Method for identifying purity of cauliflower 'Youison-65' hybrid as well as molecular marker and application of molecular marker

Abstract

The invention discloses a method for identifying the purity of a cauliflower 'Youpon 65' hybrid as well as a molecular marker and application. According to the method, on the basis of double-parent re-sequencing data of the Youshon 65 variety, SNP loci with stable genetic difference between parents are obtained through screening, and two pairs of competitive allele specific PCR primers based on the KASP technology are developed respectively according to the SNP loci. By utilizing the two SNP markers and combining a fluorescence detection technology, the male parent, the female parent and the hybrid variety of the variety can be quickly and accurately distinguished in a single reaction. The method provided by the invention can be directly applied to purity identification and authenticity identification of the Youpon 65 commodity species, and provides a reliable technical basis for variety right protection and market supervision. Through early rapid identification of seed purity, production loss and market disputes caused by false hybrids can be effectively reduced, and identification efficiency and accuracy are significantly improved.

Description

Technical Field

[0001] This invention belongs to the interdisciplinary field of molecular breeding and seed quality testing, specifically involving specific SNP molecular markers for identifying the authenticity and purity of the loose-type cauliflower F1 hybrid “Yousong 65”. It also covers the application of such SNP primers in rapid purity detection, molecular-assisted breeding, and seed quality supervision of “Yousong 65” hybrid. Background Technology

[0002] Seed industry is the core support of modern agriculture. Seed purity, as a core indicator of seed quality, directly affects crop yield, commercial value, and grower income. It is also crucial for ensuring the standardization of the seed market and mitigating production and operational risks. The cauliflower variety "YouSong 65," with its suitable loose head structure, crisp and tender texture, strong resistance to adverse conditions, and adaptability to cultivation in multiple regions, is widely used in large-scale planting. Its hybrid purity directly determines the effectiveness of variety promotion and market competitiveness.

[0003] In the process of hybrid seed production of "Yousong 65", the purity of the hybrid is prone to decline due to problems such as insufficient purity of parental lines, inadequate seed production isolation measures, and pollen contamination. Moreover, the phenotypic differences between the hybrid and other varieties in the same series and among the parents are subtle, and existing purity identification technologies all have obvious adaptability defects: morphological identification methods rely on phenotypic traits, are easily affected by the environment and developmental stage, have low accuracy and strong subjectivity, and are difficult to distinguish between "Yousong 65" hybrids and similar hybrids; biochemical marker identification methods are cumbersome to operate, have low throughput, and limited detection repeatability and sensitivity, which cannot meet the needs of accurate identification; traditional DNA molecular marker identification methods such as SSR and AFLP rely on gel electrophoresis platforms, are complex to operate, have low automation, and their throughput is difficult to adapt to the large-scale seed testing scenario of "Yousong 65"; although the field plot planting identification method has legal effect, the cycle is as long as 3-4 months, which is labor-intensive and time-consuming, and cannot achieve real-time quality control in the seed circulation process.

[0004] Due to their wide distribution, genetic stability, and ease of high-throughput detection, SNP molecular markers have become an internationally recognized and highly efficient variety identification technology. Addressing the technological gap in the purity identification of the "Yousong 65" hybrid, there is an urgent need to develop highly specific and adaptable identification primers and methods to overcome the shortcomings in accuracy, efficiency, and throughput of existing technologies. Based on this, this invention utilizes resequencing of the "Yousong 65" parent genomes to screen for SNP sites with stable polymorphism between the parents, designs and develops specific KASP primers, and combines rapid germination, efficient DNA extraction, and quantitative fluorescence detection technologies to construct a high-throughput, low-cost, and precise purity identification system suitable for the "Yousong 65" hybrid. This provides core technical support for seed quality control, variety rights protection, and industrial promotion of this variety. Summary of the Invention

[0005] One of the objectives of this invention is to provide a molecular marker and primer for identifying the purity of the cauliflower hybrid "Yousong 65".

[0006] The second objective of this invention is to provide a method for identifying the purity of the cauliflower hybrid "Yousong 65".

[0007] The third objective of this invention is to provide the application of the above-mentioned molecular markers and primers in identifying the purity or variety of the cauliflower hybrid "Yousong 65".

