Lipid nanoparticles comprising encoding RNA molecules for gene editing and as vaccines and therapeutic agents

By improving the lipid nanoparticle delivery system, the degradation of RNA within cells and the delivery lag of gene editing tools have been addressed, enabling efficient targeted delivery of RNA vaccines and therapeutics and safe gene editing.

CN121752544APending Publication Date: 2026-03-27RENAGADE THERAPEUTICS MANAGEMENT INC
View PDF 488 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-06-20
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing technologies struggle to effectively deliver RNA to appropriate sites within cells or organisms. RNA is easily degraded, and the development of delivery systems for gene editing tools lags behind, resulting in poor therapeutic outcomes.

Method used

Employing an improved lipid nanoparticle (LNP) delivery system containing higher-performance ionizable lipids, it enhances targeted RNA delivery, protects RNA from degradation, and delivers gene-editing tools such as CRISPR-Cas9, enabling whole-body or local delivery.

Benefits of technology

It improves the delivery efficiency of RNA vaccines and therapeutics, protects RNA from degradation, enables safe and effective gene editing, reduces toxicity risks, and enhances the therapeutic index.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121752544A_ABST
    Figure CN121752544A_ABST
Patent Text Reader

Abstract

The present disclosure describes improved LNP-based RNA vaccines, nucleobase editing systems, and therapeutic agents for the treatment and / or immune of diseases. In particular, the present disclosure describes improved LNPs, including novel and improved ionizable lipids for making LNPs, which enhance the targeted delivery of LNP-based RNA vaccines and therapeutic agents based on linear and / or cyclic mRNA. The improved LNPs protect linear and / or cyclic mRNA payloads from degradation and clearance while achieving targeted systemic or local delivery for use as enhanced vaccines and / or therapeutic agents.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-reference

[0002] This application claims the benefit and priority of U.S. Provisional Patent Application No. 63 / 509,376, filed June 21, 2023; U.S. Provisional Patent Application No. 63 / 509,368, filed June 21, 2023; U.S. Provisional Patent Application No. 63 / 509,587, filed June 22, 2023; and U.S. Provisional Patent Application No. 63 / 509,638, filed June 22, 2023, the contents of each of which are hereby incorporated herein by reference in their entirety. Technical Field

[0003] This disclosure generally relates to the field of nucleic acid lipid nanoparticle (LNP) compositions and their delivery for use as vaccines and / or therapeutic agents for treating diseases. This disclosure further relates to compositions comprising LNPs formulated with encoding RNA (including linear and / or circular mRNA) for delivering encoded vaccine antigens and / or therapeutic proteins for vaccination against infectious agents and / or treatment of diseases (including infectious diseases and cancer).

[0004] sequence list

[0005] This application contains a sequence list, which is submitted electronically in XML format and is hereby incorporated herein by reference in its entirety. The XML copy was created on June 19, 2024, named RNG038-WO1_REG-020WO.xml, and has a size of 44,139 bytes. Background Technology

[0006] Delivering nucleic acids to influence desired responses in biological systems (such as immune responses or the production of therapeutically beneficial proteins for treating diseases) presents many challenges. Nucleic acid-based therapeutics and vaccines hold enormous potential, but to realize this potential, more efficient delivery of nucleic acids to the appropriate sites within cells or organisms remains crucial.

[0007] Nucleic acid-based therapeutics and vaccines are typically composed of DNA or RNA. DNA is known to be relatively stable and easy to handle; however, the use of DNA carries the risk of accidental insertion into the cell genome, which could induce mutagenic events. Further concerns are the association of DNA delivery with unwanted immunogenicity and the generation of anti-DNA antibodies. Another concern with the use of DNA is the limited expression levels of the encoded peptides or proteins that can be achieved, as the administered DNA must first enter the cell nucleus for transcription before being translated into the desired protein product (e.g., an antigen or therapeutic protein).

[0008] In contrast to DNA, using RNA is inherently safer because RNA does not involve the risk of integration into the genome of transfected cells, thus eliminating concerns that introduced genetic material might disrupt the normal function of essential genes or cause mutations. Furthermore, RNA-based agents do not require foreign promoter sequences to efficiently express the encoded protein, and they are less immunogenic than DNA-based agents, partly because RNA has a relatively short half-life, unlike DNA. Additionally, DNA must enter nucleases to function, while RNA functions outside the cell nucleus and is therefore more efficient.

[0009] Despite the advantages of using RNA-based therapeutics and vaccines, RNA (e.g., mRNA) is far less stable than DNA, especially when it reaches the cytoplasm of the cell and is exposed to RNA-degrading enzymes. Furthermore, the presence of a hydroxyl group on the second carbon of the sugar moiety in RNA creates steric hindrance, preventing RNA from forming a more stable double helix structure like DNA, thus making RNA more susceptible to hydrolytic degradation than DNA.

[0010] To overcome these challenges, the delivery of RNA vaccines (e.g., mRNA vaccines) and therapeutics has recently focused on the use of lipid nanoparticles (LNPs). In fact, LNPs have emerged as the most promising nonviral delivery medium for exogenous mRNA (see, for example, Guan et al., “Nanotechnologies in delivery of mRNA therapeutics using nonviral vector-based delivery systems,” Gene Ther, 24 (2017), pp. 133–143). LNPs are complex nanostructures that provide protection against the rapidly degrading nuclease environment in vivo for the encapsulated payload RNA molecule, while simultaneously facilitating intracellular delivery. LNPs are self-assembled by combining the RNA payload with several lipid components, including ionizable lipids that play a central role in delivery efficacy (e.g., Miao et al., “Delivery of mRNA vaccines with heterocyclic lipids increases anti-tumorefficacy by STING-mediated immune cell activation,” Nat. Biotechnol., 27 (2019), pp. 1174–1185). RNA encapsulation is achieved by mixing RNA with lipids at an acidic pH. At this pH, the ionizable lipids carry a positive charge, ensuring charge-driven interactions with the negatively charged RNA molecules (e.g., Mindy et al., “Mechanism of macromolecular structure evolution in self-assembled lipid nanoparticles for siRNA delivery,” Langmuir, 20 (2014), pp. 4613-4622). The pH is then adjusted to be above the pKa of the ionizable lipids, resulting in a near-neutral surface charge suitable for clinical application (see Id.). Furthermore, incorporating polyethylene glycol-modified lipids into the mixture creates spatially stable core-shell nanoparticles, which can be used for clinical applications as vaccines and / or therapeutic agents.

[0011] Despite the development of LNPs, delivering RNA payloads to cells in vivo in a targeted manner while achieving sufficient levels of protein production (e.g., producing vaccine antigens or therapeutic proteins) remains an important and significant challenge.

[0012] Genome editing tools encompass a wide range of technologies that enable various types of genomic alterations in diverse contexts. These technologies have evolved over the past few decades, providing a suite of user-programmable editing tools, including ZFN (zinc finger) nuclease editing systems, macronuclease editing systems, and TALENS (transcription activator-like effector nucleases). Over the past decade, a new generation of genome editing systems based on components from bacterial immune pathways has exploded, including CRISPR (clustered short palindromic repeats with regular intervals) and related CRISPR-related proteins (e.g., CRISPR-Cas9) (Jinek et al., “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity,” Science, Vol. 337 (6096), pp. 816–821), macronuclease editors (Boissel et al., “megaTALs: a rare-cleaving nuclease architecture for therapeutic genome engineering,” Nucleic Acids Research 42: pp. 2591–2601), and bacterial reverse transcriptase systems (Schubert et al., “High-throughput functional variant screens via in vivo production of single-stranded DNA,” PNAS, April 27, 2021, Vol. 118 (18), pp. 1–10). Specifically, CRISPR-Cas9 has been derivatized in various ways to extend its guide RNA-based programmable double-stranded cleavage activity, ranging from the search for alternative CRISPR Cas nucleases with different PAM requirements and cleavage properties (e.g., engineered Cas9 proteins and other naturally occurring Cas9 homologs, including but not limited to Cas12a, Cas12f, Cas13a, and Cas13b and their engineered variants) to base editing (Komor et al., “Programmable editing of atarget base in genomic DNA without double-stranded DNA cleavage,” Nature, May 19, 2016, 533 (7603);Pages 420-424 [Cytosine base editor or CBE] and Gaudelli et al., “Programmable base editing of AT to GC in genomic DNA without DNAcleavage,” Nature, Vol. 551, pp. 464-471 [Adenine base editor or ABE]) to leader editing (Anzalone et al., “Search-and-replace genome editing without double-strandbreaks or donor DNA,” Nature, December 2019, 576 (7789): pp. 149-157) to double-leader editing (Anzalone et al., “Programmable deletion, replacement, integration and inversion of large DNA sequences with twin prime editing,” Nature Biotechnology, December 9, 2021, Vol. 40, pp. 731-740) to epigenetic editing (Kungulovski and Jeltsch, “Epigenome Editing: State of the Art, Concepts, and From "Perspective," Trends in Genetics, Vol. 32, 206, pp. 101-113) to CRISPR-directed integrase editing (Yarnell et al., "Drag-and-drop genome insertion of large sequences without double-stranded DNA cleavage using CRISPR-directed integrases," Nature Biotechnology, November 24, 2022, ("PASTE")) to systems with altered characteristics.

