIAA25 -M1 and ZmIAA25 -M2, its gene mutation types are as follows Figure 3 As shown. ZmIAA25 The M1 mutation is characterized by the insertion of one base at target site 1 and the deletion of one base at target site 2, resulting in... ZmIAA25 The genomic DNA (SEQ ID NO:1) has a 1-base insertion at base 632 and a 1-base insertion at base 992, or ZmIAA25 The transcript Zm00001eb271530_T004 has a 1-base insertion at 347 and a 1-base insertion at 528 in its CDS (SEQ ID NO:2), resulting in a frameshift mutation in the amino acid sequence and premature protein termination. ZmIAA25 The M2 mutation is characterized by the insertion of one base at target site 1 and the deletion of one base at target site 2, resulting in... ZmIAA25 The genomic DNA has a 1-base insertion at base 632 and a 1-base deletion at base 991, or ZmIAA25 The transcript Zm00001eb271530_T004 has an insertion of one base at CDS position 347 and a deletion of one base at CDS position 527, resulting in a frameshift mutation in the amino acid sequence and premature protein termination; ZmIAA15 Specific primers were designed upstream and downstream of the two targets, with primer sequences as follows: ZmIAA15 -F: 5'-GAGGTTGAGGTGCATCCTGG-3' (SEQ ID NO: 19), ZmIAA15 -R: 5'-GAGTAGTGGCCGTAGCATCTC-3' (SEQ ID NO: 20), ZmIAA15 There are two mutation types, named ZmIAA15-M1 and ZmIAA15-M2, respectively, and their gene mutation types are as follows: Figure 4 As shown. ZmIAA15 The M1 mutation is characterized by a 1-base deletion at target site 3 and no mutation at target site 4, resulting in... ZmIAA15 The genomic DNA (SEQ ID NO:4) has a 1-base deletion at base 133, or ZmIAA15 The CDS (SEQ ID NO:5) of transcript Zm00001eb169210_T002 has a 1-base deletion at position 133, resulting in a frameshift mutation in the amino acid sequence and premature protein termination. ZmIAA15 The M2 mutation is characterized by the insertion of one base at target site 3, with no mutation at target site 4, resulting in... ZmIAA15 The genomic DNA (SEQ ID NO:4) has a 1-base insertion at base 135, or ZmIAA15The CDS of transcript Zm00001eb169210_T002 has an insertion of 1 base at position 135, resulting in a frameshift mutation in the amino acid sequence and premature protein termination. ZmIAA33 There are three mutation types, named respectively. ZmIAA33 -M1、 ZmIAA33 -M2 and ZmIAA33 -M3, its gene mutation types are as follows Figure 5 As shown. In ZmIAA33 Specific primers were designed upstream and downstream of the two targets, with primer sequences as follows: ZmIAA33 -F: 5'-TCCACCCTCACGCTTCATTC-3' (SEQ ID NO: 21), ZmIAA33 -R: 5'-ATTACAGAAAGCGCAACGAACTC-3' (SEQ ID NO: 22), ZmIAA33 The M1 mutation is characterized by a 2-base deletion at target site 5 and a 9-base deletion at target site 6, resulting in... ZmIAA33 The genomic DNA (SEQ ID NO:7) has a 2-base deletion at base 176 and a 9-base deletion at base 427, or ZmIAA33 The transcript Zm00001eb319470_T001 has a 2-base deletion at 45 and a 9-base deletion at 161 in its CDS (SEQ ID NO:8), resulting in a frameshift mutation in the amino acid sequence. ZmIAA33 The M2 mutation is characterized by a 2-base deletion at target site 5 and a 39-base deletion at target site 6, resulting in... ZmIAA33 The genomic DNA (SEQ ID NO:7) has a 2-base deletion at base 176 and a 39-base deletion at base 424, or ZmIAA33 The transcript Zm00001eb319470_T001 has a 2-base deletion at base 45 and a 39-base deletion at base 158, resulting in a frameshift mutation in the amino acid sequence. ZmIAA33 The M3 mutation is characterized by a 4-base deletion at target site 5 and a 1-base deletion at target site 6, resulting in... ZmIAA33 The genomic DNA (SEQ ID NO:7) has a 4-base deletion at base 172 and a 1-base deletion at base 435, or ZmIAA33 The transcript Zm00001eb319470_T001 had a 4-base deletion at base 41 and a 1-base deletion at base 169 in its CDS, resulting in a frameshift mutation and premature protein termination. Three homozygous mutant plant types with mutations in all three genes were ultimately obtained. ZmIAA25- M1 / ZmIAA15 -M1 / ZmIAA33 The M1 mutation combination type is named MMM1. ZmIAA25- M2 / ZmIAA15 -M1 / ZmIAA33-M2 is named MMM2, ZmIAA25- M1 / ZmIAA15 -M2 / ZmIAA33 -M3 is named MMM3.

[0074] Example 3. ZmIAA25 / ZmIAA15 / ZmIAA33 Field phenotypic analysis of three-gene mutants

[0075] The materials were sown in experimental fields. One experimental site was the experimental base of the Institute of Biotechnology, Chinese Academy of Agricultural Sciences, in the Wanzhong Company Industry-University-Research Demonstration Park, Wengmao Village, Jianfeng Town, Ledong Li Autonomous County, Sanya City, Hainan Province (18°44′60″N, 109°10′17″E), which has a tropical monsoon climate with relatively high winter temperatures, suitable for maize growth. The second experimental site was the experimental base of the Chinese Academy of Agricultural Sciences in the International High-tech Industrial Park, Yizhihuiying and Lisunwa Village, Wanzhuang Town, Guangyang District, Langfang City, Hebei Province (39°35′28″N, 116°35′53″E), which has a cold temperate semi-arid climate. Plant phenotypes were observed through multi-year, multi-site planting (Hainan in 2022, Langfang in 2023, and Langfang in 2024).

