Recombinant plasmid for preparing natural sunscreen shinorine and porphyra-334 and application thereof

By expressing the Gracilaria heteroclade Gh.mysAB and Gh.mysCD genes in Saccharomyces cerevisiae, recombinant plasmids were constructed, solving the resource constraints and high costs in the production of natural sunscreen MAAs. This enabled efficient and safe production of MAAs, meeting the needs of the cosmetics industry.

CN121737182BActive Publication Date: 2026-07-24YUNNAN AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
YUNNAN AGRICULTURAL UNIVERSITY
Filing Date
2026-03-02
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Existing technologies for extracting natural sunscreens (MAAs) suffer from limitations such as resource constraints, high production costs, environmental pollution risks, and low extraction efficiency, making it difficult to meet the cosmetics industry's demand for natural and safe sunscreens.

Method used

By employing heterologous synthesis technology, recombinant plasmids were constructed by expressing the Gracilaria heteroclade Gh.mysAB and Gh.mysCD genes in Saccharomyces cerevisiae, enabling efficient production of MAAs, avoiding dependence on marine algae, simplifying the extraction process, and reducing production costs.

Benefits of technology

This enables efficient and safe production of MAAs, reduces production costs, meets the demand for natural sunscreens in the cosmetics industry, and possesses environmental friendliness and industrial application potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121737182B_ABST
    Figure CN121737182B_ABST
Patent Text Reader

Abstract

This invention relates to a recombinant plasmid for preparing the natural sunscreen agents shinorine and porphyra-334 and its applications, belonging to the field of biotechnology. The recombinant plasmid contains *Gracilaria heteroclade*. Gh.mysAB Genes and heteroclade Gracilaria Gh.mysCD Genes; the aforementioned Gracilaria heteroclade Gh.mysAB The nucleotide sequence of the gene is shown in SEQ ID NO.1; the described *Gracilaria heteroclade* Gh.mysCD The nucleotide sequence of the gene is shown in SEQ ID NO.2. This invention utilizes a simplified two-enzyme catalytic system of Gracilaria heteroclade to replace the complex four-gene pathway of cyanobacteria, significantly improving catalytic efficiency; and overcomes the problem of seasonal shortage of natural resources, high energy consumption of pretreatment, and complex extraction process by heterologous expression in Saccharomyces cerevisiae, thereby reducing production costs and avoiding the risk of marine environmental pollution.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a recombinant plasmid for preparing natural sunscreens shinorine and porphyra-334 and its application. Background Technology

[0002] As people's understanding of the harmful effects of ultraviolet radiation deepens, the market demand for sunscreen cosmetics is constantly expanding. Currently, most commonly used sunscreens are synthetically produced, posing potential hazards to the environment and human health. Examples include oxybenzone, TiO2, ZnO, cinnamic acid (esters), and hydroxybenzone. The May 2022 issue of *Science* reported that oxybenzone can be converted into phototoxins, causing fatal damage to corals. While focusing on the effectiveness of sunscreens, people are also paying more attention to the safety and harmlessness of sunscreen products. Therefore, developing an environmentally friendly sunscreen compound to replace existing organic sunscreens is urgently needed. Researchers have discovered that mycosporine-like amino acids (MAAs) are a class of water-soluble substances formed through condensation reactions with different types of amino acids, using cyclohexenone as the basic skeleton. MAAs possess a broad ultraviolet absorption capacity (268-362 nm), exhibiting a stronger absorption peak in the 309-362 nm range. They effectively absorb UVA and UVB radiation wavelengths, making them useful for skin protection and often referred to as "natural sunscreens." They are found in many marine and freshwater organisms. They also possess antioxidant activity and inhibit the spread of tumor cells. More than 70 MAAs and their derivatives have been extracted, isolated, and identified from nature. However, natural resources are not inexhaustible, and the titers of MAAs extracted from algae and other sources are far from meeting human needs for pollution-free products.

[0003] Research indicates that the synthetic pathways of common metabolites (MAAs) in organisms are relatively well-defined, and constructing cell factories in microorganisms is a mature technology. Therefore, using synthetic biology techniques for heterologous expression to produce MAAs can overcome the aforementioned resource limitations, enabling the continuous, efficient, and safe synthesis of shinorine and porphyra-334, and holds broad application prospects. Existing research reports that MAAs synthesis mainly relies on the shikimic acid pathway and the pentose phosphate pathway, with the latter currently being studied more extensively. The intermediate metabolite sedoheptulose-7-phosphate (S7P) in the pentose phosphate pathway is catalyzed by demethyl-4-deoxycodone synthase (DDGS) to produce 2-demethyl-4-deoxycodone (DDG). This product is then catalyzed by O-methyltransferase (OMT) to produce 4-deoxycodone (4-DG). Subsequently, ATP-grasp ligase catalyzes the linkage of 4-DG and glycine to form cytosine-glycine (MG). Finally, non-ribosomal polypeptide synthase or D-alanine-D-alanine ligase (D-Ala-D-Ala-ligase) catalyzes the reaction of MG with L-serine and threonine to produce shinorine and porphyra-334, respectively. The four enzymes DDGS, O-MT, ATP-grasp ligase, and D-Ala-D-Ala-ligase are encoded by mysA, mysB, mysC, and mysD, respectively, and these four enzymes form the MAAs synthetic gene cluster.

