Freeze-dried PCR (polymerase chain reaction) kit for nucleic acid detection of dengue fever virus and chikungunya fever virus and preparation method of freeze-dried PCR kit

The development of the lyophilized PCR kit has solved the problems of temperature sensitivity and cumbersome operation in the detection of dengue virus and chikungunya virus by liquid PCR reagents, achieving high sensitivity, specificity and simplified operation, and is suitable for room temperature storage and transportation.

CN121718655APending Publication Date: 2026-03-24SHENZHEN RONGJIN TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-09
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Existing liquid PCR reagents are temperature-sensitive, cumbersome to operate, prone to cross-contamination, and unsuitable for freeze-drying, which affects the repeatability and accuracy of test results.

Method used

Develop a lyophilized PCR kit containing lyophilized RT-PCR Mix powder, lyophilized positive control powder, and negative control. By optimizing the lyophilization agent formulation and process, and combining multiplex RT-PCR core reagents with controls, the kit is prepared into lyophilized powder, achieving room temperature stability and simplified operation.

Benefits of technology

It achieves high sensitivity and specificity detection of dengue virus and chikungunya virus, simplifies the operation process, reduces costs, is suitable for room temperature storage and transportation, reduces human error and contamination risk, and is suitable for high-throughput rapid detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121718655A_ABST
    Figure CN121718655A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of virus nucleic acid detection, in particular to a freeze-drying PCR (Polymerase Chain Reaction) kit for nucleic acid detection of dengue fever virus and chikungunya fever virus and a preparation method of the freeze-drying PCR kit. The invention provides a freeze-dried PCR (Polymerase Chain Reaction) kit for nucleic acid detection of dengue fever virus and chikungunya fever virus. The freeze-dried PCR kit comprises the following reagents: RT-PCR Mix freeze-dried powder, positive control freeze-dried powder and negative control, the RT-PCR Mix freeze-dried powder comprises a PCR Buffer buffer solution, an enzyme mixture, a nucleotide mixture, a primer probe mixed solution and a freeze-drying protective agent, the positive control freeze-dried powder is obtained by freeze-drying an RNA solution obtained by in-vitro reverse transcription of a sequence SEQ ID NO: 10. The freeze-dried PCR kit prepared by a freeze-drying technology has the technical effects of strong specificity, high sensitivity and excellent stability, and has the characteristics of being capable of being stored and transported at normal temperature, simplifying the operation process and reducing the use cost.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of viral nucleic acid detection technology, and in particular to a freeze-dried PCR kit for the detection of dengue virus and chikungunya virus nucleic acid and its preparation method. Background Technology

[0002] Dengue virus (DENV) belongs to the genus Flaviviridae in the family Flaviviridae. It is a single-stranded positive-sense RNA virus with a genome length of approximately 11 kb and includes four serotypes: DENV-1, DENV-2, DENV-3, and DENV-4. It is primarily transmitted by Aedes aegypti and Aedes albopictus mosquitoes. Infection can cause dengue fever, dengue hemorrhagic fever, and dengue shock syndrome. Clinical manifestations include fever, headache, muscle and joint pain, and rash. In severe cases, it can be life-threatening, posing a significant threat to public health.

[0003] Chikungunya virus (CHIKV) also belongs to the genus *A. alphavirus* of the family Flaviviridae. It is a single-stranded positive-sense RNA virus with a genome length of approximately 12 kb. Its main vectors are the Aedes aegypti and Aedes albopictus mosquitoes. After infection with chikungunya virus, patients mainly experience high fever, severe joint pain (often lasting for weeks or even months), rash, and muscle pain. Although the mortality rate is low, it causes severe physical discomfort and financial burden on patients, and outbreaks have occurred in many parts of the world in recent years.

[0004] Because dengue virus and chikungunya virus share the same transmission vector, overlap in their epidemic areas, and exhibit similar clinical symptoms after infection, accurate differentiation based solely on clinical manifestations is difficult, easily leading to misdiagnosis and missed diagnosis, thus affecting timely prevention, control, and treatment of the diseases. Therefore, establishing a method capable of simultaneously, rapidly, and accurately detecting both viruses is of significant practical importance.

[0005] Currently, laboratory diagnostic methods for dengue virus and chikungunya virus mainly include serological testing, virus isolation and culture, and nucleic acid detection. PCR-based detection of viral nucleic acid has advantages such as high specificity, high sensitivity, and fast detection speed, making it the preferred method for early viral diagnosis. However, conventional liquid reagents are temperature-sensitive, requiring multiple aliquots and dilutions, which is cumbersome, increases the risk of errors, and may cause cross-contamination, affecting the repeatability and accuracy of test results. Currently, PCR reagent lyophilization technology removes water through freeze-drying, stabilizing the active ingredients, allowing for room temperature storage and transportation, simplifying operation and reducing contamination. However, not all PCR reagent formulations are suitable for lyophilization; the lyophilization process may affect primer and probe specificity and Taq DNA polymerase activity, leading to a decline in reagent performance.

[0006] To address the relevant technical issues, there is an urgent need in this field to develop a freeze-dried PCR kit and its preparation method for the nucleic acid detection of dengue virus and chikungunya virus; by screening specific primer and probe combinations, optimizing the freeze-drying agent formulation and freeze-drying process, the simultaneous and rapid detection of the two arboviruses can be achieved, solving the problems of high storage and transportation costs and cumbersome operation of traditional liquid reagents. Summary of the Invention

[0007] To screen suitable primer-probe combinations with high sensitivity and specificity for lyophilization, optimize the formulation and process of lyophilization agents, and prepare high-quality lyophilized PCR kits for dengue and chikungunya viruses, this application provides a lyophilized PCR kit for the detection of dengue and chikungunya virus nucleic acids and its preparation method. This kit features high specificity, high sensitivity, and excellent stability, and can be stored and transported at room temperature, simplifying the operation process and reducing usage costs.

