RPA-LFD primer, probe and kit for detecting type II grass carp reovirus and application
By designing highly specific primer and probe combinations and combining them with freeze-dried microsphere technology, the false positive problem in RPA-LFD detection has been solved, enabling rapid, sensitive, and specific detection of grass carp hemorrhagic disease in fish farms and ensuring the healthy development of grass carp aquaculture.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-29
- Publication Date
- 2026-03-27
AI Technical Summary
The existing RPA-LFD technology is prone to false positives when detecting GCRV-II, and the detection conditions are demanding, making it difficult to conduct rapid and accurate virus detection on-site in fish farms.
A dedicated primer and probe combination for GCRV-II was designed. By performing point mutations at key sites in the reverse primer and probe sequences, combined with lyophilized microsphere technology, rapid amplification under low-temperature isothermal conditions was achieved, and the results were visualized and interpreted using a lateral flow chromatography test strip.
It significantly improves the specificity and sensitivity of the detection, enabling accurate detection of low viral loads in a short time. It is suitable for on-site detection in fish farms, simplifies the operation process, and reduces the requirements for professional skills.
Smart Images

Figure CN121737356A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of virus detection, and particularly relates to RPA-LFD primers and probes for detecting grass carp reovirus type II, a kit and application. BACKGROUND
[0002] Grass carp (Ctenopharyngodon idellus) is an important freshwater economic fish in China. However, viral diseases, especially grass carp hemorrhagic disease, have caused significant losses to the grass carp aquaculture industry. The pathogen of the disease is mainly grass carp reovirus (GCRV), which can be divided into GCRV-I (genotype I), GCRV-II (genotype II), and GCRV-III (genotype III) according to genomic differences. Studies have shown that GCRV-II (GCRV-II) is the most virulent and harmful genotype, and is the main pathogen causing outbreaks and epidemics of grass carp hemorrhagic disease. The virus can persistently latent in grass carp for a long time, and when the fish body is under environmental stress and the immune function is decreased, it is easy to induce disease outbreaks, with the characteristics of acute onset and high mortality. Therefore, establishing a technology that can be applied to the breeding site and realize early, rapid and accurate detection of GCRV-II is of great importance for timely early warning, isolation of sick fish and prevention of epidemic spread, and is a key link in the prevention and control of grass carp hemorrhagic disease.
[0003] Currently, the detection of GCRV-II mainly uses PCR or fluorescent quantitative PCR detection methods targeting the S6 gene. Huang Qiwen et al. established a GCRV-II TaqMan fluorescent quantitative PCR detection method with high sensitivity, with a minimum detection limit of 3 copies / μL. In addition, there are detection methods based on GCRV-II polyclonal antibody immunohistochemistry and immunofluorescence. However, these methods have high requirements for detection conditions, are seriously dependent on precise fluorescent quantitative PCR instruments, fluorescence signal acquisition systems, etc., and are time-consuming, only suitable for laboratory detection, and difficult to apply to fishery rapid detection. The current method that can be used for rapid detection of GCRV-II in fishery is GCRV-II antibody colloidal gold detection test strip, but the antibody detection has low sensitivity and cannot completely replace nucleic acid detection.
[0004] Recombinase polymerase amplification (RPA) is an isothermal DNA amplification technique. RPA offers several advantages over other nucleic acid amplification methods, particularly its applicability outside of laboratory settings. Utilizing recombinases, single-stranded DNA-binding proteins, and strand displacement DNA polymerases, RPA achieves specific exponential amplification of target DNA sequences within a short time (typically 10-30 minutes) under isothermal conditions (usually 37-42°C). The amplification products can be visualized using lateral flow dipsticks (LFD). This combination of techniques requires minimal hardware, eliminating the need for large or expensive instruments. RPA also has lower requirements for nucleic acid samples, eliminating the need for complex purification processes, making it highly flexible and practical, especially suitable for pathogen detection in fish farms.