[0004] Although MAAs were originally derived from fungi ( Pyronema omphalodes It was isolated from *Porphyra yezoensis*, but subsequent studies have mostly focused on marine macroalgae, among which red algae have the highest content of MAAs. Porphyra umbilicalis For example, its MAAs content reaches 3.27 mg / gDW. Currently, commercially available shinorine and porphyra-334 are mainly extracted from *Porphyra yezoensis*. However, traditional algal extraction processes face multiple constraints: First, the supply of raw materials is limited by the seasonal fluctuations of wild algal resources and the biomass decline caused by marine environmental pollution. In addition, most seaweed raw materials flow to traditional fields such as food processing, and a stable supply chain for high-value-added purification industries has not yet been formed. Second, algal pretreatment requires a lot of energy to remove mud, salt, and biological attachments, and the drying process further increases costs. Third, the cell walls composed of complex polysaccharides significantly reduce extraction efficiency. Conventional acid-base cell disruption methods easily cause degradation of active substances, while water extraction or organic solvent extraction processes have problems such as low yield and long processing time, ultimately leading to high production costs.

[0005] Therefore, overcoming the shortcomings of existing technologies is a problem that urgently needs to be solved in the field of biotechnology. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a recombinant plasmid for preparing natural sunscreens shinorine and porphyra-334 and its application.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of this invention provides recombinant plasmids for preparing the natural sunscreens shinorine and porphyra-334, said recombinant plasmids containing *Gracilaria heteroclade*. Gh.mysAB Genes and heteroclade Gracilaria Gh.mysCD Genes; the aforementioned Gracilaria heteroclade Gh.mysAB The nucleotide sequence of the gene is shown in SEQ ID NO.1; the described *Gracilaria heteroclade* Gh.mysCD The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0008] Furthermore, the heterophyllum of the river lily... Gh.mysAB Genes, heteroclade Gracilaria Gh.mysCD The gene was homologously recombined with the pUC19 vector to obtain the pUC19-Gh.mysAB-mysCD recombinant plasmid.

[0009] A second aspect of the present invention provides a transgenic engineered bacterium containing the aforementioned recombinant plasmid, or wherein the genome of the transgenic engineered bacterium is integrated with exogenous Gracilaria heteroclade. Gh.mysAB Genes and heteroclade Gracilaria Gh.mysCD Gene.

[0010] Furthermore, the genetically engineered bacteria is the Saccharomyces cerevisiae strain BY4742.

[0011] The third aspect of the present invention provides the above-mentioned *Gracilaria heterophylla*. Gh.mysAB Gene or heteroclade Gracilaria Gh.mysCD Gene.

[0012] The fourth aspect of the present invention provides the above-mentioned *Gracilaria heterophylla*. Gh.mysAB Gene or heteroclade Gracilaria Gh.mysCD Gene-encoded protein, Gracilaria heterophylla Gh.mysAB The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.3; Gracilaria heterophylla Gh.mysCD The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.4.

[0013] The fifth aspect of the present invention provides the above-mentioned *Gracilaria heterophylla*. Gh.mysAB Genes and heteroclade Gracilaria Gh.mysCD Application of genes in the preparation of natural sunscreens shinorine and porphyra-334.

[0014] The sixth aspect of the present invention provides a method for preparing natural sunscreens shinorine and porphyra-334, wherein the transgenic engineered bacteria described above are fermented to obtain natural sunscreens shinorine and porphyra-334 from the fermentation broth.

[0015] Furthermore, the fermentation medium used was SC-Leu liquid medium, and the fermentation temperature was 30℃.

[0016] This invention provides a gene related to MAAs synthesis in Gracilaria heterophylla. Gh.mysAB and Gh.mysCD Domain annotation of *Gracilaria heterophylla* protein sequences was performed using the PfamScan v1.6 program (based on the Pfam v36.0 database). Key genes were screened using an E-value threshold of 1e-5. Gh.mysAB The encoded DHQS gene and GhmysCD The nucleic acid sequences encoding the ATP-grasp gene are shown in SEQ ID NO.1 and SEQ ID NO.2, with full lengths of 2769 bp and 2760 bp, respectively, encoding 923 and 920 amino acid residues, respectively. The sequences are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0017] The structures of porphyra-334 and shinorine are as follows:

[0018] In the presence of the heterogeneous genus *Ligustrum lucidum* Gh.mysAB and Gh.mysCD The gene was constructed on a vector and introduced into the Saccharomyces cerevisiae strain BY4742. It was fermented and grown in a medium with SC-L as the carbon source. Under the catalysis of the DHQS and ATP-grasp genes encoded by the gene, the endogenous substrate 7-phosphate sedoheptulose (S7P) of Saccharomyces cerevisiae was converted into porphyra-334 and shinorine in two steps.

[0019] This invention expresses the target protein in Saccharomyces cerevisiae using recombinant plasmids, and then directly generates porphyra-334 and shinorine by catalyzing the high accumulation of the yeast endogenous substrate 7-phosphate sedoheptulose (S7P).