[0008] In one aspect, this application provides a lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acid, comprising the following reagents: RT-PCR Mix lyophilized powder, positive control lyophilized powder and negative control; The RT-PCR Mix lyophilized powder includes PCR Buffer, enzyme mixture, nucleotide mixture, primer-probe mixture and lyophilization protectant; The positive control lyophilized powder was obtained by freeze-drying an RNA solution obtained by in vitro reverse transcription using the sequence SEQ ID NO:10. The negative control was DEPC-treated water without nuclease.

[0009] By adopting the above-described scheme and preparing all core reagents and controls for multiplex RT-PCR into lyophilized powders, a revolutionary technological effect has been achieved. This completely overcomes the stringent dependence of traditional liquid reagents on cold chain transportation and storage, endowing the kit with excellent room-temperature stability and significantly reducing costs and the barriers to use. Simultaneously, this design simplifies the cumbersome multi-step preparation process into a minimally invasive "one-step sample addition" operation, greatly reducing human error and contamination risks, making high-throughput, on-site rapid detection possible. Furthermore, the kit integrates a triple detection system for dengue virus, chikungunya virus, and internal control genes within a single reaction tube, enabling not only efficient and accurate differential diagnosis but also effective avoidance of false negatives through continuous monitoring of the experimental process by the internal control. Combined with precisely designed positive and negative control samples and the UDG enzyme anti-contamination system, this forms a complete and reliable quality control closed loop, ultimately ensuring high accuracy, specificity, and reliability of the test results.

[0010] Preferably, the PCR buffer contains: MgCl2, KCl, (NH4)2SO4, Triton X-100, and Brij35, wherein: The concentration of MgCl2 is 50-65 mmol / L; The concentration of KCl is 500-600 mmol / L; The concentration of (NH4)2SO4 is 150-200 mmol / L; The concentration of Triton X-100 is 0.05-0.15% (w / v); The concentration of Brij35 is 0.05%-0.15% (w / v); the pH value is 8.0-8.3.

[0011] Preferably, the enzyme mixture includes Taq polymerase, UDG enzyme, reverse transcriptase, and RNase inhibitor; the nucleotide mixture includes five deoxynucleotides, including dATP, dTTP, dGTP, dCTP, and dUTP.

[0012] Preferably, the primer-probe mixture comprises: a first primer set for detecting dengue virus, comprising a DENV-F primer with the sequence shown in SEQ ID NO:1, a DENV-R primer with the sequence shown in SEQ ID NO:2, and a DENV-P probe with the sequence shown in SEQ ID NO:3; The second primer set, used for detecting chikungunya virus, includes the CHIKV-F primer with the sequence shown in SEQ ID NO:4, the CHIKV-R primer with the sequence shown in SEQ ID NO:5, and the CHIKV-P probe with the sequence shown in SEQ ID NO:6; The third primer set, used to detect the internal standard gene GAPDH, includes the GAPDH-F primer with the sequence shown in SEQ ID NO:7, the GAPDH-R primer with the sequence shown in SEQ ID NO:8, and the GAPDH-P probe with the sequence shown in SEQ ID NO:9.

[0013] Preferably, the specific primer and probe sequences in the primer-probe mixture are as follows:

[0014] Preferably, the freeze-drying protectant comprises trehalose, sucrose 70, dextran, and histidine, wherein: The concentration of trehalose is 3-6% (w / v); The concentration of sucrose 70 is 2-3% (w / v); The concentration of dextran is 0.1-0.5% (w / v); The concentration of histidine is 5-10 mmol / L.

[0015] By adopting the above scheme, the freeze-drying protectant is used to support the particle structure formed after freeze-drying, forming a loose structure that facilitates rapid dissolution. It plays a role in protecting the reagent components from ice crystal damage during the freeze-drying process.

[0016] Preferably, the proportions of each component in the RT-PCR Mix lyophilized powder are based on a 25 μL reaction system, including: PCR Buffer: 1× final concentration; The final concentration of each primer (DENV-F, DENV-R, CHIKV-F, CHIKV-F, GAPDH-F, GAPDH-R) is 0.2-0.4 μM. The final concentration of each probe for DENV-P, CHIKV-P, and GAPDH-P is 0.12-0.24 μM. Final concentration of UDG enzyme: 0.002-0.008 U / μL; The final activity of Taq polymerase: 0.02-0.08 U / μL; Final activity of reverse transcriptase: 0.4-1.2 U / μL; The final activity of RNase inhibitors: 0.12-0.36 U / μL; Final concentration of each deoxynucleotide: dATP, dTTP, dGTP, dCTP, dUTP: 0.1-0.3 mM; Lyophilization protectant: 1 × final concentration; DEPC water is added to make up the remaining amount.

[0017] Preferably, the positive control lyophilized powder is obtained by freeze-drying a positive control RNA solution synthesized in vitro containing a dengue virus-specific 3'-UTR sequence and a chikungunya virus E2 gene gene (SEQ ID NO:10), after in vitro reverse transcription.

[0018] Preferably, the concentration of the positive control RNA solution is 0.185-0.278 ng / μL.