[0013] While the proliferation of genome editing tools has exploded, the development of safe and efficient delivery systems for these tools has lagged behind. Numerous challenges remain in the delivery of gene editing tools—including, but not limited to, CRISPR-Cas9 and alternative Cas nuclease editors, reverse transcriptase editors, base editors, leader editors, dual leader editors, epigenetic editors, and integrase editors—to enable safe and efficient therapeutic applications of such tools in cells and patients to treat diseases and / or otherwise modify the nucleotide sequences of target nucleic acid molecules (e.g., genes or genomes), particularly when in vivo delivery is involved. That said, the use of lipid nanoparticles (LNPs) has become a primary delivery option for the safe, efficient, and targeted delivery of gene editing tools to target tissues and cells. However, there remains a need for improved LNPs, including better-performing ionizable lipids, to enhance the targeted delivery of LNP-based gene editing tools. Preferably, such improved LNPs protect the payload from degradation and clearance while achieving targeted delivery, are suitable for systemic or local delivery, and provide delivery of RNA cargo, including that associated with various gene editing tools, such as those mentioned above. In addition, such improved LNP-based therapeutic agents should exhibit low toxicity and provide a sufficient therapeutic index to minimize patient risk while maximizing therapeutic benefits when administered at an effective dose of LNP.

[0014] Therefore, improved LNPs that enhance the delivery of LNP-based RNA vaccines and therapeutics to cells, tissues, and body sites, and better protect the RNA payload, will drive advancements in this field. Preferably, such improved LNPs will protect the RNA payload from degradation and clearance upon delivery, are suitable for ex vivo or in vivo delivery, and provide delivery to any target, including linear and / or circular and / or modified forms of RNA. Furthermore, such improved LNP-based RNA vaccines and therapeutics should exhibit low toxicity and provide a sufficient therapeutic index so that patient treatment with an effective dose of LNP minimizes patient risk while maximizing therapeutic benefit. This disclosure provides for these and related advantages. Summary of the Invention

[0015] This document describes compositions, methods, processes, kits, and apparatuses for selecting, designing, preparing, manufacturing, formulating, and / or using LNP-based RNA drugs (e.g., vaccines and gene-editing therapeutics). Specifically, this document describes compositions, methods, processes, kits, and apparatuses for selecting, designing, preparing, manufacturing, formulating, and / or using LNP-based RNA drugs (e.g., vaccines and gene-editing therapeutics) to deliver one or more coding and / or non-coding RNA molecules. In various embodiments, the non-coding RNA may include one or more guide RNAs associated with a gene-editing system (such as a CRISPR-Cas9 or CRISPR-Cas12a-based gene-editing system), each of which requires complexation with the guide RNA to facilitate the localization of the protein-RNA complex to a target sequence having an enzyme-specific PAM site (protospacer adjacent motif – recognized by the CRISPR enzyme) and a target nucleotide sequence (i.e., a protospacer) complementary to a portion of the guide RNA (i.e., the spacer region). In other embodiments, the encoding RNA may encode any protein component of the LNP-based RNA drug, such as, but not limited to, viral antigens (e.g., viral envelope spike proteins), therapeutic proteins (e.g., functional versions of defective proteins), or one or more gene-editing components (e.g., programmable nucleases or other effector proteins, such as deaminases or reverse transcriptases). This document further describes compositions, methods, processes, kits, and devices for selecting, designing, preparing, manufacturing, formulating, and / or using LNP-based RNA drugs (e.g., vaccines and / or gene-editing therapeutics) to deliver one or more RNA molecules, such as encoding RNA for the preventative and / or therapeutic treatment of one or more diseases or their symptoms, or non-coding RNA, such as, but not limited to, guide RNA for gene-editing systems. In various embodiments, the RNA molecule delivered by the LNPs disclosed herein may be linear mRNA. In other embodiments, the RNA molecule delivered by the LNPs disclosed herein may be circular mRNA. In other embodiments, the RNA molecule delivered by the LNPs disclosed herein may include both linear and circular forms of mRNA. In further embodiments, the RNA may contain one or more modifications, including chemical modifications (e.g., ribonucleotide analogs, substituted phosphate linkers), sequence modifications (e.g., relative to wild-type sequences), and / or structural modifications (e.g., secondary folding structures, such as, but not limited to, stem-loops, hairpins, and G-quadruplexes, and tertiary structural elements, such as, but not limited to, helical double strands and triple strands). In various other embodiments, this disclosure provides novel lipid components of the LNPs disclosed herein, including, but not limited to, novel ionizable lipids.

[0016] This disclosure describes improved LNP-based RNA drugs (e.g., vaccines and therapeutics) for the treatment and / or immune diseases. Specifically, this disclosure describes improved LNPs, including better-performing ionizable lipids, that enhance the targeted delivery of LNP-based RNA vaccines and therapeutics based on linear and / or circular mRNAs. The improved LNPs protect linear and / or circular mRNA cargo (i.e., circular and / or linear mRNA molecules encapsulated by LNPs) from degradation and clearance while enabling targeted systemic or local delivery for use as enhanced vaccines and / or therapeutics.

[0017] In this disclosure, the present document provides formulas (CT), (CT-A), (CT-A1), (CT-A2), (CT-B), (CT-B'), (CT-C), (CT-D), (CT-D'), (CT-E), (CT-E'), (CT-E''), (CT-F), (CT-F'), (CT-F'''), (CT-F'''), (CT-F''''), (CT-F''''), (CT-F'''''), (CT-G), (CT-G'), (CT-G''), (CT-H) , (CT-H'), (CT-H''), (CT-H'''), (CT-H''''), (CT-H'''''), (CT-I), (CT-J), (CT-J'), (CT-K), (CT-K'), (CT-K'') , (CT-L), (CT-L'), (CT-L''), (CT-L'''), (CT-L''''), (CT-L'''''), (CT-M), (CT-N), (CT-N'), (CT-O), (CT-O'), ( CT-O''), (CT-P), (CT-P'), (CT-P''), (CT-P'''), (CT-P''''), (CT-P'''''), (CT-Q), (CT-Q1), (CT-R), (CT-R'), ( CT-S), (CT-S'), (CT-S''), (CT-T), (CT-T'), (CT-T''), (CT-T'''), (CT-T''''), (CT-T'''''), (CT-U), (CT-U'), ( Compounds of the structure of any one of CT-U''), (CT-U'''), (CT-U''''), (CT-U''''), (CT-V), (CT-V'), (CT-V''), (CT-V'''), (CT-V'''), (CT-V''''), (CT-V''''), or any lipid of the structure of any one of Tables (I) and (IA), or any lipid of the structure of any one of the pharmaceutically acceptable salts thereof, or solvates, stereoisomers or enantiomers thereof, see below, collectively referred to as "Lipids of the Disclosure", and each individually referred to as "Lipids of the Disclosure".

[0018] In this disclosure, pharmaceutical compositions comprising compounds as disclosed herein, or pharmaceutically acceptable salts thereof, and pharmaceutically acceptable carriers are provided.