[0005] Despite the significant advantages of RPA-LFD technology, its practical application, especially under high-sensitivity detection requirements, still faces a pressing technical challenge: the non-specific binding between the reverse primer and probe in the combination of RPA and LFD results in false positives. Because the LFD detection line captures the target amplification product with dual labels, if a biotin-containing reverse primer non-specifically binds to a fluorescent probe, a "pseudo-dual-labeled product" is formed, causing a false positive signal on the LFD detection line. Since the RPA reaction occurs at lower temperatures, interactions between primers and probes (including dimer formation or non-specific hybridization) are more likely to occur than in PCR. Although existing RPA primer / probe design principles (such as length, GC content, and avoidance of secondary structures) help reduce these problems, screening for primer-probe combinations that can both efficiently amplify and completely eliminate interactions within the complex genome sequences of natural viruses is extremely challenging. This has become a key bottleneck limiting the detection specificity and reliability of RPA-LFD technology and its widespread application in the precise detection of important pathogens such as GCRV-II. Summary of the Invention
[0006] This invention addresses the issues of low sensitivity or demanding detection conditions in current GCRV-II detection technologies, and the susceptibility to false positives in RPA-LFD detection technology. It develops a set of dedicated primers, probes, and reagent kits specifically designed for GCRV-II, possessing both high sensitivity and specificity, and effectively overcoming the false positive problem of RPA-LFD. After amplification efficiency screening, point mutations are performed on certain sites in the reverse primer and probe sequences, effectively eliminating false positives caused by the reverse primer-probe combination. This kit features high sensitivity, good specificity, ease of operation, and low requirements for detection conditions. Furthermore, combined with freeze-dried microsphere technology, it can be widely applied to on-site detection in fish farms, providing significant practical value for rapid and accurate on-site diagnosis of grass carp hemorrhagic disease and ensuring the healthy development of grass carp aquaculture.
[0007] To achieve the above-mentioned technical objectives, the present invention adopts the following technical measures: This invention provides an RPA-LFD primer and probe combination for detecting GCRV-II. The primers include: a forward primer S6-F as shown in SEQ ID NO.1, and a reverse primer S6-mR as shown in SEQ ID NO.2; the probe includes: S6-mProbe as shown in SEQ ID NO.3, wherein a tetrahydrofuran (THF) is added between the 29th and 30th bases of the probe, as detailed below: S6-F: CGAAACCTGCTCTACAGTGAACGTGTCCG (SEQ ID NO. 1); S6-mR: / Biotin / AGGTTGTGTGCTGGTATCATAGCAGCCGC (SEQ ID NO.2); S6-mProbe: / FAM / GCCCTCAAGAAGGACGTCGAGAAAGGAGT / THF / TTCGGTTCAACGTCA / C3 Spacer / (SEQ ID NO. 3).
[0008] Furthermore, the 5' end of the reverse primer S6-mR is connected to biotin; the 5' end of the probe is labeled with carboxyfluorescein FAM, and the 3' end has an extension blocking group C3 Spacer added.
[0009] This invention also provides the application of the above-mentioned primer and probe combination in the preparation of the GCRV-Ⅱ RPA-LFD detection kit.
[0010] The present invention also provides a GCRV-Ⅱ RPA-LFD detection kit, comprising the above-described primer and probe combination.
[0011] Furthermore, the kit includes a dual microsphere system, a disposable diluent, and a nucleic acid test strip; The dual microsphere system comprises microsphere 1 and microsphere 2, wherein microsphere 1 contains an RPA-LFD primer and probe combination, a recombinase that binds to single-stranded nucleic acids, a single-stranded DNA binding protein, and a strand displacement DNA polymerase; and microsphere 2 contains a rehydration buffer and a magnesium acetate solution.
[0012] Furthermore, the microsphere 1 contains 10 μmol / L of forward primer, 10 μmol / L of reverse primer, and 5 μmol / L of probe.
[0013] This invention also provides the application of the above-described primer and probe combinations and / or the above-described kits in the detection of GCRV-II for non-disease diagnostic purposes.
[0014] This invention also provides a method for detecting GCRV-II for non-disease diagnostic purposes, using the above-mentioned kit, the method comprising: S1. Extract nucleic acid from the sample to be tested; S2. Add 50 μL of the nucleic acid extracted in step S1 to the dual microsphere system, mix well, and start the reaction immediately to obtain the amplification product; S3. After diluting the amplification product with disposable diluent, analyze the amplification product obtained in step S2 using a nucleic acid test strip.
[0015] Furthermore, nucleic acid test strips are used to determine the amplification products: when both the control line and the test line on the test strip show bands, the result is positive; when the control line shows a band but the test line does not, the result is negative; if the control line does not show a band, the reaction is invalid.
[0016] Furthermore, the reaction temperature of the kit is 35-45℃, preferably 41℃; the reaction time is 10 min or more, preferably 18 min.