[0019] Preferably, the gene sequence is SEQ ID NO:10: CAATAAACAGCATATTGACGCTGGGAGAGACCAGAGATCCTGCTGTCTCTACAGCATCATTCCAGGCACAGAACGCCACCGTAATGAGCGTCGGTGCCCACACTGTGAGCGCGTACGAACACGTATCCCGAACACGGTGGGAGTACCGTATAAGACTCTAGCCGTGTCCCCACTGCCAACGTGTCAGTGGTGGACCTGACCTCCCGTCTAGAAAAACCTGCCAAATATGATGACATCAAGAA Secondly, this application provides a method for preparing a lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acids, using the following technical solution: S1 Preparation of liquid PCR reagents: Mix PCR Buffer, enzyme mixture, nucleotide mixture, primer and probe mixture, lyophilization protectant and DEPC water according to the specified ratio to form a homogeneous liquid; S2 Dispensing: Dispense the liquid PCR reagent into PCR tubes; S3 freeze-drying: The aliquoted PCR tubes are freeze-dried without capping. S4 Packaging: After lyophilization, the PCR tube is sealed in an inert gas environment to obtain RT-PCR Mix lyophilized powder. S5 Preparation of positive control: The RNA solution of the positive control is freeze-dried and packaged according to steps S3 and S4 to obtain the freeze-dried positive control powder; S6. The negative control is aliquoted into storage tubes; S7 Assembly: The kit is synthesized by combining RT-PCR Mix lyophilized powder, positive control lyophilized powder, and negative control group.

[0020] Preferably, the freeze-drying in step S3 includes the following conditions: S31 Pre-freezing stage: Freeze at -50℃ to -40℃ for 1 hour; S32 main drying stage: Drying at -50℃ to -40℃ and 0.2mbar for 3-5 hours; S33 first stage of analysis and drying: dry at -50℃ to -40℃ and 0.2mbar for 10-30 minutes; S34 second-stage drying: dry at 20-30℃ and 0.2mbar for 1-2 hours; S35 third-stage drying: Dry at 20-30℃ and 0.2mbar for 1-2 hours.

[0021] By adopting the above scheme, the "mix first, then dispense" process ensures high uniformity within and between batches of the reagent kit. Furthermore, the multi-stage freeze-drying method protects enzyme activity and nucleic acid integrity while giving the lyophilized powder excellent room-temperature stability and rapid reconstitution characteristics. By freeze-drying the main reaction reagents, positive controls, and negative controls and encapsulating them under inert gas, a complete, stable, and cold-chain-independent detection system was successfully constructed, laying a solid foundation for standardized, large-scale production and field application.

[0022] In summary, this application has the following beneficial effects: 1. This application presents a freeze-dried PCR kit for the detection of dengue virus and chikungunya virus nucleic acid. It innovatively combines multiplex quantitative PCR technology with freeze-drying process. Through two pairs of specific primers and human internal reference gene, it accurately amplifies the specific sequences of the two pathogens in vitro and achieves real-time detection with fluorescent probes.

[0023] 2. The freeze-dried PCR kit for the detection of dengue virus and chikungunya virus nucleic acid proposed in this application has the advantages of being convenient, fast, highly sensitive, highly specific, and inexpensive, making it suitable for widespread application. It can be used as a clinical auxiliary diagnostic tool for dengue virus and chikungunya virus. At the same time, it has low requirements for the operator's skill level and can complete the simultaneous detection of two common vector-borne pathogens in one go, greatly saving detection time and cost, and efficiently supporting the rapid screening of large batches of samples. The entire detection process takes only 35-75 minutes, and the detection results are accurate and reliable.

[0024] 3. This application provides a lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acid. By combining real-time quantitative PCR reagents with lyophilization technology, and by adding a composite lyophilization protectant and optimizing the lyophilization process, the stability of the reagents is greatly increased, and they are easy to transport at room temperature, saving transportation costs. The RT-PCR Mix lyophilized powder optimizes and matches specific primers and probes for dengue virus and chikungunya virus, ensuring the detection efficiency and specificity of both pathogens. Simultaneously, human internal reference gene detection and target detection are carried out concurrently, allowing real-time monitoring of the quality of clinical samples, thereby improving the reliability of the detection results.

[0025] 4. The RT-PCR Mix lyophilized powder in the lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acid of this application is made by mixing primers, probes, reverse transcriptase, PCR reaction enzymes and components of the PCR buffer system in proportion, and then aliquoting them into PCR tubes. It is ready to use immediately without the need to add enzymes separately, avoiding repeated freeze-thaw cycles and multiple aliquoting. It is simple and quick to use and more suitable for field testing at the grassroots level. Attached Figure Description

[0026] Figure 1 Image of RT-PCRMix lyophilized powder in a lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acid. Figure 2 Amplification curve of dengue virus (DENV) in a lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acid; Figure 3 Amplification curve of chikungunya virus (CHIKV) in a lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acid; Figure 4 A comparison of dengue virus (DENV) amplification curves in liquid and lyophilized kits; Figure 5 A comparison of amplification curves of chikungunya virus (CHIKV) in liquid and lyophilized kits; Figure 6 A comparison of dengue virus (DENV) amplification curves for liquid and lyophilized kits under different storage conditions; Figure 7 A comparison of amplification curves of Chikungunya virus (CHIKV) under different storage conditions for liquid and lyophilized kits. Detailed Implementation

[0027] The technical solutions of this application are further illustrated through specific embodiments. These specific embodiments do not represent a limitation on the scope of protection of this application. Any non-essential modifications and adjustments made by others based on the concept of this application still fall within the scope of protection of this application.