[0019] In one aspect, this document provides a pharmaceutical composition comprising: a) at least one nanoparticle having the formula (CT), (CT-A), (CT-A1), (CT-A2), (CT-B), (CT-B'), (CT-C), (CT-D), (CT-D'), (CT-E), (CT-E'), (CT-E''), (CT-F), (CT-F'), (CT-F''), (CT-F'''), (CT-F'''), (CT-F''''), (CT-F''''), (CT-G), (CT-G'), (CT-G) ''), (CT-H), (CT-H'), (CT-H''), (CT-H'''), (CT-H''''), (CT-H'''''), (CT-I), (CT-J), (CT-J'), (CT-K), (CT-K'), (CT-K ''), (CT-L), (CT-L'), (CT-L''), (CT-L'''), (CT-L''''), (CT-L'''''), (CT-M), (CT-N), (CT-N'), (CT-O), (CT-O'), (CT-O' '), (CT-P), (CT-P'), (CT-P''), (CT-P'''), (CT-P''''), (CT-P'''''), (CT-Q), (CT-Q1), (CT-R), (CT-R'), (CT-S), (CT-S' ), (CT-S''), (CT-T), (CT-T'), (CT-T''), (CT-T'''), (CT-T''''), (CT-T'''''), (CT-U), (CT-U'), (CT-U''), (CT-U'''), ( The structure of at least one compound or a pharmaceutically acceptable salt thereof of any of the following: (CT-U''''), (CT-U'''''), (CT-V), (CT-V'), (CT-V''), (CT-V'''), (CT-V''''), (CT-V''''), (CT-V'''''); or any lipid or a pharmaceutically acceptable salt or solvate thereof or a pharmaceutically acceptable salt, solvate, stereoisomer or enantiomer thereof, or any lipid or a salt, solvate, stereoisomer or enantiomer thereof, as shown in Tables (I) and (IA); and b) at least one nucleobase editing system.

[0020] In one aspect, this article provides a method for delivering a nucleobase editing system to a subject in need, the method comprising administering to the subject a pharmaceutical composition disclosed herein.

[0021] In this disclosure, a lipid nanoparticle (LNP) is provided, comprising the following formulas: (CT), (CT-A), (CT-A1), (CT-A2), (CT-B), (CT-B'), (CT-C), (CT-D), (CT-D'), (CT-E), (CT-E'), (CT-E''), (CT-F), (CT-F'), (CT-F''), (CT-F'''), (CT-F''''), (CT-F''''), (CT-G), (CT-G'), (CT-F''''), (CT-F'''''), (CT-G'''''), (CT-F'''''), (CT-G'''''), (CT-F''''') -G''), (CT-H), (CT-H'), (CT-H''), (CT-H'''), (CT-H''''), (CT-H'''''), (CT-I), (CT-J), (CT-J'), (CT-K), (CT-K' ), (CT-K''), (CT-L), (CT-L'), (CT-L''), (CT-L'''), (CT-L''''), (CT-L'''''), (CT-M), (CT-N), (CT-N'), (CT-O), (C T-O'), (CT-O''), (CT-P), (CT-P'), (CT-P''), (CT-P'''), (CT-P''''), (CT-P'''''), (CT-Q), (CT-Q1), (CT-R), (CT- R'), (CT-S), (CT-S'), (CT-S''), (CT-T), (CT-T'), (CT-T''), (CT-T'''), (CT-T''''), (CT-T'''''), (CT-U), (CT-U') Compounds of the structure of any one of (CT-U''), (CT-U'''), (CT-U''''), (CT-U''''), (CT-V), (CT-V'), (CT-V''), (CT-V'''), (CT-V'''), (CT-V''''), (CT-V''''), or any lipid in Tables (I) and (IA) or any pharmaceutically acceptable salt thereof, or any lipid in Tables (I) and (IA) or any salt thereof, solvate thereof, stereoisomer or enantiomer.

[0022] In another aspect of this disclosure, a method for delivering nucleic acids to cells is provided, comprising contacting the cells with the LNP disclosed herein or a pharmaceutical composition disclosed herein.

[0023] In another aspect of this disclosure, a method for treating a disease characterized by a functional protein deficiency is provided herein, the method comprising administering to a subject suffering from the disease an LNP formulation comprising an LNP disclosed herein, wherein the mRNA encodes a functional protein or a protein having the same biological activity as the functional protein.

[0024] In another aspect of this disclosure, a method for treating a disease characterized by peptide overexpression is provided, comprising administering to a subject suffering from said disease an LNP formulation comprising the LNP and siRNA disclosed herein, wherein the siRNA targets the expression of the overexpressed peptide. Attached Figure Description

[0025] Figure 1 This is a diagram illustrating the LNP-based RNA vaccines and therapeutics disclosed herein that encapsulate RNA payloads (e.g., linear and / or circular mRNA).

[0026] Figure 2 This is a diagram illustrating the starting polynucleotide constructs of this disclosure, which can be linear or cyclic. Detailed Implementation

[0027] I. Introduction

[0028] This specification describes compositions, methods, processes, kits, and devices for selecting, designing, preparing, manufacturing, formulating, and / or using LNP-based RNA drugs (e.g., vaccines, gene therapies, or gene-editing therapeutics). In various embodiments, the LNP-based RNA drug comprises an LNP delivery system (as detailed herein) and an encapsulated cargo / payload (e.g., RNA in the case of an RNA drug).

[0029] In various embodiments and as further described herein, the LNP delivery medium is a complex nanostructure that provides protection against environmental damage (e.g., the intracellular environment) to the encapsulated RNA payload (i.e., one or more RNA molecules). The LNP is formed by the self-assembly of multiple lipid components, including (i) ionizable lipids (e.g., ALC-0315 in COMIRNATY® (Pfizer-BioNTech), SM-102 in SPIKEVAX® (Moderna), or MC3 in ONPATTRO® (Alnylam), or those ionizable lipids described herein), (ii) accessory lipids (such as, but not limited to, 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC)), (iii) sterols (e.g., cholesterol), and (iv) PEG-lipids (e.g., PEG-DSPE).

[0030] In various embodiments and as further described herein, the RNA payload in the LNP-based pharmaceuticals described herein may include coding and / or non-coding RNA and / or mixtures thereof. The specific composition of the RNA payload generally reflects the pharmaceutical composition. For example, an LNP-based vaccine or therapeutic agent may contain only coding RNA for expressing a vaccine antigen or therapeutic protein, respectively. However, LNP-based gene-editing pharmaceuticals may contain a combination of coding RNA (e.g., encoding a CRISPR nuclease) and non-coding RNA (e.g., guide RNA). In various embodiments, the RNA molecule delivered by the LNPs disclosed herein may be linear mRNA. In other embodiments, the RNA molecule delivered by the LNPs disclosed herein may be circular mRNA. In other embodiments, the RNA molecule delivered by the LNPs disclosed herein may include both linear and circular forms of mRNA. In a further embodiment, the RNA may contain one or more modifications, including chemical modifications (e.g., ribonucleotide analogs, alternative phosphate linkers), sequence modifications (e.g., sequences relative to wild-type sequences), and / or structural modifications (e.g., secondary folding structures, such as, but not limited to, stem-loops, hairpins, and G-quadruplexes, and tertiary structural elements, such as, but not limited to, double helices and triple helices).

[0031] A. LNP-based RNA vaccines

[0032] This document describes, in some respects, improved LNP-based RNA vaccines for immune diseases. In various aspects, this disclosure describes improved LNPs, including better-performing ionizable lipids, which enhance the targeted delivery of LNP-based RNA vaccines and therapeutics based on linear and / or circular mRNAs. Improved LNPs protect linear and / or circular mRNA cargo (i.e., circular and / or linear mRNA molecules encapsulated by LNPs) from degradation and clearance while enabling targeted systemic or local delivery for use as enhanced vaccines.

[0033] This specification describes compositions, methods, processes, kits, and apparatuses for selecting, designing, preparing, manufacturing, formulating, and / or using LNP-based RNA vaccines. Specifically, as described herein, it describes compositions, methods, processes, kits, and apparatuses for selecting, designing, preparing, manufacturing, formulating, and / or using LNP-based RNA vaccines to deliver RNA molecules encoding one or more immunogenic viral antigens that serve as a vaccine and / or immunogenic composition. In various embodiments, the RNA molecule delivered by the LNPs disclosed herein may be linear mRNA. In other embodiments, the RNA molecule delivered by the LNPs disclosed herein may be circular mRNA. In other embodiments, the RNA molecule delivered by the LNPs disclosed herein may include both linear and circular forms of mRNA. In further embodiments, the RNA may contain one or more modifications, including chemical modifications (e.g., ribonucleotide analogs, substituted phosphate linkers), sequence modifications (e.g., sequences relative to wild-type sequences), and / or structural modifications (e.g., secondary folding structures, such as, but not limited to, stem-loops, hairpins, and G-quadruplexes, and tertiary structural elements, such as, but not limited to, double helices and triple helices). In various other embodiments, this disclosure provides novel lipid components of the LNPs disclosed herein, including but not limited to novel ionizable lipids.