[0017] Compared with the prior art, the beneficial effects of the present invention include: 1) Effectively solves the false positive problem in RPA-LFD technology: After screening out the primer-probe combination with high efficiency amplification, this invention further modifies the key sites of the reverse primer and probe sequences by site-directed mutation, thereby effectively eliminating the problem of false positive signals generated on the LFD detection line due to the formation of "pseudo-double-labeled products", and significantly improving the specificity and reliability of the detection results.
[0018] 2) Combining high sensitivity and high specificity: The dedicated RPA primers and probes provided in this invention are designed for highly conserved regions of the GCRV-II genome and have been optimized to ensure both high efficiency and targeting of amplification, with a minimum detection concentration as low as 10. 1With copies / μL, it can accurately detect samples with low viral load, and its sensitivity is comparable to or even higher than that of PCR, which is widely used in molecular detection laboratories.
[0019] 3) Fast detection speed and low reaction temperature: Compared with conventional PCR technology, which requires complex thermal cycling and usually takes more than 60 minutes, the RPA-LFD method of this invention can achieve the nucleic acid concentration detected by the test strip in less than 30 minutes or even 10 minutes under constant temperature conditions of 35-45℃. Combined with LFD, the results can be visualized and interpreted, which greatly shortens the time of nucleic acid amplification.
[0020] 4) The method is simple, easy to operate, and suitable for on-site testing: This method does not rely on expensive and precision instruments such as thermal cyclers. Furthermore, this invention prepares enzymes, primers, probes, and buffer solutions in the reaction system into lyophilized microspheres, achieving long-term reagent stability and room-temperature transportation. During on-site testing, the operator only needs to add the processed sample nucleic acid solution to the dual-microsphere system, mix well, and start the reaction. The results can then be read using a test strip, greatly simplifying the operation and reducing the professional technical requirements for operators. It is suitable for on-site testing in fish farms and can also be used for scientific research on GCRV-II.
[0021] 5) Intuitive and accurate result interpretation: The test results are displayed on the bands of the sideflow chromatography test strip (LFD), which can be observed directly with the naked eye. When clear bands appear on both the test line (T line) and the control line (C line), it can be interpreted as GCRV-II positive, avoiding complicated steps such as electrophoresis and fluorescence signal analysis. The results are clear and easy to understand, and are less prone to misinterpretation.
[0022] In summary, this invention, through primer and probe design and mutation optimization, successfully overcomes the common false positive problem in RPA-LFD technology, and establishes a rapid, sensitive, specific, easy-to-operate, and equipment-independent field detection method for GCRV-II. It can be widely applied to field detection in fish farms and has important practical application value for achieving rapid and accurate field diagnosis of grass carp hemorrhagic disease and ensuring the healthy development of grass carp aquaculture. Attached Figure Description
[0023] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 This is a schematic diagram illustrating the alignment analysis and modification of the reverse primer and probe sequences in Example 1 of the present invention.
[0025] Figure 2 The reaction conditions for optimizing the RPA-LFD detection system in Example 2 of this invention are as follows: (A) the effect of different reaction temperatures on the RPA-LFD amplification effect, and (B) the effect of different reaction times on the RPA-LFD amplification effect.
[0026] Figure 3 This is the result of RPA-LFD specificity detection in Example 3 of the present invention.
[0027] Figure 4 The sensitivity of PCR and RPA-LFD detection using pMD18-S6 plasmid in Example 4 of this invention is shown; wherein: (A) PCR detection results; (B) RPA-LFD detection results. Detailed Implementation
[0028] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.
[0029] In some embodiments, the product is analyzed by 2% agarose gel electrophoresis. In some embodiments, nucleic acid test strips are used to analyze the product: the presence of bands on both the control line and the test line indicates a positive result; the presence of a band on the control line but no band on the test line indicates a negative result; and the absence of a band on the control line indicates an invalid reaction.
[0030] It should be noted that the RNA isothermal rapid detection kit (product number: WLRN8209KIT), the customized dual microsphere system, and the nucleic acid detection test strip (product number: WLFS8204) in the following examples were all purchased from Weifang Anpu Future Biotechnology Co., Ltd., China.
[0031] Example 1: Design and optimization of GCRV-Ⅱ RPA-LFD primer pairs and probe sequences (1) Design of primer pairs and probe sequences Based on the GCRV-Ⅱ S6 gene sequence (GQ896337.1) published in GenBank, this invention designs RPA-LFD primer pairs and probes, and then performs sequence alignment analysis using BLAST to compare the similarity of the designed primer and probe sequences with common grass carp virus gene sequences such as GCRV-Ⅰ and GCRV-Ⅲ, thereby determining the specificity of the primer pairs and probes.