[0028] Unless otherwise specified, the experimental methods shown in the following examples are conventional methods.

[0029] The primers, probes, and positive plasmids used in this embodiment were all synthesized by Sangon Biotech Co., Ltd.

[0030] T7 RNA Polymerase In Vitro Reverse Transcription Kit: Nanjing Novizan Biotechnology Co., Ltd., Product Name: T7 High Yield RNA Transcription Kit-TR101.

[0031] The real-time quantitative PCR instrument used was Thermo Fisher Scientific Inc., product name: AppliedBiosystems QuantStudio 5.

[0032] The present application will be further described in detail below with reference to embodiments and comparative examples.

[0033] Preparation Example Preparation Example 1: Preparation of PCR buffer PCR buffer: MgCl2 60 mmol / L, KCl 500 mmol / L, (NH4)2SO4 180 mmol / L, Triton X-100 0.1% (w / v), Brij35 0.1% (w / v).

[0034] The specific preparation of PCR buffer: Accurately weigh 23.8g (NH4)2SO4, 37.3g KCl, 10.2g MgCl2·6H2O, 1.0g Triton X-100 and 1.0g Brij 35, add them to 800mL of DEPC water to dissolve, bring the volume to 1.0L, adjust the pH to 8.0-8.3, and store at 4℃ for later use.

[0035] Preparation Example 2: Preparation of PCR buffer PCR buffer: MgCl2 50 mmol / L, KCl 500 mmol / L, (NH4)2SO4 150 mmol / L, Triton X-100 0.05% (w / v), Brij35 0.05% (w / v).

[0036] The specific preparation of PCR buffer: Accurately weigh 19.82g (NH4)2SO4, 37.28g KCl, 10.17g MgCl2·6H2O, 0.50g Triton X-100 and 0.50g Brij 35, add them to 800mL of DEPC water to dissolve, bring the volume to 1.0L, adjust the pH to 8.0-8.3, and store at 4℃ for later use.

[0037] Preparation Example 3: Preparation of PCR buffer PCR buffer: MgCl2 65 mmol / L, KCl 600 mmol / L, (NH4)2SO4 200 mmol / L, Triton X-100 0.15% (w / v), Brij35 0.15% (w / v).

[0038] The specific preparation of PCR buffer: Accurately weigh 26.43g (NH4)2SO4, 44.73g KCl, 13.21g MgCl2·6H2O, 1.50g Triton X-100 and 1.50g Brij 35, add them to 800mL of DEPC water to dissolve, bring the volume to 1.0L, adjust the pH to 8.0-8.3, and store at 4℃ for later use.

[0039] Preparation Example 4: Formulation of Lyophilization Protectant Lyophilization protectants: trehalose 4.5% (w / v), sucrose 70.3% (w / v), dextran 0.3% (w / v), histidine 7 mmol / L.

[0040] Preparation of specific freeze-drying protectant: Accurately weigh 0.1086g L-histidine, 4.5g trehalose, 0.3g dextran, and 7.5mL of 40% sucrose 70 solution, add them sequentially to 60mL of DEPC water to dissolve, and make up to 100mL. Store at 4℃ for later use.

[0041] Preparation Example 5: Formulation of Lyophilization Protectant Lyophilization protectants: trehalose 3% (w / v), sucrose 70 2% (w / v), dextran 0.1% (w / v), histidine 5 mmol / L.

[0042] Preparation of specific freeze-drying protectant: Accurately weigh 0.0776 g L-histidine, 3.0 g trehalose, 0.1 g dextran, and 5.0 mL of 40% sucrose 70 solution, add them sequentially to 60 mL of DEPC water to dissolve, and make up to 100 mL. Store at 4℃ for later use.

[0043] Preparation Example 6: Formulation of Lyophilization Protectant Lyophilization protectants: trehalose 6% (w / v), sucrose 70 3% (w / v), dextran 0.5% (w / v), histidine 10 mmol / L.

[0044] Preparation of specific freeze-drying protectant: Accurately weigh 0.1552g L-histidine, 6.0g trehalose, 0.5g dextran, and 7.5mL of 40% sucrose 70 solution, add them sequentially to 60mL of DEPC water to dissolve, and make up to 100mL. Store at 4℃ for later use.

[0045] Preparation Example 7: Preparation of Primer and Probe Solutions The primer-probe mixture includes the following primer-probe sequences:

[0046] The first primer set, used for detecting dengue virus, includes the DENV-F primer with the sequence shown in SEQ ID NO:1, the DENV-R primer with the sequence shown in SEQ ID NO:2, and the DENV-P probe with the sequence shown in SEQ ID NO:3; The second primer set, used for detecting chikungunya virus, includes the CHIKV-F primer with the sequence shown in SEQ ID NO:4, the CHIKV-R primer with the sequence shown in SEQ ID NO:5, and the CHIKV-P probe with the sequence shown in SEQ ID NO:6; The third primer set, used to detect the internal standard gene GAPDH, includes the GAPDH-F primer with the sequence shown in SEQ ID NO:7, the GAPDH-R primer with the sequence shown in SEQ ID NO:8, and the GAPDH-P probe with the sequence shown in SEQ ID NO:9.

[0047] Primer and probe solution preparation: DEPC was dissolved in water to prepare a 100 μM stock solution for each primer and probe dry powder tube, and then aliquoted and stored at -20℃.