[0034] B. LNP-based RNA therapeutics

[0035] This document describes, in some respects, LNP-based RNA therapeutics for the treatment of diseases or the improvement of their symptoms. In various aspects, this disclosure describes improved LNPs, including better-performing ionizable lipids, which enhance the targeted delivery of LNP-based RNA therapeutics based on linear and / or circular mRNAs. The improved LNPs protect linear and / or circular mRNA cargo (i.e., circular and / or linear mRNA molecules encapsulated by LNPs) from degradation and clearance while enabling targeted systemic or local delivery for use as enhanced therapeutic agents.

[0036] This specification describes compositions, methods, processes, kits, and apparatuses for selecting, designing, preparing, manufacturing, formulating, and / or using LNP-based RNA therapeutics. Specifically, this document describes compositions, methods, processes, kits, and apparatuses for selecting, designing, preparing, manufacturing, formulating, and / or using LNP-based RNA therapeutics to deliver RNA molecules encoding one or more therapeutic proteins for treating a disease or its symptoms. This document further describes compositions, methods, processes, kits, and apparatuses for selecting, designing, preparing, manufacturing, formulating, and / or using LNP-based RNA therapeutics to administer RNA molecules encoding one or more therapeutic proteins for the preventative and / or therapeutic treatment of one or more diseases or their symptoms. In various embodiments, the RNA molecule delivered by the LNP disclosed herein may be linear mRNA. In other embodiments, the RNA molecule delivered by the LNP disclosed herein may be circular mRNA. In other embodiments, the RNA molecule delivered by the LNP disclosed herein may include both linear and circular forms of mRNA. In further embodiments, the RNA may contain one or more modifications, including chemical modifications (e.g., ribonucleotide analogs, substituted phosphate linkers), sequence modifications (e.g., relative to wild-type sequences), and / or structural modifications (e.g., secondary folding structures, such as, but not limited to, stem-loops, hairpins, and G-quadruplexes, and tertiary structural elements, such as, but not limited to, helical double strands and triple strands). In various other embodiments, this disclosure provides novel lipid components of the LNPs disclosed herein, including, but not limited to, novel ionizable lipids.

[0037] C. LNP-based gene editing therapies

[0038] This document also describes LNP compositions comprising gene editing systems for treating diseases and / or otherwise modifying target nucleotide sequences and / or expressing them. This disclosure provides LNPs capable of delivering gene editing systems to target organs, tissues, and / or cells. The gene editing systems can be delivered to cells in vitro or under in vitro conditions, and can be delivered to organs, tissues, or cells in vivo (e.g., administered to a subject in an effective amount).

[0039] This disclosure also provides therapeutic or pharmaceutical compositions comprising LNPs in various aspects, said LNPs comprising a gene editing system or one or more components thereof. Gene editing systems may comprise DNA components, RNA components, protein components, nucleoprotein components, polysaccharide components, or combinations thereof. In other aspects, this disclosure provides nucleic acid molecules (e.g., RNA or DNA) encoding and / or constituting various components of the deliverable gene editing system considered herein. Additionally, other aspects of this disclosure provide nucleic acid molecules as components of the gene editing system considered herein, such as, but not limited to, plasmids or vectors encoding one or more components of the gene editing system, RNA encoding one or more components of the gene editing system (e.g., mRNA encoding a nuclease domain of the gene editing system), and non-coding RNA (e.g., guide RNA capable of complexing with a nucleic acid programmable DNA binding domain and targeting it to a specific target nucleotide sequence or reverse transcriptase ncRNA).

[0040] In a further embodiment, the nucleic acid component (e.g., RNA) may contain one or more modifications, including chemical modifications (e.g., ribonucleotide analogs, alternative phosphate linkers), sequence modifications (e.g., sequences relative to wild-type sequences), and / or structural modifications (e.g., secondary folding structures, such as, but not limited to, stem-loops, hairpins, and G-quadruplexes, and tertiary structural elements, such as, but not limited to, double helices and triple helices).

[0041] In other respects, this disclosure describes various protein components (which may be encoded by the nucleic acid components described herein) of various gene editing systems considered herein, including but not limited to user-programmable DNA-binding proteins and various effector proteins such as nucleases, polymerases, reverse transcriptases, recombinases, integrases, endonucleases, exonucleases, transposases and deaminases.

[0042] This disclosure also describes nucleoprotein components of the gene editing systems considered herein, such as, but not limited to, nuclease-guided RNA complexes. This disclosure also provides methods for modifying the sequence and / or expression level of a target nucleic acid molecule by delivering and / or administering an LNP comprising a gene editing system or a component thereof as described herein. Further still, this disclosure provides a method for treating a disease by administering a therapeutically effective amount of an LNP-based gene editing system that results in modification of the sequence and / or expression level of a target nucleic acid molecule (e.g., a disease-related gene or regulatory sequence, such as a promoter, transcription factor binding site, or gene enhancer site).

[0043] Gene editing systems capable of delivery by the LNPs disclosed herein can be of any type. Without limitation, gene editing systems considered herein may include (A) nucleobase gene editing systems that result in one or more alterations to the sequence of a target nucleic acid molecule (e.g., a gene or gene regulatory sequence) (sequence modifications may include, but are not limited to, the insertion of one or more base pairs, the deletion of one or more base pairs, the substitution of one or more base pairs, the conversion of one base pair to another (e.g., a G:C pair to an A:T pair), inversions, or translocations), (B) epigenetic editing systems that result in one or more modifications to the epigenome to affect gene expression without altering the sequence of the nucleic acid molecule, and (C) gene editing systems that combine features of nucleobase editing systems and epigenetic editing systems (e.g., combining components from both types of systems to alter sequence and epigenome components using one system).

[0044] Nucleobase editing systems encompass a variety of configurations with different combinations of protein functionalities and / or nucleic acid molecule components, all of which are considered herein. Typically, a nucleobase editing system includes at least (i) a user-programmable DNA-binding domain that targets a specific sequence in a nucleic acid molecule, and optionally (ii) one or more effector domains that facilitate sequence modification of the nucleic acid molecule. User programmability may include amino acid sequence-programmable DNA-binding domains (e.g., TALENS, zinc finger-binding domains, macronucleases (or homing endonucleases)) or nucleic acid sequence-programmable DNA-binding domains or proteins (“naspDBP”) (e.g., CRISPR-Cas9, CRISPR-Cas12a, CRISPR-Cas12f, CRISPR-Cas13a, CRISPR-Cas13b, or TnpB).

[0045] Similarly, an epigenetic editing system includes at least (i) a DNA-binding domain that targets a specific sequence in a nucleic acid molecule, and (ii) one or more effector domains that promote the modification of one or more epigenomic features of the nucleic acid molecule.

[0046] Gene editing systems may include one or more functional effector domains that provide alterations to nucleotide sequences and / or gene expression, such as, but not limited to, single-stranded DNA-binding proteins, nucleases, endonucleases, exonucleases, deaminases (e.g., cytidine deaminase or adenosine deaminase), polymerases (e.g., reverse transcriptase), integrases, recombinases, and fusion proteins containing one or more functional domains linked together.

[0047] Additionally, gene editing systems utilizing nucleic acid sequence-programmable DNA-binding domains or proteins (naspDBPs) may also include one or more non-coding nucleic acids, such as one or more guide RNAs that are complexed with a nucleic acid sequence-programmable DNA-binding protein (naspDBP) and target the complex to a specific nucleotide sequence. In the case of lead editing, the guide RNA may be a lead editing guide RNA (“pegRNA”) containing a specialized RNA template molecule that provides a template or coding sequence for the reverse transcriptase of the lead editing system. In some embodiments, the RNA template molecule may be coupled to the guide RNA as an extension arm at the 5' or 3' end of the guide RNA. In other embodiments, the RNA template molecule may be provided as a separate molecule in a trans configuration, such that the RNA template molecule itself is localized and associates with the target sequence and / or the gene editing system at the editing site. In some embodiments, co-localization of the trans RNA template molecule may be achieved using aptamers or other RNA structures that bind to a binding partner that is coupled, integrated, or otherwise associated with the editing complex.

[0048] In the case of an editing system that includes a nucleic acid sequence programmable DNA-binding protein (naspDBP) (such as CRISPR-Cas9 or CRISPR-Cas12a nuclease), appropriate guides can be designed and synthesized using methods, software, and commercial sources well known to those skilled in the art, making it possible to obtain guide RNA for any given naspDBP without excessive experimentation.