[0020] The *Gracilaria heterophylla* described in this invention Gh.mysAB Genes and heteroclade Gracilaria Gh.mysCDThe gene was identified from the algae of *Gracilaria heteroclade* through genome sequencing and bioinformatics techniques, after extensive experimental screening. RNA was extracted from *Gracilaria heteroclade* using RNA reagents, reversed to form cDNA, and then amplified by PCR. Gh.mysAB and Gh.mysCD When the gene undergoes homologous recombination with the vector pUC19, Gh.mysAB and Gh.mysCD Genes require amplification and recovery using primers with homologous arms. Primers with homologous arms are as follows: Gh.mysAB-TY-5'F:tatataattatattaatcttattataaacgagattcgtcaactttctgca; (SEQ ID NO.5) Gh.mysAB-TY-3'R: caatcaactatctcatatacaatgcacatatctctggattccaca; (SEQ IDNO.6) Gh.mysCD-TY-5'F: taaacacacataaacaaacaaaatgtactatccagctgttctgaaattttg; (SEQ ID NO.7) Gh.mysCD-TY-3'R: atttaagagcgatttgttttattagtgccggattctcataccaaca. (SEQ ID NO.8) In addition, the target segment needs to be included when constructing the chassis. Gh.mysAB and Gh.mysCD To integrate the target fragment into the Saccharomyces cerevisiae genome, integration primers are needed to extract the target fragment from the constructed plasmid. pUC19-Gh.mysAB-msyCD The clone obtained its integration primers are as follows: DSCP1-ZH-F:ccccggtccgtttgttctatacttctct; DSCP1-ZH-R:tagtccgcgagttggatagcccgagctt.

[0021] In the experimental subject of this invention, *Gracilaria heterophylla* (… Gracilariopsis heteroclada In the study, genomic analysis revealed that the MAAs synthesis gene cluster consists of only two enzymes: 3-dehydroquinic acid synthase (DHQS) and ATP-grasp. The pathway-related genes >Gh02G000287.t1 and >Gh02G000288.t1 were named... Gh.mysAB and Gh.mysCD It is a fusion of four genes from the MAA biosynthetic gene cluster of cyanobacteria, and each enzyme in this species has two domains.

[0022] The present invention relates to Gracilaria heterophylla. Gh.mysAB Genes and heteroclade Gracilaria Gh.mysCD The gene can serve as an important marker gene for molecularly assisted culture of Gracilaria plants, and also as an important candidate gene for the production of porphyra-334 and shinorine in yeast chassis cell construction.

[0023] This invention achieves efficient production of mycotoxin amino acids (MAAs) through heterologous synthesis technology, which has significant advantages over traditional algal extraction methods. Firstly, it utilizes a simplified two-enzyme catalytic system derived from Gracilaria (…). Gh.mysAB and Gh.mysCD First, it replaces the complex four-gene pathway of cyanobacteria, significantly improving catalytic efficiency. Second, by heterologously expressing it in Saccharomyces cerevisiae, it eliminates the dependence on marine algae such as red algae, overcoming problems such as seasonal shortage of natural resources, high energy consumption in pretreatment, and complex extraction processes, thus reducing production costs. Finally, this technology avoids the risk of marine environmental pollution, meets the demand for natural and safe sunscreens in the cosmetics industry, and has both environmental friendliness and industrial application potential.

[0024] Compared with the prior art, the beneficial effects of this invention are as follows: (1) Current domestic MAAs production relies entirely on thalli extraction, which suffers from bottlenecks such as long raw material cycles, low extraction rates, and high costs, leading to stagnation in large-scale production. This invention is based on... Gh.mysAB and Gh.mysCD The dual-gene approach successfully constructed a heterologous synthesis system for MAAs in a yeast system, eliminating dependence on algae and shortening the production cycle to within a day, laying the technological foundation for the industrial production of MAAs. (2) Compared with the complex synthetic pathway of cyanobacteria requiring 4 steps, the evolution of Gracilaria heterophylla is a different process. Gh.mysAB and Gh.mysCD The dual-enzyme system can complete the skeleton construction and modification in one step through synergistic catalysis, achieving efficient synthesis in "two steps" and potentially significantly optimizing catalytic efficiency; (3) Achieving the production of natural and safe sunscreens, achieving a win-win situation for both environmental protection and commercial value. By using heterogeneous synthesis of MAAs to replace the traditional algal resource extraction method, the production cost is greatly reduced, which can better meet the human demand for "natural, efficient and safe" sunscreens. Attached Figure Description

[0025] Figure 1 A schematic diagram of the synthetic pathways of porphyra-334 and shinorine; Figure 2 Recombinant plasmid pUC19-Gh.mysAB-mysCD A schematic diagram of its construction; Figure 3 forpUC19-Gh.mysAB-mysCD and pUC19 - Electrophoresis results of Gh.mysAB recombination; lane marker is 250 bp with 9 bands, from top to bottom: 5000bp, 3000bp, 2000bp, 1500bp, etc. Lanes 1 to 4 in Figure A are selected recombination bands. pUC19-Gh.mysAB-mysCD The four positive transformants were all 3000bp-5000bp; lanes 2 and 4 in Figure B are the two positive transformants of pESC-Gh.mysAB after recombination, both 2000bp-3000bp, while lanes 1 and 3 are the transformants that did not recombine successfully, both 500bp. Figure 4 This is a diagram of the chassis construction; the chassis consists of three large segments: segment 1 is the upstream portion of the integration site, segment 2 is the target segment for integration. pUC19-Gh.mysAB-msyCD Fragment 3 is the downstream portion of the integration site; Figure 5 Graphs for LC-MS detection of intermediate 4-DG; where A is the EIC chromatogram of the yeast cell extract that produced intermediate 4-DG, 4#-1- pUC9-Gh.mysAB and 4#-2- pUC9-Gh.mysAB These are two sample-specific chromatographic peaks; CK is the control group; B is the peak extracted by MS (4#-1-). pUC9-Gh.mysAB Graph of production intermediate 4-DG; C represents 4#-2- extracted by MS. pUC9- Gh.mysABGh.mysCD Graph showing the production of intermediate product 4-DG; Figure 6 HPLC and LC-MS chromatograms of porphyra-334 and shinorine products are shown; where A is the HPLC chromatogram of the extract from yeast chassis cells producing porphyra-334 and shinorine, P1 is shinorine, P2 is porphyra-334, and the positive gene is... Nl.mysD The product is porphyra-334, a positive gene. Np.mysD The product was shinorine, CK was the control, and the gene from *Gracilaria heterophylla* was 3#- pUC9 - Gh.mysAB-mysCD The products are shinorine and porphyra-334; B is the EIC diagram of the yeast chassis cells that produced porphyra-334 and shinorine, 3#- pUC9 - Gh.mysAB-mysCD The sample showed more specific chromatographic peaks than the control group; Figure 7 MS detection Gh.mysAB-mysCD The production of porphyra-334 and shinorine in yeast is shown in the figure; where A represents the positive gene band extracted by MS.Np.mysD A represents shinorine produced by the chassis; B represents shinorine produced by *Gracilaria heterophylla* extracted by MS; C represents the positive gene band extracted by MS. Nl.mysD The chassis produced porphyra-334; DMS extracted porphyra-334 from Gracilaria heterophylla. Detailed Implementation