[0008] To achieve the above objectives, the technical solution of the present invention is as follows: A molecular marker for identifying the purity of the cauliflower hybrid “Yousong 65”, comprising molecular marker 1 and molecular marker 2. Molecular marker 1 is an A-to-C mutation occurring at position 66,636,438 bp on chromosome 2 of the cauliflower genome; molecular marker 2 is a G-to-A mutation occurring at position 65,853,152 bp on chromosome 9 of the cauliflower genome.

[0009] The primers corresponding to the molecular markers are shown in Table 1.

[0010] Table 1 Molecular marker primers and sequences

[0011] Preferably, the 5' ends of primers Chr2_66636438-F and Chr9_65853152-F are connected to FAM fluorescent adapters, and the 5' ends of primers Chr2_66636438-R and Chr9_65853152-R are connected to HEX fluorescent adapters. The FAM and HEX fluorescent adapter sequences are as follows: FAM: GAAGGTGACCAAGTTCATGCT; HEX: GAAGGTCGGAGTCAACGGATT.

[0012] This invention also protects the application of the above-mentioned molecular markers in identifying true and false hybrids of cauliflower “Yousong 65”.

[0013] Specifically, the method for identifying true and false hybrids of cauliflower 'Yousong 65' is as follows: (1) Using the genomic DNA of the sample to be tested as a template, amplification is performed using the two sets of primers corresponding to the molecular marker to obtain the amplification product; (2) Fluorescence detection of the amplification products. If the sample PCR product detects the FAM fluorescence signal corresponding to the primers Chr2_66636438 and Chr9_65853152, the corresponding detection site is A:A, G:G genotype, and it is determined to be a paternal type pseudo-hybrid of "Yousong 65". If the sample PCR product detects the HEX fluorescence signal corresponding to the primers Chr2_66636438 and Chr9_65853152, the corresponding detection site is C:C, A:A genotype, and it is determined to be a maternal type pseudo-hybrid of "Yousong 65". If both FAM and HEX fluorescence signals are detected at the same time, the detection site is A:C, G:A genotype, and it is determined to be a true hybrid of "Yousong 65".

[0014] In addition, this invention also protects a method for identifying the purity of the cauliflower hybrid "Yousong 65", the method comprising the following steps: (1) Using the genomic DNA of the sample to be tested as a template, PCR amplification was performed using the primers corresponding to the molecular marker to obtain the amplification product; (2) Fluorescence detection was performed on the amplification products. If the sample PCR product detected FAM fluorescence signal corresponding to primers Chr2_66636438 and Chr9_65853152, the corresponding detection site was A:A, G:G genotype, and it was determined to be a paternal type pseudo-hybrid of "Yousong 65". If the sample PCR product detected HEX fluorescence signal corresponding to primers Chr2_66636438 and Chr9_65853152, the corresponding detection site was C:C, A:A genotype, and it was determined to be a maternal type pseudo-hybrid of "Yousong 65". If both FAM and HEX fluorescence signals were detected, the detection site was A:C, G:A genotype, and it was determined to be a true hybrid of "Yousong 65". If no fluorescence signal was detected, it was another genotype combination, and it was determined to be another type hybrid. (3) The purity of cauliflower hybrid seeds can be calculated by statistically analyzing the proportion of true hybrids in the total tested samples.

[0015] Preferably, Touchdown PCR is used for PCR amplification. The Touchdown PCR amplification program is as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles. The components and amounts used for PCR amplification are shown in Table 2.

[0016] Table 2 Components and dosages used in PCR amplification

[0017] Advantages of this invention: This invention utilizes whole-genome resequencing variation detection to screen for two SNP sites that differentiate between the two parents of 'Yousong 65' cauliflower, and successfully developed SNP markers and two pairs of KASP primers. Using fluorescence detection technology, it rapidly distinguishes between the paternal, maternal, and hybrid parents, and can be directly used for the identification of the 'Yousong 65' variety. Furthermore, this molecular marker can be used to assess the authenticity of hybrids in commercial varieties, effectively protecting the rights and interests of this variety. Early use of this molecular marker allows for rapid identification of the variety's purity, effectively reducing losses caused by false hybrids, minimizing potential disputes, improving identification efficiency and accuracy, and providing evidence for variety protection. Therefore, this invention has significant application value in the identification and variety protection of the 'Yousong 65' cauliflower hybrid. Attached Figure Description