[0049] The following references provide information and tools for the design, synthesis, modification, and configuration of guide RNAs: (1) Mohr SE, Hu Y, Ewen-Campen B, Housden BE, Viswanatha R, Perrimon N. CRISPR guide RNA design for research applications. FEBS J. Sep 2016;283(17):3232-8. doi: 10.1111 / febs.13777. Electronic version 22 June 2016. PMID: 27276584; PMCID: PMC5014588; (2) Hoberecht L, Perampalam P, Lun A, Fortin JP. Acomprehensive Bioconductor ecosystem for the design of CRISPR guide RNAs across nucleases and technologies. Nat Commun. Nov 2, 2022;13(1):6568. WheatCRISPR: a web-based guide RNA design tool for CRISPR / Cas9-mediated genome editing in wheat. BMC Plant Biol. 2019 Nov 6;19(1):474. doi: 10.1186 / s12870-019-2097-z. PMID: 31694550; PMCID: PMC6836449; (4) Pliatsika V, Rigoutsos I. "Off-Spotter": very fast and exhaustiveenumeration of genomic lookalikes for designing CRISPR / Cas guide RNAs. BiolDirect.2015 Jan 29;10:4. doi: 10.1186 / s13062-015-0035-z. PMID: 25630343; PMCID: PMC4326336; (5) Hoof JB, Nødvig CS, Mortensen UH. Genome Editing: CRISPR-Cas9. Methods Mol Biol. 2018;1775:119-132. doi: 10.1007 / 978-1-4939-7804-5_11. PMID: 29876814; (6) Labun K, Krause M, Torres Cleuren Y, Valen E. CRISPR Genome Editing Made Easy Through the CHOPCHOP Website. Curr Protoc. 2021 Apr;1(4):e46. doi: 10.1002 / cpz1.46. PMID: 33905612;(7) Lee CM, DavisTH, Bao G. Examination of CRISPR / Cas9 design tools and the effect of targetsite accessibility on Cas9 activity. Exp Physiol. April 1, 2018;103(4):456-460. doi: 10.1113 / EP086043. Electronic version April 12, 2017. PMID: 28303677; PMCID:PMC7266697;(8) Ma S, Lv J, Feng Z, Rong Z, Lin Y. Get ready for the CRISPR / Cas system: A beginner's guide to the engineering and design of guide RNAs. JGene Med. November 2021;23(11):e3377. doi: 10.1002 / jgm.3377. Electronic version July 28, 2021. PMID: 34270141; (9) Hiranniramol K, Chen Y, Wang X. CRISPR / Cas9 Guide RNADesign Rules for Predicting Activity. Methods Mol Biol.2020;2115:351–364.doi:10.1007 / 978-1-0716-0290-4_19. PMID: 32006410(10) Wiles MV, Qin W, ChengAW, Wang H. CRISPR-Cas9-mediated genome editing and guide RNA design. MammGenome. Oct 2015;26(9-10):501-10. doi: 10.1007 / s00335-015-9565-z. Posted on 5 / 20 / 2015. PMID: 25991564; PMCID: PMC4602062(11) Creutzburg SCA, Wu WY,Mohanraju P, Swartjes T, Alkan F, Gorodkin J, Staals RHJ, van der Oost J.Good guide, bad guide: spacer sequence-dependent cleavage efficiency ofCas12a. Nucleic Acids Res. April 6, 2020;48(6):3228-3243. doi: 10.1093 / nar / gkz1240. PMID: 31989168; PMCID: PMC7102956(12) Heigwer F, Boutros M. Cloud-Based Design of Short Guide RNA (sgRNA) Libraries for CRISPR Experiments.Methods Mol Biol. 2021;2162:3-2 doi: 10.1007 / 978-1-0716-0687-2_1. PMID:32926374(13) Dronina J, Samukaite-Bubniene U, Ramanavicius A. Towards Application of CRISPR-Cas12a in the Design of Modern Viral DNA DetectionTools (Review). J Nanobiotechnol. Jan 21, 2022;20(1):41. doi: 10.1186 / s12951-022-01246-7.PMID: 35062978; PMCID: PMC8777428(14) Chrysler AR,Cromwell CR, Tu T, Jovel J, Hubbard BP. Guide RNAs containing universal basesenable Cas9 / Cas12a recognition of polymorphic sequences. Nat Commun. Mar 25, 2022;13(1):1617. doi: 10.1038 / s41467-022-29202-x. PMID: 35338140; PMCID:PMC8956631(15) Shin HR, Kweon J, Kim Y. Gene Manipulation Using Fusion GuideRNAs for Cas9 and Cas12a. Methods Mol Biol.2021;2162:185–193. doi: 10.1007 / 978-1-0716-0687-2_10. PMID: 32926383;(16) Schubert MS, Thommandru B, WoodleyJ, Turk R, Yan S, Kurgan G, McNeill MS, Rettig GR. Optimized design parameters for CRISPR Cas9 and Cas12a homology-directed repair. Sci Rep. 9 / 30 / 2021;11(1):19482. doi: 10.1038 / s41598-021-98965-y. PMID: 34593942;PMCID: PMC8484621(17) Crone MA, MacDonald JT, Freemont PS, Siciliano V.gDesigner: computational design of synthetic gRNAs for Cas12a-based transcriptional repression in mammalian cells. NPJ Syst Biol Appl. 9 / 16 / 2022;8(1):34. doi: 10.1038 / s41540-022-00241-w.PMID: 36114193; PMCID: PMC9481559; (18) Konstantakos V, Nentidis A, Krithara A, Paliouras G. CRISPR-Cas9 gRNA efficiency prediction: an overview of predictive tools and the role of deep learning. Nucleic Acids Res. 2022 Apr 22;50(7):3616-3637. doi:10.1093 / nar / gkac192. PMID: 35349718; PMCID: PMC9023298; (19) Wang J, Zhang doi:10.1080 / 15476286.2019.1669406. Electronic version September 27, 2019. PMID: 31533522; PMCID:PMC6948960; and (20) Cram D, Kulkarni M, Buchwaldt M, Rajagopalan N, Bhowmik P, Rozwadowski K, Parkin IAP, Sharpe AG, Kagale S. WheatCRISPR: a web-based guide RNA design tool for CRISPR / Cas9-mediated genome editing in wheat. BMCPlant Biol. November 6, 2019;19(1):474. doi: 10.1186 / s12870-019-2097-z. PMID:31694550; PMCID: PMC6836449; each of the references mentioned above is incorporated herein by reference in its entirety.

[0050] In the case of prime editing, specifically, the following references can be further consulted, which provide information and tools on the design, synthesis, modification and configuration of pegRNAs: (1) Hsu JY, Grünewald J, SzalayR, Shih J, Anzalone AV, Lam KC, Shen MW, Petri K, Liu DR, Joung JK, PinelloL. PrimeDesign software for rapid and simplified design of prime editingguide RNAs. Nat Commun. 15 Feb 2021;12(1):1034. doi: 10.1038 / s41467-021-21337-7. PMID: 33589617; PMCID: PMC7884779;(2) Li Y, Chen J, Tsai SQ, ChengY. Easy-Prime: a machine learning-based prime editor design tool. GenomeBiol. 2021 Aug 19;22(1):235. doi: 10.1186 / s13059-021-02458-0. PMID: 34412673; PMCID: PMC8377858; (3) Zhang W, Petri K, Ma J, Lee H, Tsai CL, JoungJK, Yeh JJ. Enhancing CRISPR prime editing by reducing misfolded pegRNAinteractions. bioRxiv [Preprint]. August 15, 2023: 2023.08.14.553324. doi:10.1101 / 2023.08.14.553324. PMID: 37645936; PMCID: PMC10462064; (4) Jin S, LinQ, Gao Q, Gao C. Optimized prime editing in monocot plants usingPlantPegDesigner and engineered plant prime editors (ePPEs). Nat Protoc. 2023 Mar;18(3):831-853. doi: 10.1038 / s41596-022-00773-9. Electronic version November 25, 2022. PMID: 36434096;(5) Lin Q, Jin S, Zong Y, Yu H, Zhu Z, Liu G, Kou L, Wang Y, Qiu JL, Li J, Gao C. High-efficiency prime editing with optimized, pairedpegRNAs in plants. Nat Biotechnol. Aug 2021;39(8):923-927. doi: 10.1038 / s41587-021-00868-w. Electronic version March 25, 2021. PMID: 33767395;(6) Standage-Beier K, Tekel SJ, Brafman DA, Wang X. Prime Editing Guide RNA Design Automation Using PINE-CONE. ACS Synth Biol. February 19, 2021; 10(2):422-427. doi: 10.1021 / acssynbio.0c00445. Electronic version January 19, 2021. PMID: 33464043; PMCID: PMC7901017;(7)Zhang W, Petri K, Ma J, Lee H, Tsai CL, Joung JK, Yeh JJ.Enhancing CRISPRprime editing by reducing misfolded pegRNA interactions. bioRxiv [Preprint]. August 15, 2023:2023.08.14.553324. doi: 10.1101 / 2023.08.14.553324. PMID:37645936; PMCID: PMC10462064;(8)Chow RD, Chen JS, Shen J, Chen S. A web tool for the design of prime-editing guide RNAs. Nat Biomed Eng. Feb. 2021;5(2):190-194. doi: 10.1038 / s41551-020-00622-8. Electronic version September 28, 2020.PMID:32989284; PMCID: PMC7882013; Each of the references mentioned above is incorporated herein by reference in its entirety.