[0026] The present invention will now be described in further detail with reference to the embodiments.

[0027] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to techniques or conditions described in the literature in the field or according to product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be purchased. In this invention, m / v is measured in g / mL. Example 1

[0028] Based on the genome gene domain annotation information of Gracilaria heterophylla, the protein sequences of Gracilaria heterophylla were annotated using the PfamScan v1.6 program based on the Pfamv36.0 database. Sequences with an E value less than 1e-5 were retained. The annotated sequence containing PF01761 was identified as the Gracilaria heterophylla DHQS gene sequence, the annotated sequence containing PF01596 as the Gracilaria heterophylla OMT gene sequence, the annotated sequence containing PF17773 as the Gracilaria heterophylla Acylphosphatase gene sequence, and the annotated sequence containing PF07478 as the Gracilaria heterophylla ATP-grasp gene sequence. A total of Gh.mysA sequences were identified. The three results are Gh01G00035.t1, Gh02G000287.t1, and Gh09G000322.t1. Three results for Gh.mysB are found: Gh015G000191.t1, Gh02G000287.t1, and Gh23G000079.t1. No results for Gh.mysC are found. Three results for Gh.mysD are found: Gh13G000276.t1, Gh02G000288.t1, and Gh21G000182.t1. The results obtained from these filters are then organized and analyzed. Following a series of procedures including cDNA preparation, candidate gene amplification and recovery, homologous recombination, in vivo yeast expression induction, incubation reaction, yeast metabolite extraction, and LC-MS detection, the Gh02G000287.t1 gene was finally identified. Gh.mysAB encodes ) can catalyze the production of 4-DG from the yeast endogenous substrate S7P. Figure 1 ), while the Gh02G000288.t1 gene (by Gh.mysAB-mysCDEncoding) can catalyze the intermediate 4-DG to generate the final products porphyra-334 and shinorine ( Figure 1 The steps involved in the synthesis of porphyra-334 and shinorine are as follows: (1) Preparation of cDNA template Fresh samples of Gracilaria heterophylla were sectioned, flash-frozen in liquid nitrogen, and RNA was extracted. Total RNA was extracted using the Magen HiPure Plant RNA Mini Kit (Guangzhou Meiji Biotechnology Co., Ltd.). RNA was extracted according to the kit's instructions, and after passing the tests, the RNA was reverse transcribed into cDNA using the TAKARA reverse transcription kit and stored at -20℃ for later use.

[0029] (2) Gene amplification and recovery The target fragment for gene amplification is the candidate gene. Gh.mysAB and Gh.mysCD The open reading frames were obtained using the cDNA prepared above. Candidate genes were first identified using NCBI online software (https: / / www.ncbi.nlm.nih.gov / orffinder / ). Gh.mysAB and Gh.mysCD The open reading frame was determined, and then primers with homologous arms for the two target genes were designed using the primer design software SnapGene: Upstream primer Gh.mysAB-TY-5'F: tatataattatattaatcttattataaacgagattcgtcaactttctgca; (SEQ ID NO.5) Downstream primer Gh.mysAB-TY-3'R: caatcaactatctcatatacaatgcacatatctctggattccaca; (SEQ ID NO.6) Upstream primer Gh.mysCD-TY-5'F: taaacacacataaacaaacaaaatgtactatccagctgttctgaaattttg; (SEQ ID NO.7) Downstream primer Gh.mysCD-TY-3'R: attaagagcgatttgttttattagtgccggattctcataccaaca. (SEQ ID NO.8) (Note: The homologous arm is on the yeast expression vector pUC19) The target gene was then amplified using 2×Phanta Max Master Mix. The PCR reaction system consisted of 25 μL of 2×Phanta Max Master Mix, 2 μL each of upstream and downstream primers (10 μM), 2 μL of Gracilaria heterophylla cDNA, and 19 μL of ddH2O, for a total of 50 μL.

[0030] The PCR amplification program was as follows: 95℃, 3 min; 95℃, 15 s; 58℃, 15 s; 72℃, 3 min, 30 cycles; 72℃, 5 min; 12℃, infinity. After PCR, gel electrophoresis was performed to confirm successful amplification, and the target band was then recovered. Gene digestion and recovery were performed using a GenStar kit to obtain the target gene. Gh.mysAB, Target gene Gh.mysCD The fragment was recovered and its concentration was determined using NanoDrop2000. Finally, it was stored in a -20 ℃ refrigerator for later use.