[0032] The initial primer and probe sequences obtained from the preliminary design are (5'-3'): S6-F:CGAAACCTGCTCTACAGTGAACGTGTCCG S6-R: / Biotin / AGGTGTGTCTACTGGTATCATAGCAGCCGC S6-Probe: / FAM / GCCCTCAAGAAGTACGTCGAGAAAGGAGT / THF / TTCATGTCAACATCA / C3Spacer / (2) Optimization of reverse primer and probe sequences During RPA-LFD detection, the LFD detection line is prone to false positive signals due to primer dimers, which severely affects the accuracy of the detection. In this invention, the reverse primer and probe of the original primer / probe sequence can form a "pseudo-double-labeled product" through non-specific pairing and binding. Therefore, we optimized the reverse primer and probe by point mutation, modifying a total of five bases between the reverse primer and probe, specifically: as follows... Figure 1 As shown, the 20th adenine (A) and 22nd cytosine (C) on the reverse primer were replaced with guanine (G), and the 13th thymine (T), 34th adenine (A), and 42nd adenine (A) on the probe were also replaced with guanine (G). The optimal primer-probe combination after modification is shown in Table 1.
[0033] This invention specifically optimizes the reverse primer and probe sequences, and specifically adjusts the bases in the key binding regions of the reverse primer / probe. This effectively blocks the non-specific complementary binding between the labeled detection probe and the reverse primer. In the RPA-LFD isothermal amplification detection system, it can effectively avoid the generation of false positive signals mediated by this type of dimer. Compared with the original sequence, the optimized sequence avoids the false positive risk of the detection system, significantly improves the specificity and reliability of the detection results, and does not affect the specific amplification ability of the target nucleic acid.
[0034] Table 1. RPA-LFD primer and probe sequences used for detecting GCRV-II The reverse primer S6-mR has a biotin attached to its 5' end; the probe's 5' end is labeled with carboxyfluorescein FAM, and the 3' end has a C3 spacer extension blocking group added. The 30th position of the probe sequence is not a base, but a tetrahydrofuran. Both primers and probes were synthesized by Qingke Biotechnology Co., Ltd.
[0035] Example 2: Optimization of the reaction system and conditions for RPA-LFD of GCRV-II (1) Extraction of viral genomic RNA After centrifuging the GCRV-II cell culture medium, the supernatant was used to extract GCRV-II genomic RNA according to the instructions of the viral DNA / RNA extraction kit (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.), and finally eluted with 30 μL of DNase- and RNase-free water. The extracted RNA was stored at -80℃ for later use.
[0036] (2) RPA-LFD reaction system The reaction system consisted of: 2 μL of forward primer (10 μmol / L), 2 μL of reverse primer (10 μmol / L), 0.6 μL of probe (5 μmol / L), 2 μL of DNA template, 11.5 μL of DNase- and RNase-free water, and 29.4 μL of buffer A. These were added to a reaction tube containing lyophilized enzyme powder. 2.5 μL of initiation buffer B was added to the tube cap. The tubes were then capped, centrifuged, and vortexed to mix, ensuring a consistent initiation time.
[0037] Result interpretation: Take 10 μL of amplification product and dilute it with DNase- and RNase-free water to a total volume of 200 μL. Then add 80 μL of the diluted product to the nucleic acid test strip for color development. The color development time should be controlled within 10 min.
[0038] The amplification products are analyzed using nucleic acid test strips: a positive result is indicated when both the control line (C) and the test line (T) on the test strip show bands; a negative result is indicated when the control line (C) shows a band but the test line (T) does not show a band; and a negative result is indicated when the control line (C) shows no band.
[0039] (3) Optimization of reaction temperature To determine the optimal reaction temperature for the RPA-LFD method, we tested nine different reaction temperatures: 20℃, 25℃, 30℃, 35℃, 37℃, 39℃, 41℃, 45℃, and 50℃, with an incubation time of 20 min. The test results are as follows: Figure 2 As shown in Figure A, clear positive bands appeared on the test strips at temperatures between 35 and 45°C. No bands appeared on the test strips at 50°C. The bands on the test strips were the brightest at 41°C, so 41°C was chosen as the reaction temperature for subsequent experiments.