[0076] At the Sanya Peak Test Base in Hainan in 2022, three species were identified for the first time. ZmIAA25, ZmIAA15, ZmIAA33 Homozygous mutants with simultaneous mutations in all three genes were selected, with one plant of each mutant type. The female ear phenotype was observed; compared to the wild-type control WWW, the ears of the three-mutant material were larger. Figure 6 Seeds were preserved and propagated at the Langfang, Hebei experimental base in 2023 to observe the phenotype of plants in the field. The maize mutant described in this invention was planted with a wild-type control with the same genetic background under the same season, field conditions, and cultivation conditions. Visual comparison showed that, compared to the wild-type control (WWW), the mutant maize plants exhibited more vigorous vegetative growth and appeared thicker and stronger. Figure 7 The female ears of the mutant maize plants were generally longer and thicker than those of the control population, and the ear outline under the husks was significantly larger. After maturity, the female ears of the mutant and control were randomly selected and compared side by side after the husks were removed. The mutant ears had thicker cobs, more compact kernel arrangement, and better overall volume and plumpness than the control. Trait measurements were also performed: ear length (length from base to tip); ear width (maximum diameter at the middle of the ear); the number of kernels in a typical row of kernels at the middle of the ear was counted; the harvested whole female ears were placed in a well-ventilated area to air dry naturally, or dried in a 40°C oven to constant weight until the kernel moisture content reached approximately 14% for safe storage; the weight of the dried, unthreshed whole female ear (grams) was measured as ear weight. The results showed that compared with the wild-type control WWW with the same genetic background, ZmIAA25, ZmIAA15, ZmIAA33The homozygous mutants with simultaneous mutations in all three genes showed significantly increased ear length, ear width, number of grains per row, and ear weight (P<0.05). Figure 8 Furthermore, in a planting trial conducted at the Langfang experimental base in 2024, it was also observed that the mutant ears were significantly larger than the control phenotype. Figure 9 ).

[0077] In summary, the above experimental results show that, ZmIAA25, ZmIAA15, ZmIAA33 This gene has the function of regulating the size of maize female ears. Mutants resulting from simultaneous mutation of the three genes exhibit a phenotype with significantly increased ear length, ear width, number of kernels per row, and ear weight. The above experiments demonstrate that this three-gene mutant can directly increase maize yield and has significant agricultural application value in the field of breeding.

[0078] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for producing corn plants, characterized in that, The maize plant has a phenotype with an increase in any one of the traits of ear length, ear width, kernel number per row, and / or ear weight. The method includes: Producing one or more maize plants, said maize plants endogenous ZmIAA25, ZmIAA15 and ZmIAA33 Each gene contains at least one loss-of-function mutation, which is obtained through gene editing technology; The ZmIAA25 The gene's polynucleotide sequence is selected from one of the following groups of sequences: (a) a polynucleotide sequence as shown in SEQ ID No: 1 or 2; or (b) a polynucleotide sequence encoding an amino acid sequence as shown in SEQ ID No: 3; The ZmIAA15 The gene's polynucleotide sequence is selected from one of the following groups of sequences: (a) a polynucleotide sequence as shown in SEQ ID No: 4 or 5; or (b) a polynucleotide sequence encoding an amino acid sequence as shown in SEQ ID No: 6; The ZmIAA33 The gene's polynucleotide sequence is selected from one of the following groups of sequences: (a) a polynucleotide sequence as shown in SEQ ID No: 7 or 8; or (b) a polynucleotide sequence encoding an amino acid sequence as shown in SEQ ID No:

9.

2. The method according to claim 1, wherein the loss-of-function mutation includes substitution, deletion, and / or addition of one or more nucleotides in the polynucleotide sequence of the gene.

3. The method according to claim 1, wherein the gene editing technology is CRISPR / Cas gene editing technology.

4. The method according to claim 3, wherein the CRISPR / Cas gene editing technology is CRISPR / Cas9 gene editing technology, and the target sequence used in the CRISPR / Cas9 is selected from one of the sequences in the following group: (I) a fragment conforming to the 5'-Nx-NGG-3' sequence arrangement rule in the nucleotide sequences shown in SEQ ID No: 1, 2, 4, 5, 7, or 8, where N represents any one of A, G, C, and T, 14 < X < 30, and X is an integer, and Nx represents X consecutive nucleotides; or (II) a nucleotide sequence complementary to the polynucleotide sequence described in (I).

5. The method according to claim 4, wherein the target sequence is as shown in SEQ ID NO: 10, 11, 12, 13, 14, or 15.

6. The method according to any one of claims 1-4, wherein the loss-of-function mutation is insertion of 1 base at the 632nd base or insertion of 1 base at the 992nd base of SEQ ID NO: 1; and deletion of 1 base at the 133rd base or insertion of 1 base at the 135th base of SEQ ID NO: 4; and deletion of 2 bases at the 176th base, or deletion of 9 bases at the 427th base, or deletion of the 39 bases at the 424th base, or deletion of 4 bases at the 172nd base, or deletion of 1 base at the 435th base of SEQ ID NO:

7.

7. Use of the method according to any one of claims 1-6 in cultivating a maize plant with a significant increase in any one of the traits of ear length, ear width, kernel number per row, and / or ear weight.