[0031] (3) Construction and identification of gene recombination vectors (3.1) Vector linearization: First, the pUC19 vector was linearized by designing upstream and downstream backbone primers. The upstream backbone primer was pUC19-GJ-5'F: actggccgtcgttttaca (SEQ ID NO.9); the downstream backbone primer was pUC19-GJ-3'R: gcgtaatcatggtcatagctgtttc (SEQ ID NO.10). Subsequently, 2×Phanta Max Master Mix was used to linearize the vector. The PCR reaction system included: 25 μL of 2×Phanta Max Master Mix, 2 μL each of the upstream and downstream backbone primers (10 μM), 0.5 μL of pUC19 circular plasmid, and 20.5 μL of ddH2O, for a total of 50 μL. The PCR amplification program was as follows: 95℃, 3 min; 95℃, 15 s; 58℃, 15 s; 72℃, 5 min, 30 cycles; 72℃, 5 min; 12℃, indefinite. The recovered product was retrieved using a GenStar kit to extract the target band. After recovery, the concentration was determined, and the product was labeled as linearized pUC19-GJ. Finally, it was stored at -20℃ for later use.

[0032] (3.2) Preparation of promoter fragments: The nucleotide sequences of two promoters, ADH1 and TDH3, were downloaded from the Saccharomyces cerevisiae genome database. The upstream primer of ADH1 was designed as ADH1-5'F: tgtatatgagatagttgattgtatgcttg (SEQ ID NO.11), and the downstream primer of ADH1 was designed as ADH1-3'R: acatgtaggtggcggaggg (SEQ ID NO.12). The upstream primer of TDH3 was designed as TDH3-5'F: gacgctaacattcaacgctagtat (SEQ ID NO.13), and the downstream primer of TDH3 was designed as TDH3-3'R: tttgtttgtttatgtgtgtttattcgaaac (SEQ ID NO.14). Subsequently, PCR amplification of the two promoters ADH1 and TDH3 was performed using phanta enzyme. The cloning system was identical except for the primers; the template was the BY4742 genome. The PCR reaction system and procedure were referenced in (3.1) Vector Linearization. After the procedure, the target bands were recovered using a GenStar kit. The concentrations were measured after recovery, and the bands were labeled as unidirectional promoters ADH1 and TDH3. Subsequently, the two promoters, ADH1 and TDH3, were fused. The PCR reaction system consisted of: 25 μL of 2×Phanta Max Master Mix, 2 μL (10 μM) each of the upstream primer ADH1-5'F: tgtatatgagatagttgattgtatgcttg (SEQ ID NO.15) and the downstream primer TDH3-3'R: tttgtttgtttatgtgtgtttattcgaaac (SEQ ID NO.16), 1 μL of the one-way promoter ADH1, 1 μL of the one-way promoter TDH3, and 19 μL of ddH2O. The PCR program was: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 3 min, 30 cycles; 72℃ for 5 min; 12℃ for infinity. The target band was subsequently recovered using a GenStar reagent kit. After recovery, its concentration was determined, and it was labeled as bidirectional promoter ADH1-TDH3. Finally, it was stored at -20°C for later use.

[0033] (3.3) Gene recombination transformation: Recombinant plasmids were constructed using the Ready-to-Use Seamless Cloning Kit; Constructed pUC19-Gh.mysAB-mysCD The plasmid ligation system included: 1 μL of linearized pUC19-GJ backbone, 1.5 μL of bidirectional promoter ADH1-TDH3, and the target gene amplified using homologous arm primers.Gh.mysAB The target gene was amplified using 1.5 μL of primers with homologous arms. Gh.mysCD 1 μL of fragment and 5 μL of seamless clone enzyme, total volume 10 μL; Constructed pESC-Gh.mysAB The system includes: a linearized pUC19-GJ backbone (1 μL), ADH1-TDH3 (1 μL), and the target gene amplified by homologous arm primers. Gh.mysAB Fragment (3 μL) and ready-to-use seamless cloning kit (5 μL), total volume 10 μL.

[0034] After the two reaction systems were thoroughly mixed, they were incubated in a metal bath at 50°C for 1 hour.

[0035] The connection method and conversion method are described in [link to documentation]. Figure 2 After ligation, the ligation product was converted into DH5α competent cells using a heat shock method. Specifically, 10 μL of the ligation product from two tubes was converted into 50 μL of DH5α competent cells, incubated on ice for 30 min, heat-shocked at 42℃ for 45 s, followed by an ice incubation for 2 min. Then, 200 μL of antibiotic-free LB liquid medium was added, and the cells were incubated at 220 rpm / min and 37℃ for 1 h. Subsequently, 200 μL of each medium was plated onto LB solid medium containing ampicillin (100 mg / mL). pESC-Gh.mysAB- mysCD The plasmid was constructed on plate #1. pESC-Gh.mysAB The plasmid was placed in plate #2 and incubated overnight at 37°C. The culture media used in this experiment are listed in Table 1.

[0036]

[0037] (3.4) Bacterial water detection: On a clean bench, four single colonies were randomly selected from plates #1 and #2 of the overnight cultured transformation products from (3.3) and placed into eight tubes containing 20 μL of sterile ddH2O. The tubes were numbered 1#-1, 1#-2, 1#-3, 1#-4, 2#-1, 2#-2, 2#-3, and 2#-4. After thoroughly suspending the colonies, 2 μL of each tube was taken for PCR amplification. The PCR reaction system used was the 2×Taq Master Mix enzyme reaction system from Nanjing Novizan Biotechnology Co., Ltd. The reaction system consisted of 10 μL of 2×Taq Master Mix, 1 μL each of upstream and downstream detection primers (10 μM), 2 μL of template bacterial solution, and 6.5 μL of sterile ddH2O, for a total of 25 μL.