[0040] (4) Optimization of reaction time To determine the optimal reaction time for the RPA-LFD method, eight different times were set at a reaction temperature of 41℃: 1 min, 5 min, 10 min, 15 min, 18 min, 20 min, 25 min, and 30 min. The detection results are as follows: Figure 2 As shown in B, when the reaction time is 10 min or more, a more obvious band appears on the test strip detection line. In order to make the test results more stable, 18 min was selected as the reaction time for subsequent experiments.
[0041] Example 3: Integrating the reaction reagent into dual microspheres and performing RPA-LFD specificity detection of GCRV-II. 1. The integrated reaction reagent is a double microsphere. To improve the ease of use of the testing kits in fisheries, the optimized testing reagents were integrated into lyophilized dual microspheres for testing. The dual microsphere reaction system is as follows: Microsphere 1: Contains 10 μmol / L forward primer, 10 μmol / L reverse primer, 5 μmol / L probe, recombinase, single-stranded DNA binding protein and strand displacement DNA polymerase; Microsphere 2: Contains rehydration buffer and magnesium acetate solution.
[0042] The reaction can be initiated by adding 2 μL of purified nucleic acid and 48 μL of enzyme-free water, or by directly adding 50 μL of the supernatant of the crude nucleic acid release product, mixing well and then incubating at 35-45℃.
[0043] 2. Specificity detection of RPA-LFD for GCRV-II The specificity of RPA-LFD was detected using nucleic acids from GCRV-Ⅰ, GCRV-Ⅱ, GCRV-Ⅲ, largemouth bass iridovirus (LMBV), infectious spleen and kidney necrosis virus (ISKNV), Aeromonas hydrophila, and Flavobacterium cloumnare, respectively, with a blank control group set up.
[0044] The genomes of GCRV-II, largemouth bass iridovirus, infectious spleen and kidney necrosis virus, Aeromonas hydrophila, and Flavobacterium columnare were extracted and preserved by our laboratory; the nucleic acids of GCRV-I and GCRV-III were donated by the Yangtze River Fisheries Research Institute of the Chinese Academy of Fishery Sciences.
[0045] Specific test results such as Figure 3As shown, only the test strip using GCRV-II as a template showed a band on the detection line, while other pathogens did not show bands on the detection line, resulting in negative results. This indicates that the method is specific for GCRV-II detection and effectively avoids interference from other pathogens when used in fish farm environments.
[0046] Example 4: RPA-LFD Sensitivity Detection of GCRV-II (1) Plasmid construction Using GCRV-II cDNA as a template, the S6 gene fragment of GCRV-II was amplified by PCR. The primers are shown below: Forward primer: 5'-GCTGATGCTGCAGACGGCTAAAC -3', Reverse primer: 5'-TAATTGCCTGCTGCGCTGACT-3' The reaction system consisted of 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 1 μL of template, 10 μL of 2× Taq Master Mix (Nanjing Novizan Biotechnology Co., Ltd.), and 7 μL of ddH2O.
[0047] The amplification conditions were as follows: 94℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 32 cycles; and 72℃ extension for 10 min.
[0048] PCR products were identified by electrophoresis on a 2% agarose gel. The PCR products were recovered using an agarose gel DNA recovery kit (Guangzhou Meiji Biotechnology Co., Ltd.), ligated into the pMD18-T cloning vector (TAKARA, Japan), transformed into competent *E. coli* cells DH5α (Beijing TransGen Biotech Co., Ltd.), and plated on LB agar plates containing 100 mg / L ampicillin, incubated at 37°C for 12 h. Positive single colonies were screened and cultured overnight at 37°C in liquid medium containing ampicillin. Finally, plasmids were extracted using an endotoxin-free plasmid mini-extraction kit (Tiangen Biotech Co., Ltd.), and the pMD18-S6 plasmid was sequenced positive. The concentration of the extracted pMD18-S6 plasmid was measured using a Nanodrop-2000 spectrophotometer.
[0049] According to the formula for calculating the copy number: copy number (copies) / μL = 6.02 × 10⁻⁶ 23 × Plasmid concentration (ng / μL) × 10 -9 Calculate the copy number of the extracted recombinant plasmid pMD18-S6 by using (plasmid base number × 660) and dilute it to 10^6. 7copies / μL.
[0050] For a concentration of 10 7 Plasmids with copies / μL were serially diluted 10-fold to select a copy number of 10. 7 ~10 0 The plasmid was divided into copies / μL and RPA-LFD was amplified at 41℃ for 18 min. A blank control group (i.e. no template was added, and the template volume was made up with enzyme-free water) was set up. The minimum detection concentration of RPA-LFD was determined and sensitivity analysis was performed. The reaction system and result analysis method of RPA-LFD are detailed in Example 2.