[0048] Preparation Example 8: Preparation of RNA solution for positive control The RNA solution for the positive control was prepared by the following method: A gene sequence SEQ ID NO:10 containing a dengue virus-specific 3'-UTR sequence and a chikungunya virus E2 sequence was synthesized in vitro by Sangon Biotech Co., Ltd., and then subjected to a 1:10 reaction with DEPC water. 2 Diluted multiple times; b. Using the diluted gene sequence from step a as a DNA template, perform in vitro transcription using a T7 RNA polymerase in vitro reverse transcription kit to obtain crude transcribed RNA products; c. Digest the crude transcribed RNA product from step b with DNase to remove excess DNA; d. Purify the reverse transcription product using a column-based nucleic acid extraction kit to obtain purified positive control RNA stock solution, and determine the concentration of the positive control RNA stock solution to be 20-30 ng / μL; e. Dilute the positive control RNA stock solution with DEPC water at a ratio of 1:10. 8 The RNA solution was diluted 1-2 times, with a CT value ranging from 22 to 30, to obtain a positive control RNA solution with a concentration of 0.185-0.278 ng / μL.

[0049] The gene sequence SEQ ID NO:10:CAATAAACAGCATATTGACGCTGGGAGAGACCAGAGATCCTGCTGTCTCTACAGCATCATTCCAGGCACAGAACGCCACCGTAATGAGCGTCGGTGCCCACACTGTGAGCGCGTACGAACA CGTAACAGTGATCCCGAACACGGTGGGAGTACCGTATAAGACTCTAGCCGTGTCCCCACTGCCAACGTGTCAGTGGTGGACCTGACCTGCCGTCTAGAAAAACCTGCCAAATATGATGACATCAAGAA Example

[0050] Example 1 A lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acids, employing the following technical solution: S1 Preparation of liquid PCR reagents: Mix PCR Buffer, enzyme mixture, nucleotide mixture, primer and probe mixture, lyophilization protectant and DEPC water according to the specified ratio to form a homogeneous liquid; S2 Dispensing: Dispense the liquid PCR reagent into PCR tubes; S3 freeze-drying: The aliquoted PCR tubes are freeze-dried without capping. S31 Pre-freezing stage: Freeze at -50℃ for 1 hour; S32 main drying stage: drying at -50℃ and 0.2 mbar for 3.5 hours; S33 first stage of analysis and drying: drying at -40℃ and 0.2 mbar for 20 minutes; S34 second-stage drying: drying at 25℃ and 0.2 mbar for 2 hours; S35 third-stage drying: drying at 25℃ and 0.2 mbar for 1 hour; S4 Packaging: After lyophilization, the PCR tube is sealed in an inert gas environment to obtain RT-PCR Mix lyophilized powder. S5 Preparation of positive control: The RNA solution of the positive control is freeze-dried and packaged according to steps S3 and S4 to obtain the freeze-dried positive control powder; S6 negative control preparation: Dispense 0.5 ml / tube into 1.5 ml storage tubes; S6 Assembly: The kit is synthesized by combining RT-PCR Mix lyophilized powder, positive control lyophilized powder, and negative control group.

[0051] Preparation of the liquid PCR reagent: Prepare according to a reaction system of 25 μL / tube. The amount of each component and the final concentration are shown in Table 1.

[0052] Mix all components according to the above formula, stir well, and after a total volume of 1250 μL (25 μL × 50 tubes), dispense into 8-tube PCR aliquots, place uncapped tubes in a lyophilizer tray, and perform lyophilization. After lyophilization, encapsulate the lyophilized PCR reagents under nitrogen atmosphere to obtain RT-PCR Mix lyophilized powder. Figure 1 As shown.

[0053] The positive control RNA solution was prepared by Example 8, with a concentration of 27 ng / μL. The positive control RNA solution was then diluted 1:10 with DEPC water. 8 The RNA solution was diluted 1-2 times to obtain a concentration of 0.25 ng / μL for the positive control.

[0054] The negative control was DEPC-treated water without nuclease.

[0055] Example 2 A lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acid differs from Example 1 in that: The freeze-drying conditions in step S3 are as follows: S31 Pre-freezing stage: Freeze at -40℃ for 1 hour; S32 main drying stage: drying at -40℃ and 0.2 mbar for 3 hours; S33 first stage of analysis and drying: drying at -40℃ and 0.2 mbar for 10 minutes; S34 second-stage drying: drying at 20℃ and 0.2 mbar for 1 hour; S35 third-stage drying: drying at 30℃ and 0.2 mbar for 2 hours; S4 Packaging: After lyophilization, the PCR tube is sealed in an inert gas environment to obtain RT-PCR Mix lyophilized powder.

[0056] Preparation of the liquid PCR reagent: Prepare according to a reaction system of 25 μL / tube. The amount of each component and the final concentration are shown in Table 2.

[0057] Example 3 A lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acid differs from Example 1 in that: The freeze-drying conditions in step S3 are as follows: S31 Pre-freezing stage: Freeze at -50℃ for 1 hour; S32 main drying stage: drying at -50℃ and 0.2 mbar for 5 hours; S33 first stage of analysis and drying: drying at -50℃ and 0.2 mbar for 30 minutes; S34 second stage of analysis and drying: drying at 30℃ and 0.2 mbar for 1 hour; S35 third-stage drying: drying at 20℃ and 0.2 mbar for 2 hours; S4 Packaging: After lyophilization, the PCR tube is sealed in an inert gas environment to obtain RT-PCR Mix lyophilized powder.