[0038] Upstream detection primer pUC19-JC-F: gttacttggacgctgttcaataatgt; (SEQ ID NO.17) Downstream detection primer pESC-JC-R: tgtatcacttgtaaatctaccgtccctta; (SEQ ID NO.18) The PCR amplification program was as follows: 95℃, 3 min; 95℃, 15 s, 58℃, 15 s, 72℃, 2 min, 35 cycles (cycle phase: 95℃, 15 s - 72℃, 2 min); 72℃, 5 min; 12℃, ∞. After the reaction program was completed, the length of the PCR products was determined using 1% agarose gel.

[0039] Depend on Figure 3 Electrophoresis results showed that, as shown in Figure A, the PCR products from plate #1 were all between 3000bp and 5000bp in length, consistent with the target band, indicating successful assembly, which was further confirmed by sequencing. Figure B showed the PCR product results from plate #2, where only 2#-2 and 2#-4 had lengths between 2000bp and 3000bp, indicating successful assembly, which was further confirmed by sequencing. The remaining PCR stock solutions from plates #1, #2, #3, #1, #4, #2, and #2 were sent for sequencing. The remaining 17 μL of the corresponding positive monoclonal bacteria were placed in 6 mL of LB broth containing 100 mg / mL ampicillin and incubated overnight at 37°C with a shaker at 220 rpm / min.

[0040] (4) Extraction of recombinant plasmids and amplification of integrated fragments After successful sequencing of cells 1#-1, 1#-2, 1#-3, 1#-4, 2#-2, and 2#-4, the bacteria were preserved by mixing 4 mL of the overnight culture with 50% (v / v) glycerol at a 1:1 volume ratio. Subsequently, plasmids were extracted according to the instructions on the plasmid DNA miniaturization kit (GenStar, Shenzhen, China). The recovered plasmid DNA concentration was determined using a NanoDrop 2000 and numbered accordingly. pUC19-Gh.mysAB-mysCD (1#-1) pUC19-Gh.mysAB-mysCD (1#-2) pUC19-Gh.mysAB- mysCD (1#-3) pUC19 -Gch.mysAB-mysCD (1#-4) pUC19 -Gh.mysAB (2#-1) and pUC19- Gh.mysAB (2#-2).

[0041] Finally, the integration primers DSCP1-ZH-F: ccccggtccgtttgttctatacttctct (SEQ ID NO. 19); and DSCP1-ZH-R: tagtccgcgagttggatagcccgagctt (SEQ ID NO. 20) were used to... pUC19- Gh.mysAB-mysCD Genes andpUC19-Gh.mysAB Genes from plasmids pUC19-Gh.mysAB-mysCD (1#-1) and plasmid pUC19-Gh.mysAB The first PCR reaction system, which is integrated from (2#-2), is: 2×Phanta Max MasterMix 25μL, and upstream and downstream integration primers 2μL each (10μM). pUC19 - Gh.mysAB - mysCD (1#-1) Circular plasmid 0.5 μL, ddH2O 20.5 μL, total 50 μL system; the second reaction system is: 2×Phanta Max Master Mix 25 μL, upstream and downstream integration primers 2 μL each (10 μM). pUC19 - Gh.mysAB (2#-2) 0.5 μL of circular plasmid and 20.5 μL of ddH2O were used to form a 50 μL system. The PCR amplification program was as follows: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 1.5 min, 72℃ for 5 min, 30 cycles; 72℃ for 5 min; 12℃ for infinity. The recovered product was obtained by using a GenStar kit to recover the target band. The concentration was determined after recovery, and the first recovered product was named ZH- pUC19 - Gh.mysAB - mysCD The second product was named ZH- pUC19 - Gh.mysAB Finally, store it in a -20℃ refrigerator for later use.

[0042] (5) Preparation of competent cells and transformation of yeast strain BY4742 (5.1) Prepare a YPD solid plate and streak the Saccharomyces cerevisiae strain BY4742 on the YPD solid plate for 48 h. Then, pick a single colony of BY4742 growing on the YPD solid medium and inoculate it into 3 mL of YPD liquid medium. Incubate overnight at 220 rpm in a 30℃ constant temperature shaking incubator for 16-24 h.

[0043] (5.2) Take 1 mL of the 3 mL of BY4742 yeast cultured overnight and spread it into 30 mL of YPD liquid culture medium. Place it in a 30℃ constant temperature shaking incubator and culture at 220 rpm until OD600 = 0.8~1 to obtain the culture medium.

[0044] (5.3) Collect the culture medium into a 50 mL centrifuge tube, centrifuge at 6000 rpm for 5 min, remove the supernatant, and collect the bacterial cells.

[0045] (5.4) Wash the bacterial cells with 30 mL of sterile deionized water, centrifuge at 6000 rpm for 5 min, remove the supernatant and collect the bacterial cells; repeat the washing twice.

[0046] (5.5) Add 1 mL of sterile deionized water to resuspend the bacteria, then transfer to a 1 mL sterile centrifuge tube, centrifuge at 12000 rpm for 1 min, and remove the supernatant.

[0047] (5.6) Add 900 μL of sterile deionized water and 100 μL of 1 mM LiAc to the 1 mL centrifuge tube in (5.5) to resuspend the bacteria. Aliquot the bacteria into 1.5 mL centrifuge tubes, 100 μL per tube, and divide into 3 tubes. Centrifuge for 30 seconds on your hand and remove the supernatant for yeast transformation.