[0051] You may also refer to the following commercial vendors who sell guide RNA for CRISPR editing applications (including base editing and major editing) and provide various tools and instructions on the sequencing, design, synthesis, modification, and configuration of guide RNA: GENSCRIPT, SYNTHEGO, TAKARA BIO, INTEGRATED DNA TECHNOLOGIES, LC SCIENCES, HORIZON DISCOVERY; SIGMA-ALDRICH; ORIGENE and TWIST BIOSCIENCES, etc.

[0052] Additionally, guide RNA can be modified with chemical and / or structural modifications to enhance its various properties, including specificity, stability, and limitation of off-target activity. Those skilled in the art will be able to modify guide RNA with any known modifications without excessive experimentation. The following references discuss guide modifications: (1) Ke Y, Ghalandari B, Huang S, Li S, Huang C, Zhi X, Cui D, Ding X. 2'-O-Methyl modified guide RNA promotes the single nucleotide polymorphism (SNP) discrimination ability of CRISPR-Cas12a systems. Chem Sci. Feb 1, 2022;13(7):2050-2061. doi: 10.1039 / d1sc06832f. PMID: 35308857; PMCID: PMC8848812;(2) Allen D, Rosenberg M, Hendel A. Using Synthetically Engineered Guide RNAs to Enhance CRISPR Genome Editing Systems in Mammalian Cells. Front Genome Ed. Jan 28, 2021;2:617910. doi: 10.3389 / fgeed.2020.617910. PMID: 34713240; PMCID: PMC8525374; (3) BasilaM, Kelley ML, Smith AVB. Minimal 2'-O-methyl phosphorothioate linkagemodification pattern of synthetic guide RNAs for increased stability and efficient CRISPR-Cas9 gene editing avoiding cellular toxicity. PLoS One. 2017 Nov 27;12(11):e0188593. doi: 10.1371 / journal.pone.0188593.PMID:29176845; PMCID: PMC5703482(4) Sakovina L, Vokhtantsev I, Vorobyeva M,Vorobyev P, Novopashina D. Improving Stability and Specificity of CRISPR / Cas9System by Selective Modification of Guide RNAs with 2'-Fluoro and LockedNucleic Acid Nucleotides. Int J Mol Sci. 2022 / 11 / 3;23(21):13460. doi:10.3390 / ijms232113460. PMID: 36362256; PMCID: PMC9655745(5) Shapiro J, TovinA, Iancu O, Allen D, Hendel A. Chemical Modification of Guide RNAs forImproved CRISPR Activity in CD34+ Human Hematopoietic Stem and ProgenitorCells. Methods Mol Biol.2021;2162:37–48. doi: 10.1007 / 978-1-0716-0687-2_3.PMID: 329263766(6) Filippova J, Matveeva A, Zhuravlev E, Stepanov G. GuideRNA modification as a way to improve CRISPR / Cas9-based genome-editingsystems. Biochemistry. Dec 2019;167:49-60. doi: 10.1016 / j.biochi.2019.09.003. PMID: 31493470;(7) Hendel A, Bak RO, Clark JT, KennedyAB, Ryan DE, Roy S, Steinfeld I, Lunstad BD, Kaiser RJ, Wilkens AB, BacchettaR, Tsalenko A, Dellinger D, Bruhn L, Porteus MH.Chemically modified guideRNAs enhance CRISPR-Cas genome editing in human primary cells. NatBiotechnol. 2015 Sep;33(9):985-989. doi: 10.1038 / nbt.3290. Electronic version June 29, 2015. PMID: 26121415; PMCID: PMC4729442; (8)_ Ryan DE, Taussig D, Steinfeld I,Phadnis SM, Lunstad BD, Singh M, Vuong January 25, 2018; 46(2):792-803. doi: 10.1093 / nar / gkx1199. Errata: Nucleic Acids Res. March 21, 2022; 50(5):2986. PMID: 29216382; PMCID:PMC5778453;(9) Palumbo CM, Gutierrez-Bujari JM, O'Geen H, Segal DJ, Beal PA. Versatile 3' Functionalization of CRISPR Single Guide RNA. Chembiochem. June 2, 2020; 21(11):1633-1640. doi: 10.1002 / cbic.201900736. Electronic version March 5, 2020. PMID: 31943634; PMCID: PMC7323579; (10) Mullally G, van Aelst K, Naqvi MM, Diffin FM, Karvelis T, Gasiunas G, Siksnys V, Szczelkun MD.5' modifications to CRISPR-Cas9 gRNA can change the dynamics and size of R-loops and inhibit DNA cleavage. Nucleic Acids Res. 2020 July 9;48(12):6811-6823. doi: 10.1093 / nar / gkaa477. PMID: 32496535; PMCID: PMC7337959;(12) Lu S, Zhang Y, Yin H. Chimeric DNA-RNA Guide RNA Designs. Methods Mol Biol.2021;2162:79-85. doi:10.1007 / 978-1-0716-0687-2_6. PMID: 32926379;Each of the references cited is incorporated herein by reference in its entirety.

[0053] In specific cases of lead editing, pegRNAs can be modified with chemical and / or structural modifications to enhance their various properties, including specificity, stability, and limitation of off-target activity. Those skilled in the art will be able to modify pegRNAs for lead editing with any known modifications without excessive experimentation. The following references discuss pegRNA modification: (1) Nelson JW, Randolph PB, Shen SP, Everette KA, Chen PJ, Anzalone AV, An M, Newby GA, Chen JC, Hsu A, Liu DR. Engineered pegRNAs improve prime editing efficiency. Nat Biotechnol. Mar 2022;40(3):402-410. doi: 10.1038 / s41587-021-01039-7. Electronic version October 4, 2021. Errata: Nat Biotechnol. Dec 8, 2021; PMID:34608327; PMCID: PMC8930418; (2) Liu B, Dong X, Cheng H, Zheng C, Chen Z, Rodríguez TC, Liang SQ, Xue W, Sontheimer EJ. A split prime Editor with untethered reverse transcriptase and circular RNA template. Nat Biotechnol. Sep 2022;40(9):1388-1393. doi: 10.1038 / s41587-022-01255-9. Electronic version April 4, 2022. PMID: 35379962; Each of the references mentioned above is incorporated herein by reference in its entirety.

[0054] Depending on the requirements and / or properties of the gene editing system and the homologous nucleic acid programmable protein, additional specialized guide RNAs may be included. For example, the TnpB enzyme requires a specialized guide RNA called reRNA. Furthermore, depending on the requirements of the programmable nuclease, the guide RNA may have different characteristics (e.g., PAM preference, spacer length, and scaffold portion that binds to the nuclease protein).

[0055] The gene editing systems considered in this paper can introduce a variety of changes, including (A) changes in the sequence of the target nucleic acid molecule, such as, but not limited to (i) nucleobase substitution (e.g., purine substitution for pyrimidine), (ii) deletion of one or more nucleobases, (iii) insertion of one or more nucleobases, (iv) a combination of deletion and insertion of one or more nucleobases, (v) inversion of nucleobase sequence, (vi) translocation of nucleobase sequence, and (vii) a combination of two or more such modifications, and (B) one or more modifications to the epigenome to produce an effect on gene expression without altering the sequence of the nucleic acid molecule, wherein the epigenetic changes lead to alterations in gene expression by changing chromatin structure or accessibility.

[0056] The LNP compositions and / or gene editing systems described herein may comprise various coding RNA molecules that encode various components of a gene editor. In various embodiments, the coding RNA may be linear mRNA. In other embodiments, the coding RNA may be circular mRNA. In various embodiments, the improved LNP protects linear and / or circular mRNA cargo from degradation and clearance while enabling targeted systemic or local delivery for use as an enhanced gene editing platform and / or therapeutic agent.