[0058] Preparation of the liquid PCR reagent: Prepare according to a reaction system of 25 μL / tube. The amount of each component and the final concentration are shown in Table 3.

[0059] Example 4 Screening of specific primer-probe combinations To ensure the detection specificity and sensitivity of the lyophilized PCR reagent, this embodiment designed eight primer-probe combinations targeting the dengue virus 3'-UTR sequence (covering serotypes DENV1, DENV2, DENV3, and DENV4), the chikungunya virus E2 gene, and the internal reference gene GAPDH. The lyophilized reagent was prepared according to the method in Example 1, and the optimal combination was screened using the positive control RNA lyophilized powder as a template.

[0060] 4.1 Experimental Materials Positive control: The positive control lyophilized powder prepared in Example 1 was diluted with DEPC water to a concentration of 1×10 copies / mL. 7 Gradient concentrations of copies / mL.

[0061] Negative control: DEPC water; Cross-reaction validation template: recombinant plasmids of Zika virus (ZIKV), yellow fever virus (YFV), and Japanese encephalitis virus (JEV), at a concentration of 1×10⁻⁶. 6 Copy / mL.

[0062] 4.2 Experimental Procedure Reconstitute RT-PCR Mix lyophilized powder: Add 20 μL of DEPC water to each tube of RT-PCR Mix lyophilized powder, and gently vortex for 30 seconds to completely dissolve the lyophilized powder.

[0063] Add 5 μL of gradient concentrations of positive control, negative control, and cross-reaction template to the reconstituted reagent tube, for a total reaction volume of 25 μL.

[0064] PCR amplification: Real-time quantitative PCR was performed using a real-time fluorescence PCR instrument. Fluorescence channels selected were: DENV-P (FAM channel), CHIKV-P (ROX channel), and GAPDH (CY5 channel). Amplification curves and Ct values ​​were recorded. The reaction program is shown in Table 4.

[0065] 4.3 Test Results By comparing the amplification efficiency, specificity, and detection limit of lyophilized PCR reagents containing different primer and probe combinations, three high-performance combinations were finally selected. The detection performance of the optimal combination is shown in Table 5.

[0066] The results are attached. Figure 2 and Figure 3 As shown, Figure 2 This is a curve showing the amplification of dengue virus (DENV). Figure 3 This is an amplification curve of chikungunya virus (CHIKV); from left to right, the concentration of the positive control template is 1×10⁻⁶. 7 copies / mL, 1×10 6 copies / mL, 1×10 5 copies / mL, 1×10 4 copies / mL, 1×10 3 copies / mL, 1×10 2 The copy number / mL clearly shows that when the positive control RNA copy number is 1×10⁻⁶, the difference is significant. 2 At concentrations above 10 copies / mL, both DENV and CHIKV exhibited typical S-shaped amplification curves, indicating that the detection limits of the prepared nucleic acids for dengue virus and chikungunya virus detection can both reach 1×10⁻⁶. 2 The sample size was 100 copies / mL, and it showed no cross-reactivity with ZIKV, YFV, and JEV. It had good specificity, and the detection rate was 100% after 20 repetitions at the detection limit concentration. Therefore, it was determined to be the final primer-probe combination.

[0067] Example 5: Performance comparison with liquid PCR kit The performance of the lyophilized PCR kit for the detection of dengue virus and chikungunya virus prepared in Example 1 (hereinafter referred to as the lyophilized kit) was compared with that of the same kit without lyophilization.

[0068] 5.1 Experimental Procedure Lyophilized kit: A lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acids, prepared according to Example 1, wherein: positive control lyophilized powder was diluted with DEPC water to a concentration of 1×10⁻⁶. 31×10 6 Copy / mL concentration; RT-PCR Mix lyophilized powder, add 20 μL DEPC water to the tube, gently vortex for 30 s to completely dissolve the lyophilized powder.

[0069] Liquid reagent kit: Prepared according to the liquid formulation of Example 1 (excluding lyophilization step, store at 2-8℃); the liquid reagent can be used directly without reconstitution.

[0070] Sample loading and PCR amplification: Add 5 μL of gradient concentrations of positive control, negative control and cross-reaction template to the lyophilized reconstitution reagent and liquid reagent respectively, with a total reaction volume of 25 μL. Amplify according to the PCR procedure in step 4.2 of Example 4, and record the Ct value and amplification curve.

[0071] 5.2 Comparison Results The detection Ct values ​​of the two kits for different template concentrations were calculated by repeating each group three times and taking the average value. The results are shown in Table 6.

[0072] like Figure 4 and Figure 5 The figures show a comparison of amplification curves for chikungunya virus (CHIKV) and dengue virus (DENV) in the liquid kit and the lyophilized kit, respectively; from left to right, the positive control template concentration is 1×10⁻⁶. 6 copies / mL, 1×10 3 The results showed that the Ct values ​​of the lyophilized PCR kit and the liquid kit for the detection of dengue virus and chikungunya virus nucleic acid were ≤0.3, and the amplification curves showed the same trend, indicating that the lyophilization process did not affect the detection performance of the reagents, and the sensitivity and amplification efficiency of the two kits were basically the same.

[0073] Example 6: Stability test of lyophilized PCR reagents The lyophilized PCR kit for the detection of dengue virus and chikungunya virus prepared in Example 1 (hereinafter referred to as the lyophilized kit) was stored at room temperature (25±2℃) and 37℃ (accelerated experiment) respectively. Its sensitivity was tested periodically to verify its stability.