[0018] Figure 1 Phenotypic diagrams of the maternal, paternal, and F1 parent plants of Yousong 65; Figure 2 The image shows the genotyping diagrams of the molecular markers Chr2_66636438 (left) and Chr9_65853152 (right) used in the identification of true and false hybrids of "Yousong 65". In the image, the fluorescent signal at point A corresponds to the maternal parent and maternal type false hybrid; the fluorescent signal at point B corresponds to the paternal parent and paternal type false hybrid; and the fluorescent signal at point C corresponds to the hybrid F1. Detailed Implementation

[0019] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0020] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0022] Example: Acquisition and application of molecular markers for purity identification of cauliflower variety "Yousong 65" I. Whole-genome resequencing variant detection Variation detection refers to the use of high-throughput sequencing technology to sequence and analyze the genomes of individuals or populations, thereby systematically identifying various types of genomic variations, such as single nucleotide polymorphisms (SNPs), insertions / deletions (InDels), structural variations (SVs), and copy number variations (CNVs). With the significant decrease in sequencing costs and the substantial increase in throughput, whole-genome resequencing combined with variation detection has become one of the key technical means supporting plant molecular breeding research. After sequencing data is generated, the following bioinformatics analysis workflow is generally followed: (1) Raw data quality control and filtering: Strict quality control is performed on the raw sequences (RAW data) to obtain high-quality clean data. The filtering steps mainly include: removing reads containing adapter sequences; removing reads with more than 3 N bases; and filtering low-quality reads (i.e., sequences with a quality value Q < 5 accounting for more than 20% of the total length of the read).

[0023] (2) Data alignment and preprocessing: Clean data was aligned to the reference genome using BWA software to initially generate alignment results in SAM format. Subsequently, SAMtools was used to convert the SAM data to BAM format and sort them. If the sample contained multiple sequencing libraries, the BAM files of each library were further integrated, and repetitive sequences were marked using Picard. At the same time, the relevant statistical information of the alignment was summarized.

[0024] (3) SNP detection: Single nucleotide polymorphism detection was performed based on the standard GATK (Genome Analysis Toolkit, v3.8) procedure. This software is widely used for variant identification in second-generation resequencing data.

[0025] (4) SNP screening and candidate site extraction: The SNPs initially detected were quality filtered to remove sites with QUAL value <30, MQ value <30 or DP value <2. SNPs in which both parents are homozygous and have different genotypes were further screened as key candidate variants for subsequent analysis.

[0026] II. Molecular Marker Development Based on the differences in sequencing sequences between the parents, candidate SNP sites were selected. KASP primers (as shown in Table 1) were designed using the online primer design software SNP Primer (www.snpway.com). These primers consisted of a pair of specific primers (Primer F and Primer R) containing different fluorescent adapters for the SNP alleles, and a reverse common primer (Primer C). Primer F used a FAM fluorescent adapter (GAAGGTGACCAAGTTCATGCT), and Primer R used a HEX fluorescent adapter (GAAGGTCGGAGTCAACGGATT). Primer pairs with suitable specificity and annealing temperatures were selected. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0027] The application of molecular markers specifically includes the following steps: (1) Using the genomic DNA of the sample to be tested as a template, Touchdown PCR was performed using molecular marker amplification primers to obtain the amplification product. The Touchdown PCR program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles. (2) Detection and analysis of amplification products If the PCR product of the sample detects FAM fluorescence signal corresponding to primers Chr2_66636438 and Chr9_65853152, the corresponding detection site is A:A, G:G genotype, and it is identified as a paternal type pseudohybrid of "Yousong 65". If the PCR product of the sample detects HEX fluorescence signal corresponding to primers Chr2_66636438 and Chr9_65853152, the corresponding detection site is C:C, A:A genotype, and it is identified as a maternal type pseudohybrid of "Yousong 65". If both FAM and HEX fluorescence signals are detected simultaneously, the detection site is A:C, G:A genotype, and it is identified as a true hybrid of "Yousong 65". If no fluorescence signal is detected, it is another genotype combination, and it is identified as another type of hybrid. (3) The purity of cauliflower hybrid seeds can be calculated by statistically analyzing the proportion of true hybrids in the total tested samples.