[0057] In various other respects, the LNP compositions and / or gene editing systems described herein may also include a repair template, such as a homology-guided repair (HDR)-dependent repair template (or HDR template). Such HDR templates are well known in the art and may comprise single-stranded or double-stranded DNA (e.g., oligonucleotides) or RNA. Further information on HDR and HDR templates for editing systems used in various applications (such as gene knock-in) can be found in Fu YW, Dai XY, Wang WT, Yang ZX, Zhao JJ, Zhang JP, Wen W, Zhang F, Oberg KC, Zhang L, Cheng T, Zhang XB. Dynamics and competition of CRISPR-Cas9 ribonucleoproteins and AAV donor-mediated NHEJ, MMEJ and HDR editing. Nucleic Acids Res. 2021 Jan 25;49(2):969-985. doi: 10.1093 / nar / gkaa1251. PMID: 33398341; PMCID: PMC7826255;Iyer S, Mir A, Vega-Badillo J, Roscoe BP, Ibraheim R, Zhu LJ, Lee J, Liu P, Luk K, Mintzer E, Guo D, Soares de Brito J, Emerson CP Jr, Zamore PD, Sontheimer EJ, Wolfe SA. Efficient Homology-Directed Repair with Circular Single-Stranded DNA Donors. CRISPR J. Oct 2022;5(5):685-701. doi: 10.1089 / crispr.2022.0058. e.g. Sep 7, 2022. PMID: 36070530; PMCID: PMC9595650; and Richardson CD, RayGJ, DeWitt MA, Curie GL, Corn JE.Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. Mar 2016;34(3):339-44. doi: 10.1038 / nbt.3481. Electronic version January 20, 2016. PMID: 26789497. Each of the references mentioned is incorporated herein by reference in its entirety.

[0058] Therefore, this specification describes compositions, methods, processes, kits, and devices for selecting, designing, preparing, manufacturing, formulating, and / or using LNP-based gene editing systems as therapeutic compositions. Further described herein are compositions, methods, processes, kits, and devices for selecting, designing, preparing, manufacturing, formulating, and / or using LNP-based RNA gene editing therapeutics for the prophylactic and / or therapeutic treatment of one or more diseases or their symptoms. Components that can be encapsulated or otherwise incorporated into the LNPs described herein may be referred to as LNP “payloads” and may include all of the aforementioned biological materials, including DNA molecules, RNA molecules (coding and / or non-coding), proteins, and nucleoproteins (e.g., Cas / guide RNA complexes).

[0059] II. LNP Delivery System

[0060] The RNA payloads described herein (e.g., linear and circular mRNAs) can be encapsulated and delivered via lipid nanoparticles (LNPs) and compositions and / or formulations containing RNA-encapsulated LNPs.

[0061] The following describes the LNPs that can be used as RNA payload delivery mediators considered herein, as well as various ionizable lipids, structural lipids, PEGylated lipids, and phospholipids that can be used to manufacture the LNPs described herein for delivering RNA payloads to cells. Additionally, further LNP components considered, such as targeting portions and other lipid components, are described below.

[0062] A. Lipid nanoparticle composition

[0063] In one aspect, this disclosure further provides delivery systems for delivering the therapeutic payloads disclosed herein (e.g., RNA payloads described herein that may encode peptides of interest, such as antigens or therapeutic proteins). In some embodiments, delivery systems suitable for delivering the therapeutic payloads disclosed herein comprise lipid nanoparticle (LNP) formulations.

[0064] In some embodiments, the LNP of this disclosure comprises ionizable lipids, structural lipids, polyethylene glycol-modified lipids (also known as PEG lipids), and phospholipids. In alternative embodiments, the LNP comprises ionizable lipids, structural lipids, polyethylene glycol-modified lipids (also known as PEG lipids), and zwitterionic amino acid lipids. In some embodiments, the LNP further comprises a fifth lipid in addition to any of the aforementioned lipid components. In some embodiments, the LNP encapsulates one or more elements of the active agent of this disclosure. In some embodiments, the LNP further comprises a targeting portion covalently or non-covalently bound to the outer surface of the LNP. In some embodiments, the targeting portion is a targeting portion that binds to cells of a specific organ system or otherwise promotes cellular uptake by cells of a specific organ system.

[0065] In some embodiments, the diameter of the LNP is at least about 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, or 90 nm. In some embodiments, the diameter of the LNP is less than about 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, or 160 nm. In some embodiments, the diameter of the LNP is less than about 120 nm. In some embodiments, the diameter of the LNP is less than about 100 nm. In some embodiments, the diameter of the LNP is less than about 90 nm. In some embodiments, the diameter of the LNP is less than about 80 nm. In some embodiments, the diameter of the LNP is about 60-100 nm. In some embodiments, the diameter of the LNP is about 50-120 nm. In some embodiments, the diameter of the LNP is about 75-80 nm.

[0066] In some embodiments, the lipid nanoparticle compositions of this disclosure are described according to the corresponding molar ratio of the component lipids in the formulation. As a non-limiting example, the mol-% of ionizable lipids can be from about 10 mol-% to about 80 mol-%. As a non-limiting example, the mol-% of ionizable lipids can be from about 20 mol-% to about 70 mol-%. As a non-limiting example, the mol-% of ionizable lipids can be from about 30 mol-% to about 60 mol-%. As a non-limiting example, the mol-% of ionizable lipids can be from about 35 mol-% to about 55 mol-%. As a non-limiting example, the mol-% of ionizable lipids can be from about 40 mol-% to about 50 mol-%. As a non-limiting example, the mol-% of ionizable lipids can be from about 30 mol-% to about 40 mol-%. As a non-limiting example, the mol-% of ionizable lipids can be from about 25 mol-% to about 35 mol-%. In some embodiments, the mol% of ionizable lipids is about 10 mol%. In some embodiments, the mol% of ionizable lipids is about 15 mol%. In some embodiments, the mol% of ionizable lipids is about 20 mol%. In some embodiments, the mol% of ionizable lipids is about 25 mol%. In some embodiments, the mol% of ionizable lipids is about 30 mol%. In some embodiments, the mol% of ionizable lipids is about 33 mol%. In some embodiments, the mol% of ionizable lipids is about 35 mol%. In some embodiments, the mol% of ionizable lipids is about 40 mol%. In some embodiments, the mol% of ionizable lipids is about 45 mol%. In some embodiments, the mol% of ionizable lipids is about 55 mol%. In some embodiments, the mol% of ionizable lipids is about 60 mol%.

[0067] In some embodiments, the mol% of phospholipids can be from about 1 mol% to about 50 mol%. In some embodiments, the mol% of phospholipids can be from about 2 mol% to about 45 mol%. In some embodiments, the mol% of phospholipids can be from about 3 mol% to about 40 mol%. In some embodiments, the mol% of phospholipids can be from about 4 mol% to about 35 mol%. In some embodiments, the mol% of phospholipids can be from about 5 mol% to about 30 mol%. In some embodiments, the mol% of phospholipids can be from about 10 mol% to about 20 mol%. In some embodiments, the mol% of phospholipids can be from about 5 mol% to about 20 mol%. In some embodiments, the mol% of phospholipids can be from about 30 mol% to about 60 mol%. In some embodiments, the mol% of phospholipids can be from about 35 mol% to about 55 mol%. In some embodiments, the phospholipid has a mol% concentration of about 35 mol% to about 45 mol%. In some embodiments, the phospholipid has a mol% concentration of about 10 mol%. In some embodiments, the phospholipid has a mol% concentration of about 15 mol%. In some embodiments, the phospholipid has a mol% concentration of about 20 mol%. In some embodiments, the phospholipid has a mol% concentration of about 25 mol%. In some embodiments, the phospholipid has a mol% concentration of about 30 mol%. In some embodiments, the phospholipid has a mol% concentration of about 35 mol%. In some embodiments, the phospholipid has a mol% concentration of about 40 mol%. In some embodiments, the phospholipid has a mol% concentration of about 45 mol%. In some embodiments, the phospholipid has a mol% concentration of about 55 mol%. In some embodiments, the phospholipid has a mol% concentration of about 60 mol%.