[0051] (2) The results of RPA-LFD were compared with those of conventional PCR. The primers, reaction system, and amplification conditions used in conventional PCR are as follows: Forward primer: 5'-GCTGATGCTGCAGACGGCTAAAC -3', Reverse primer: 5'-TAATTGCCTGCTGCGCTGACT-3' The reaction system consisted of 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 1 μL of template, 10 μL of 2× Taq Master Mix (Nanjing Novizan Biotechnology Co., Ltd.), and 7 μL of ddH2O.
[0052] The amplification conditions were as follows: 94℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 32 cycles; and 72℃ extension for 10 min.
[0053] Test results as follows Figure 4 As shown, the lowest detection concentration of the pMD18-S6 plasmid using conventional PCR methods is 10. 3 The RPA-LFD detection method of this invention is two orders of magnitude more sensitive than the PCR method, and the lowest detection concentration of RPA-LFD for pMD18-S6 plasmid is 10 copies / μL. 1 The results show that the GCRV-ⅡRPA-LFD detection method established in this invention has high sensitivity, comparable to existing gold standard PCR methods.
[0054] In summary, this invention successfully overcomes the common false positive problem in RPA-LFD technology through primer and probe design and mutation optimization. Furthermore, by optimizing the reaction conditions of the RPA-LFD detection system and combining it with freeze-dried microsphere technology, a rapid, sensitive, specific, easy-to-operate, and equipment-independent field detection method for GCRV-II has been established. This method is widely applicable to field detection in fish farms and has significant practical value for achieving rapid and accurate on-site diagnosis of grass carp hemorrhagic disease, thus ensuring the healthy development of grass carp aquaculture.
[0055] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
Claims
1. An RPA-LFD primer and probe combination for detecting GCRV-II, characterized in that, The primers include: the forward primer S6-F as shown in SEQ ID NO.1, and the reverse primer S6-mR as shown in SEQ ID NO.2; the probe includes: S6-mProbe as shown in SEQ ID NO.3, with a tetrahydrofuran added between the 29th and 30th bases of the probe.
2. The primer and probe combination according to claim 1, characterized in that, The reverse primer S6-mR has a biotin attached to its 5' end; the probe has a carboxyfluorescein FAM labeled at its 5' end and an extension blocking group C3 Spacer added to its 3' end.
3. The application of the primer and probe combination according to claim 1 in the preparation of the GCRV-Ⅱ RPA-LFD detection kit.
4. A GCRV-Ⅱ RPA-LFD detection kit, characterized in that, It includes the primer and probe combination as described in any one of claims 1-2.
5. The reagent kit according to claim 4, characterized in that, The kit includes a dual microsphere system, disposable diluent, and nucleic acid test strips. The dual microsphere system comprises microsphere 1 and microsphere 2, wherein microsphere 1 contains an RPA-LFD primer and probe combination, a recombinase that binds to single-stranded nucleic acids, a single-stranded DNA binding protein, and a strand displacement DNA polymerase, and microsphere 2 contains a rehydration buffer and a magnesium acetate solution.
6. The reagent kit according to claim 5, characterized in that, The microsphere 1 contains 10 μmol / L of forward primer, 10 μmol / L of reverse primer, and 5 μmol / L of probe.
7. The use of the primer and probe combination according to any one of claims 1-2 and / or the kit according to any one of claims 4-6 in the detection of GCRV-II for non-disease diagnostic purposes.
8. A method for detecting GCRV-II for non-disease diagnostic purposes, characterized in that, The detection is performed using the kit described in any one of claims 5-6, the method comprising: S1. Extract nucleic acid from the sample to be tested; S2. Add 50 μL of the nucleic acid extracted in step S1 to the dual microsphere system, mix well, and start the reaction immediately to obtain the amplification product; S3. After diluting the amplification product with disposable diluent, analyze the amplification product obtained in step S2 using a nucleic acid test strip.
9. The method according to claim 8, characterized in that, The amplification products are determined using nucleic acid test strips: a positive result is indicated when both the control line and the test line appear on the strip; a negative result is indicated when the control line appears but the test line does not. If the quality control line shows no bands, the reaction is invalid.
10. The method according to any one of claims 8-9, characterized in that, The reaction temperature of the kit is 35-45℃; the reaction time is 10 min or more.