[0028] 3. Specific Application Examples Two SNP markers were used to test 187 samples. The percentage of true hybrids in the samples was calculated based on the SNP marker results. Primers were cross-corrected, and a true hybrid was defined as one where both primer pairs showed heterozygote behavior during F1 testing. The number of hybrid plants was determined by the number of individual plants with identical genotypes at both marker loci, indicating they were the male or female parent. Seed purity was calculated (Tables 3 and 4). Field validation showed that the primers exhibited good stability and consistent with field test results, enabling purity identification of cauliflower hybrid varieties. This invention's detection method can complete seed purity identification within 2 hours, offering advantages such as speed, low cost, and ease of operation.

[0029] Table 3. Genotypes detected by Chr2_66636438 and Chr9_65853152 markers and determination of true and false hybrids of "Yousong 65".

[0030]

[0031]

[0032]

[0033]

[0034] Table 4 Purity Identification Results

[0035] In summary, molecular marker identification and screening in breeding, using the primers of this invention, if two fluorescent signals are detected simultaneously, it is determined to be a true hybrid; if FAM or HEX fluorescent signals are detected, it is a false hybrid. If no fluorescent signal is detected, it is another type of seed. Early molecular marker screening can identify the purity of commercial varieties. This method is simple and easy to operate, greatly improving efficiency for breeders.

[0036] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A molecular marker for identifying the purity of the cauliflower hybrid "Yousong 65", characterized in that, The molecular markers consist of molecular marker 1 and molecular marker 2. Molecular marker 1 is an A-to-C mutation occurring at position 66,636,438 bp on chromosome 2 of the cauliflower genome; molecular marker 2 is a G-to-A mutation occurring at position 65,853,152 bp on chromosome 9 of the cauliflower genome. The primers corresponding to the molecular markers are as follows:

2. The molecular marker according to claim 1, characterized in that, The 5' ends of primers Chr2_66636438-F and Chr9_65853152-F are connected to FAM fluorescent adapters, respectively, and the 5' ends of primers Chr2_66636438-R and Chr9_65853152-R are connected to HEX fluorescent adapters, respectively. The FAM and HEX fluorescent adapter sequences are as follows: FAM: GAAGGTGACCAAGTTCATGCT; HEX: GAAGGTCGGAGTCAACGGATT.

3. The application of the molecular marker described in claim 1 or 2 in identifying true and false hybrids of cauliflower "Yousong 65".

4. The application according to claim 3, characterized in that, The method for identifying true and false hybrids of cauliflower "Yousong 65" is as follows: (1) Using the genomic DNA of the sample to be tested as a template, amplification is performed using the two sets of primers corresponding to the molecular markers described in claim 2 to obtain the amplification product; (2) Fluorescence detection of the amplification products. If the sample PCR product detects the FAM fluorescence signal corresponding to the primers Chr2_66636438 and Chr9_65853152, the corresponding detection site is A:A, G:G genotype, and it is determined to be a paternal type pseudo-hybrid of "Yousong 65". If the sample PCR product detects the HEX fluorescence signal corresponding to the primers Chr2_66636438 and Chr9_65853152, the corresponding detection site is C:C, A:A genotype, and it is determined to be a maternal type pseudo-hybrid of "Yousong 65". If both FAM and HEX fluorescence signals are detected at the same time, the detection site is A:C, G:A genotype, and it is determined to be a true hybrid of "Yousong 65".

5. A method for identifying the purity of the hybrid cauliflower variety "Yousong 65", characterized in that, The method includes the following steps: (1) Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using the primers corresponding to the molecular markers described in claim 2 to obtain the amplification products; (2) Fluorescence detection was performed on the amplification products. If the sample PCR product detected the FAM fluorescence signal corresponding to the primers Chr2_66636438 and Chr9_65853152, the corresponding detection site was A:A, G:G genotype, and it was determined to be a paternal type pseudo-hybrid of "Yousong 65". If the sample PCR product detected the HEX fluorescence signal corresponding to the primers Chr2_66636438 and Chr9_65853152, the corresponding detection site was C:C, A:A genotype, and it was determined to be a maternal type pseudo-hybrid of "Yousong 65". If both FAM and HEX fluorescence signals were detected, the detection site was A:C, G:A genotype, and it was determined to be a true hybrid of "Yousong 65". If no fluorescence signal was detected, it was another genotype combination, and it was determined to be another type hybrid. (3) The purity of cauliflower hybrid seeds can be calculated by statistically analyzing the proportion of true hybrids in the total tested samples.

6. The method for identifying the purity of hybrid cauliflower seed "Yousong 65" according to claim 5, characterized in that, PCR amplification was performed using Touchdown PCR. The Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles.

Images