[0048] (5.7) Resuspend the competent yeast cells in a 1.5 mL centrifuge tube containing the mixture and gently pipette to mix. The mixture was prepared according to Table 2. All components were the same except for the added DNA. The DNA was prepared using… ZH - pUC19 - Gh.mysAB - mysCD plasmid, ZH- pUC19 - Gh.mysAB Plasmid.

[0049] Table 2

[0050] Depending on the type of DNA added: Adding an integrated fragment ZH - pUC19 - Gh.mysAB - mysCD The tube is named #3, and the integrated fragment ZH- is added. pUC19 - Gh.mysAB It is named pipe #4. (5.8) After mixing (5.7), the centrifuge tubes were placed in a constant temperature incubator at 30℃ for 20 min.

[0051] (5.9) After static incubation, heat shock at 42℃ for 40 min.

[0052] (5.10) Centrifuge at 12000 rpm for 1 min, remove the supernatant, add 200 μL of sterile deionized water to resuspend the yeast cells, and take 150 μL of yeast cells to spread on SC-Lue solid medium [the plates to be spread are named No. 3 plate and No. 4 plate respectively, corresponding to the tube number in step (5.7) above], the specific formula is listed in Table 1, and incubate in an inverted 30℃ constant temperature incubator for 2-3 days.

[0053] (6) Extraction of single-colony genome of Saccharomyces cerevisiae (6.1) From step (5.10) 3# plate (3#-1- pUC9 - Gh.mysAB - mysCD 3#-2 - pUC9 - Gh.mysAB - mysCD 3#-3 - pUC9 - Gh.mysAB - mysCD 3#-4 - pUC9 - Gh.mysAB - mysCD ), 4# board (4#-1- pUC9 - Gh.mysAB 4#-2- pUC9 - Gh.mysAB 4#-3- pUC9 - Gh.mysAB 4#-4- pUC9 - Gh.mysABFour yeast colonies were picked from each of the plates and added to 3 mL of SC-Lue liquid medium. At the same time, three single colonies of BY4742 yeast (BY4742-1, BY4742-2, BY4742-3) were picked from the YPD plate in step (5.1) and added to 3 mL of YPD liquid medium as a control group. The cells were cultured at 220 rpm in a constant temperature shaking incubator at 30℃ for 24-48 h. When the cells became turbid, the yeast genome was extracted (6.2) and single colony PCR was performed for verification.

[0054] (6.2) Take 200 μL of the turbid bacterial solution obtained in (6.1) into a 1.5 mL centrifuge tube, centrifuge at 12000 rpm for 1 min, remove the supernatant, and keep the bacterial cells for subsequent (6.3) yeast genome extraction.

[0055] (6.3) Add 150 μL of cell lysis buffer containing 200 mM lithium acetate and 1% (m / v) SDS to the cells, mix well, and incubate at 70 °C for 10 min.

[0056] (6.4) After incubation, add 300 μL of anhydrous ethanol and mix well. At this time, white flocculent matter will appear. Then centrifuge at 12000 rpm for 1 min and remove the supernatant.

[0057] (6.5) Add 300 μL of 70% (v / v) anhydrous ethanol and mix well. Resuspend the precipitate, centrifuge at 12000 rpm for 1 min, and aspirate the supernatant with a pipette tip.

[0058] (6.6) Place the centrifuge tube in a 65°C metal bath to dry the remaining 70% anhydrous ethanol, add 20 μL ddH2O and mix gently, then centrifuge at 12000 rpm for 1 min.

[0059] (6.7) Take 2 μL of the supernatant as a template for single colony PCR verification.

[0060] (7) Single colony PCR verification To verify the integration of the transformed DNA fragment (gene expression cassette) into the yeast genome, the single-colony yeast genome extracted in step (6.7) above was subjected to PCR verification. The reaction system for colony PCR verification is shown in Table 3.

[0061] The detection primers are: Upstream primer Y15site-JC-R: atgtagttttaaaatttcaaatccgaaca; (SEQ ID NO.21) Downstream primer DSCP1-GJ-F: gaaagcttttttatattgtttctttttcat; (SEQ ID NO.22) The reaction procedure is shown in Table 3. After the PCR reaction was completed, the PCR products were further detected and verified by agarose gel electrophoresis to identify positive single colonies.

[0062] Table 3

[0063] Table 4

[0064] (8) Yeast-induced expression Select the positive yeast single colony suspensions verified by PCR products in step (7) above, and plate #3 (3#-1- pUC9 - Gh.mysAB - mysCD 3#-2 - pUC9 - Gh.mysAB - mysCD 3#-3 - pUC9 - Gh.mysAB - mysCD ), 4# board (4#-1- pUC9 - Gh.mysAB 4#-2- pUC9 - Gh.mysAB 4#-3- pUC9 - Gh.mysAB Three positive single colonies were picked from each of the following samples. 1 mL of bacterial culture was cultured in 50 mL of SC-Lue liquid medium. Simultaneously, 1 mL of bacterial culture was taken from each of BY4742-1, BY4742-2, and BY4742-3 samples and cultured in 50 mL of YPD liquid medium. The formulations are listed in Table 1. The samples were cultured at 30°C and 220 rpm with shaking for 5 days. Subsequently, the culture medium was transferred to a 50 mL centrifuge tube, centrifuged at 3900 rpm for 10 min to collect the cells, the supernatant was discarded, 5 mL of deionized water was added, and the mixture was sonicated for 30 min. Then, 5 mL of chloroform was added, and the mixture was sonicated for another 30 min. The mixture was then left to stand overnight. The supernatant was collected the next day for testing.