[0074] 6.1 Experimental Design Storage conditions: Room temperature group (25±2℃, sealed and protected from light), 37℃ group (constant temperature incubator, sealed and protected from light); Sampling time points: 0 months (freshly prepared), 1 month, 3 months, 6 months; Positive template: The positive control lyophilized powder prepared in Example 1 was diluted with DEPC water to a concentration of 1×10⁻⁶. 3 Copy / mL concentration.

[0075] 6.2 Experimental Procedure Reconstitute the lyophilized reagent, add the sample, and perform PCR amplification according to step 4.2 in Example 4. Record the detection rate and Ct value of each group, and repeat each group 10 times.

[0076] 6.3 Stability Results The detection performance of the lyophilized kit under different storage conditions is shown in Table 7:

[0077] like Figure 6 and Figure 7 As shown, Figure 6 This image shows a comparison of amplification curves for dengue virus (DENV) and chikungunya virus (CHIKV) under different storage conditions for liquid and lyophilized kits. The positive control template concentration is 1×10⁻⁶. 3 Copy / mL, blue represents liquid control, green represents storage at room temperature for 6 months, and red represents storage at 37°C for 6 months; the experimental results show that the lyophilized PCR kit for dengue virus and chikungunya virus nucleic acid detection prepared in Example 1, after being stored at room temperature and 37°C for 6 months, has a PCR effect of 1×10⁻⁶ copies / mL. 3 The detection rate of DENV and CHIKV templates at a concentration of copies / mL remained at 100%, and the Ct value change was ≤0.7, indicating that the reagent has excellent stability and can be stored and transported at room temperature without the need for a cold chain.

[0078] Example 7: Application of lyophilized PCR reagents in clinical samples This embodiment uses clinically collected samples suspected of being infected by arboviruses to verify the practical application effect of the freeze-dried PCR kit for the detection of dengue virus and chikungunya virus nucleic acid.

[0079] 7.1 Source of Clinical Samples Sample type: 120 serum samples from patients with fever (collected from dengue fever endemic areas in southern my country, with symptoms including high fever, rash, and joint pain); Sample processing: Total RNA was extracted from the samples using a commercial RNA extraction kit and stored at -80℃ for later use; Control methods: The commercially available dengue virus nucleic acid detection kit (liquid type, RT-PCR method) and chikungunya virus nucleic acid detection kit (liquid type, RT-PCR method) were used as controls.

[0080] 7.2 Experimental Procedure Detection using the lyophilized kit: The lyophilized PCR kits for the detection of dengue virus and chikungunya virus prepared in Examples 1-3 and the control kit were reconstituted with the lyophilized powder according to step 4.2 of Example 4. 5 μL of sample RNA was added, and PCR amplification was performed. The results were interpreted (a typical "S" curve in the FAM channel indicates a positive result for DENV, and a typical "S" curve in the ROX channel indicates a positive result for CHIKV). Control reagent detection: Follow the instructions of the control kit to detect RNA from the same sample; Results Comparison: The detection concordance rate between the freeze-dried PCR kits prepared in Examples 1-3 for the detection of dengue virus and chikungunya virus nucleic acid and the control kit was statistically analyzed.

[0081] 7.3 Clinical Application Results The test results of 120 clinical samples are shown in Table 8 below:

[0082] The results showed that the lyophilized PCR kits for dengue virus and chikungunya virus nucleic acid detection prepared in Examples 1-3, with a total of 120 samples, exhibited 100% positive and 100% negative concordance rates in CHIKV detection and DENV+CHIKV mixed infection detection, indicating complete consistency with the control kit and extremely high sensitivity and specificity. In DENV detection, the positive concordance rate of all kits in the examples was 94.40%, slightly lower than 100%. Specifically, in Example 1, one DENV sample was positive with the control kit but negative with the kit of this invention. Sequencing confirmed it to be a rare DENV4 variant (with a single base mutation in the 3'-UTR target sequence). Although this variant has an extremely low clinical incidence, the negative concordance rate was 100%, indicating no false positives and excellent specificity. This demonstrates that the kit of this invention can meet the needs of clinical sample testing and is suitable for field screening of dengue and chikungunya outbreaks.

[0083] The above experimental results show that the freeze-dried PCR kit for the detection of dengue virus and chikungunya virus prepared in this invention has the characteristics of high specificity, high sensitivity and excellent stability. It can be stored and transported at room temperature, simplifying the operation process and reducing the cost of use. It can realize the simultaneous detection of the two viruses, providing a powerful tool for the early diagnosis and prevention and control of vector-borne virus infections.

[0084] This specific embodiment is merely an explanation of the present invention and is not intended to limit the invention. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but as long as they are within the scope of the present invention, they are protected by patent law.

Claims

1. A lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acids, characterized in that, Includes the following reagents: RT-PCR Mix lyophilized powder, positive control lyophilized powder, and negative control; The RT-PCR Mix lyophilized powder includes PCR Buffer, enzyme mixture, nucleotide mixture, primer-probe mixture and lyophilization protectant; The positive control lyophilized powder was obtained by freeze-drying an RNA solution obtained by in vitro reverse transcription using the sequence SEQ ID NO:

10. The negative control was DEPC-treated water without nuclease.

2. The lyophilized PCR kit for detecting dengue virus and chikungunya virus nucleic acid according to claim 1, characterized in that, The PCR Buffer contains: MgCl2, KCl, (NH4)2SO4, Triton X-100, and Brij 35, wherein: The concentration of MgCl2 is 50-65 mmol / L; The concentration of KCl is 500-600 mmol / L; The concentration of (NH4)2SO4 is 150-200 mmol / L; The concentration of Triton X-100 is 0.05-0.15% (w / v); The concentration of Brij35 is 0.05%-0.15% (w / v); The pH value is 8.0-8.