[0065] The HPLC gradient elution program is shown in Table 5. During gradient elution, the gradient change was linear. An INERTSUSTAINAQ-C18 column (250 mm × 4.6 mm, 5 μm) was used. The column temperature was 25℃, the flow rate was 0.6 mL / min, the injection volume was 10 μL, the ESI was in positive ion mode, and the UV was 330 nm.

[0066] Table 5

[0067] (9) Detection of yeast products by HPLC and LC-MS To verify the biosynthetic pathway of the intermediate 4-DG, samples screened from *Gracilaria heterophylla* were used. Gh.mysAB The gene recombinant vector was transformed into Saccharomyces cerevisiae BY4742 for heterologous expression. After fermentation for 5 days following step (8) above, the experimental groups (4#-1-) were respectively... pUC9 - Gh.mysAB 4#-2-pUC9 - Gh.mysAB Fermentation products were extracted from two transformants and the original strain BY4742-1 control group (CK), and analyzed by LC-MS. Figure 5 From A, we know that the two transformants (4#-1-) pUC9 - Gh.mysAB 4#-2- pUC9 - Gh.mysAB Specific chromatographic peaks appeared at a retention time of 8.8 min in all positive peaks, while no such characteristic peak was observed in the control group. Further extraction of the relative molecular weight of the positive peaks was performed. pUC9 - Gh.mysAB The relative molecular weight is [M+H]+=189.0763, 4#-2- pUC9 - Gh.mysAB The relative molecular mass is [M+H]+=189.0755, which is consistent with the reported relative molecular mass of 4-DG [M+H]+=189.0757 in the literature. Figure 5 B-5C.

[0068] Due to the limited availability of commercially available standard samples, this experiment used the cyanobacterial MAAs synthesis gene cluster ( Av.mysA , Np.mysB , Np.mysC , Np.mysD / Nl.mysD Heterologous expression of shinorine was introduced into *Saccharomyces cerevisiae* BY4742 as a positive control for this experiment. The results were analyzed by HPLC and EIC. Figure 6 Analysis showed that all recombinant strains successfully produced the target product, among which the constructed *Gracilaria heteroclade* strain 3#-1- pUC9 - Gh.mysAB - mysCD Characteristic peaks appeared at 7.9 min and 9.4 min, and their retention times were consistent with those of shinorine (7.9 min) and porphyra-334 (9.4 min) in the positive control sample. Further validation was performed by LC-MS. Figure 7 A-7D analysis showed that the relative molecular masses of the two characteristic peaks in *Gracilaria heterophylla* were [M+H]+=333.1295 and [M+H]+=347.1468, consistent with the relative molecular masses of the positive control. Based on these results, the synthetic pathway of MAAs in *Gracilaria heterophylla* is inferred to start from S7P, and then... Gh.mysAB Gene catalysis to 4-DG, subsequently in Gh.mysCD The genes catalyze the production of the final products shinorine and porphyra-334. Figure 1 ).

[0069] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A recombinant plasmid for preparing the natural sunscreen agents shinorine and porphyra-334, characterized in that, The recombinant plasmid contains *Gracilaria heteroclade*. Gh.mysAB Genes and heteroclade Gracilaria Gh.mysCD Genes; the aforementioned Gracilaria heteroclade Gh.mysAB The nucleotide sequence of the gene is shown in SEQ ID NO.1; the described *Gracilaria heteroclade* Gh.mysCD The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

2. The recombinant plasmid for preparing the natural sunscreen agents shinorine and porphyra-334 according to claim 1, characterized in that, The different branches are like the river grass. Gh.mysAB Genes, heteroclade Gracilaria Gh.mysCD The gene was homologously recombined with the pUC19 vector to obtain the pUC19-Gh.mysAB-mysCD recombinant plasmid.

3. A transgenic engineered bacterium containing the recombinant plasmid of claim 2, or wherein the genome of the transgenic engineered bacterium is integrated with exogenous Gracilaria heteroclade of claim 1. Gh.mysAB Genes and heteroclade Gracilaria Gh.mysCD Gene.

4. The genetically engineered bacteria according to claim 3, characterized in that, The genetically engineered bacteria is Saccharomyces cerevisiae strain BY4742.

5. The *Gracilaria heterophylla* as described in claim 1 Gh.mysAB Genes or heteroclades of Gracilaria Gh.mysCD Gene.

6. The *Gracilaria heterophylla* as described in claim 1 Gh.mysAB Genes or heteroclades of Gracilaria Gh.mysCD Gene-encoded protein, characterized by, Different branches of the river grass Gh.mysAB The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.3; Gracilaria heterophylla Gh.mysCD The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.

4.

7. The *Gracilaria heterophylla* as described in claim 1 Gh.mysAB Genes and heteroclade Gracilaria Gh.mysCD Application of genes in the preparation of natural sunscreens shinorine and porphyra-334.

8. A method for preparing natural sunscreens shinorine and porphyra-334, characterized in that, The transgenic engineered bacteria as described in any one of claims 3 to 4 are fermented to obtain the natural sunscreen agents shinorine and porphyra-334 from the fermentation broth.

9. The method for preparing the natural sunscreen agents shinorine and porphyra-334 according to claim 8, characterized in that, The fermentation medium used was SC-Leu liquid medium, and the fermentation temperature was 30℃.