3.

3. The lyophilized PCR kit for detecting dengue virus and chikungunya virus nucleic acid according to claim 1, characterized in that, The enzyme mixture includes Taq polymerase, UDG enzyme, reverse transcriptase, and RNase inhibitor; the nucleotide mixture includes five deoxynucleotides, including dATP, dTTP, dGTP, dCTP, and dUTP.

4. The lyophilized PCR kit for detecting dengue virus and chikungunya virus nucleic acid according to claim 1, characterized in that, The primer-probe mixture includes: a first primer set for detecting dengue virus, comprising a DENV-F primer with the sequence shown in SEQ ID NO:1, a DENV-R primer with the sequence shown in SEQ ID NO:2, and a DENV-P probe with the sequence shown in SEQ ID NO:3; The second primer set, used for detecting chikungunya virus, includes the CHIKV-F primer with the sequence shown in SEQ ID NO:4, the CHIKV-R primer with the sequence shown in SEQ ID NO:5, and the CHIKV-P probe with the sequence shown in SEQ ID NO:6; The third primer set, used to detect the internal standard gene GAPDH, includes the GAPDH-F primer with the sequence shown in SEQ ID NO:7, the GAPDH-R primer with the sequence shown in SEQ ID NO:8, and the GAPDH-P probe with the sequence shown in SEQ ID NO:

9.

5. The lyophilized PCR kit for detecting dengue virus and chikungunya virus nucleic acid according to claim 1, characterized in that, The freeze-drying protectant comprises trehalose, sucrose 70, glucan, and histidine, wherein: The concentration of trehalose is 3-6% (w / v); The concentration of sucrose 70 is 2-3% (w / v); The concentration of dextran is 0.1-0.5% (w / v); The concentration of histidine is 5-10 mmol / L.

6. The lyophilized PCR kit for detecting dengue virus and chikungunya virus nucleic acid according to claim 1, characterized in that, The proportions of each component in the RT-PCR Mix lyophilized powder are based on a 25 μL reaction system, including: PCR Buffer: 1× final concentration; The final concentration of each primer (DENV-F, DENV-R, CHIKV-F, CHIKV-F, GAPDH-F, GAPDH-R) is 0.2-0.4 μM. The final concentration of each probe for DENV-P, CHIKV-P, and GAPDH-P is 0.12-0.24 μM. Final concentration of UDG enzyme: 0.002-0.008 U / μL; The final activity of Taq polymerase: 0.02-0.08 U / μL; Final activity of reverse transcriptase: 0.4-1.2 U / μL; The final activity of RNase inhibitors: 0.12-0.36 U / μL; Final concentration of each deoxynucleotide: dATP, dTTP, dGTP, dCTP, dUTP: 0.1-0.3 mM; Lyophilization protectant: 1 × final concentration; DEPC water is added to make up the remaining amount.

7. The lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acid according to claim 1, characterized in that, The positive control lyophilized powder is obtained by freeze-drying a positive control RNA solution synthesized in vitro, which contains a dengue virus-specific 3'-UTR sequence and a chikungunya virus E2 gene sequence (SEQ ID NO:10), after in vitro reverse transcription.

8. The lyophilized PCR kit for the detection of dengue virus and chikungunya virus nucleic acid according to claim 7, characterized in that, The positive control RNA solution has a concentration of 0.185-0.278 ng / μL.

9. A method for preparing a lyophilized PCR kit for detecting dengue virus and chikungunya virus nucleic acids as described in any one of claims 1-8, characterized in that, It includes the following steps: S1 Preparation of liquid PCR reagents: Mix PCR Buffer, enzyme mixture, nucleotide mixture, primer and probe mixture, lyophilization protectant and DEPC water according to the specified ratio to form a homogeneous liquid; S2 Dispensing: Dispense the liquid PCR reagent into PCR tubes; S3 freeze-drying: The aliquoted PCR tubes are freeze-dried without capping. S4 Packaging: After lyophilization, the PCR tube is sealed in an inert gas environment to obtain RT-PCR Mix lyophilized powder. S5 Preparation of positive control: The RNA solution of the positive control is freeze-dried and packaged according to steps S3 and S4 to obtain the freeze-dried positive control powder; S6. The negative control is aliquoted into storage tubes; S7 Assembly: The kit is synthesized by combining RT-PCR Mix lyophilized powder, positive control lyophilized powder, and negative control group.

10. The method for preparing the lyophilized PCR kit for detecting dengue virus and chikungunya virus nucleic acid according to claim 9, characterized in that: The freeze-drying process in step S3 includes the following stages: S31 Pre-freezing stage: Freeze at -50℃ to -40℃ for 1 hour; S32 main drying stage: Drying at -50℃ to -40℃ and 0.2mbar for 3-5 hours; S33 first stage of analysis and drying: dry at -50℃ to -40℃ and 0.2mbar for 10-30 minutes; S34 second-stage drying: dry at 20-30℃ and 0.2mbar for 1-2 hours; S35 third-stage drying: Dry at 20-30℃ and 0.2mbar for 1-2 hours.