[0068] In some embodiments, the mol-% of phospholipids as described above includes two or more phospholipids, each in mol-% totaling the aforementioned amount. In some embodiments, the mol-% of phospholipids is about 20 mol-% of each of the two phospholipids. In some embodiments, the mol-% of phospholipids is about 15 mol-% of each of the two phospholipids. In some embodiments, the mol-% of phospholipids is about 25 mol-% of each of the two phospholipids. In some embodiments, the mol-% of phospholipids is about 30 mol-% of each of the two phospholipids. In some embodiments, the mol-% of phospholipids is about 15 mol-% of the first phospholipid and about 20 mol-% of the second phospholipid. In some embodiments, the mol-% of phospholipids is about 30 mol-% of the first phospholipid and about 10 mol-% of the second phospholipid. In some embodiments, the mol-% of phospholipids is about 25 mol-% of the first phospholipid and about 10 mol-% of the second phospholipid. In some embodiments, the mol-% of phospholipids is about 25 mol-% of the first phospholipid and about 20 mol-% of the second phospholipid. In some embodiments, the mol-% of phospholipids is about 15 mol-% of the first phospholipid and about 20 mol-% of the second phospholipid.

[0069] In some embodiments, the mol-% of structural lipids can be from about 10 mol-% to about 80 mol-%. In some embodiments, the mol-% of structural lipids can be from about 20 mol-% to about 70 mol-%. In some embodiments, the mol-% of structural lipids can be from about 30 mol-% to about 60 mol-%. In some embodiments, the mol-% of structural lipids can be from about 35 mol-% to about 55 mol-%. In some embodiments, the mol-% of structural lipids can be from about 40 mol-% to about 50 mol-%.

[0070] In some embodiments, the mol-% of PEG lipids can be from about 0.1 mol-% to about 10 mol-%. In some embodiments, the mol-% of PEG lipids can be from about 0.2 mol-% to about 5 mol-%. In some embodiments, the mol-% of PEG lipids can be from about 0.5 mol-% to about 3 mol-%. In some embodiments, the mol-% of PEG lipids can be from about 1 mol-% to about 2 mol-%. In some embodiments, the mol-% of PEG lipids can be from about 1.5 mol-%. In some embodiments, the mol-% of PEG lipids can be from about 2.5 mol-%. In some embodiments, the mol-% of PEG lipids can be from about 3 mol-%. In some embodiments, the mol-% of PEG lipids can be from about 3.5 mol-%.

[0071] In the context of "mol-%" or "mol %" mentioned above, the amount of LNP component indicated is intended to be in mol relative to the total lipid component content of the lipid nanoparticles.

[0072] i. Ionizable lipids

[0073] In some embodiments, the LNP disclosed herein comprises ionizable lipids. In some embodiments, the LNP comprises two or more ionizable lipids.

[0074] The following describes a variety of exemplary ionizable lipids of this disclosure.

[0075] Formula (CT)

[0076] In some embodiments, the lipids of this disclosure have a structure of formula (CT).

[0077]

[0078] (CT),

[0079] Or its pharmaceutically acceptable salt, wherein:

[0080] i) A is N; Z is a bond. , , , , , , , , , or The keys marked with "*" are attached to X. 1 ;X 1 It is an optionally substituted C1-C6 aliphatic; and R 1 Choose from the following groups: -OH, -OAc, -NR2,

[0081] , , , , , , , , , and ;or

[0082] ii) A is CH;

[0083] Z is , , , , , , , , , or The keys marked with "*" are attached to X. 1 ;

[0084] X 1 It is a C1-C6 aliphatic compound with a bond or optional substitution;

[0085] R 1 Choose from the following groups: -OH, -OAc, -NR2,

[0086] , , , , , , , , , and ;

[0087] Each R is independently -H or C1-C6 aliphatic;

[0088] X 2 and X 3 Each of the C1-Cs can be substituted independently and optionally. 12 Aliphatic;

[0089] Y 1 and Y 2 Choose independently from the following groups:

[0090] , , , , , , and ;

[0091] The key marked with "*" is attached to Y. 1 X 2 Or Y 2 X 3 ;

[0092] R 2 It is a C1-C6 aliphatic compound with a bond or optional substitution;

[0093] R 3 It is a C1-C6 aliphatic compound with a bond or optional substitution;

[0094] R 4 It is -CH(OR) 6 (OR) 7 -CH(SR) 6 (SR) 7 ), -CH(R 6 (R) 7 ) or optionally replace C1-C 14 Aliphatic, wherein one or more methylene groups are linked to C3-C8 cycloalkyl groups, each optionally and independently substituted, or to substituted bridging bicyclic or polycyclic C5-C groups. 14 Replacement with cycloalkylene, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-;

[0095] R 5 It is -CH(OR) 8 (OR) 9 -CH(SR) 8 (SR) 9 ), -CH(R 8 (R) 9 -R8 or optionally replaced by -C1-C6 aliphatic -R 8 ;

[0096] R 6 and R 7 Each of the C1-Cs can be substituted independently and optionally. 14 Aliphatic, wherein one or more methylene groups are linked to C3-C8 cycloalkyl groups, each optionally and independently substituted, or to substituted bridging bicyclic or polycyclic C5-C groups. 14 Replacement with cycloalkylene, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-;

[0097] R 8 It is the optional substitution of C1-C 14 Aliphatic, wherein at least one methylene bond is replaced by an optionally substituted divalent group, the structure of which is selected from...

[0098] , , , , , , , , , , , , , , , and ;and

[0099] R 9 It is the optional substitution of C1-C 14 Aliphatic, wherein one or more methylene groups are linked to C3-C8 cycloalkyl groups, each optionally and independently substituted, or to substituted bridging bicyclic or polycyclic C5-C groups. 14 Replacement with cycloalkylene, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-.

[0100] Formula (CT')

[0101] In some embodiments, the lipids of this disclosure have a structure of formula (CT').

[0102]

[0103] (CT'),

[0104] Or a pharmaceutically acceptable salt thereof, wherein R, X 1 Z, X 2 X 3 Y 1 Y 2 R 2 R 3 R 4 R 5 R 6 R 7 R 8 and R 9 As described in Formula (CT) or in any of the embodiments described below;

[0105] i) A is N; Z is a bond. , , , , , , , , , or The keys marked with "*" are attached to X. 1 ;X 1It is an optional C1-C6 aliphatic group;

[0106] ii) A is CR; Z is , , , , , , , , , or The keys marked with "*" are attached to X. 1 ;

[0107] R 1 Choose from the following groups: -OH, -OAc, -NR2,

[0108] , , , , , , , , , , , , , , , , , , , , , and ;

[0109] R Z It is NR2 or OH; and

[0110] X 4 It is an optional substitution of C2-C 14 Alkylene or optionally substituted C2-C 14 Alkenyl group.

[0111] Formula (CT-A)

[0112] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-A):

[0113]

[0114] (CT-A),

[0115] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 Z, X 2 X 3 X 4 R Z Y 1 Y 2 R 2 R 3 R 4 R 5 R 6 R 7 R 8 and R 9 As described in Formula (CT) or any of the embodiments described below.

[0116] Formula (CT-A1)

[0117] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-A1):

[0118]

[0119] (CT-A1),

[0120] Or its pharmaceutically acceptable salt, wherein

[0121] Z is or The keys marked with "*" are attached to X. 1 ;

[0122] Y 1 and Y 2 Choose independently from the following groups:

[0123] , , , , and ;

[0124] The key marked with "*" is attached to Y. 1 R 2 Or Y 2 R 3 ;and

[0125] R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R3 R 4 R 5 R 6 R 7 R 8 and R 9 As described in Formula (CT) or any of the embodiments described below.

[0126] Formula (CT-A2)

[0127] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-A2):

[0128]

[0129] (CT-A2),

[0130] Or its pharmaceutically acceptable salt, wherein

[0131] Z is or The keys marked with "*" are attached to X. 1 ;

[0132] Y 1 and Y 2 Each for themselves The key marked with "*" is attached to Y. 1 R 2 Or Y 2 R 3 ;and

[0133] R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 4 R 5 R 6 R 7 R 8 and R 9 As described in Formula (CT) or any of the embodiments described below.

[0134] Formula (CT-B)

[0135] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-B):

[0136]

[0137] (CT-B),

[0138] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 Z, X 2 X 3 X 4 R Z R 2 R 3 R 4 R 5 R 6 R 7 R 8 and R 9 As described in Formula (CT) or any of the embodiments described below.

[0139] Formula (CT-B')

[0140] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-B'):

[0141]

[0142] (CT-B'),

[0143] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 Z, X 2 X 3 X 4 R Z R 2 R 3 R 4 R 5 R 6 R 7 R 8 and R 9 As described in Formula (CT) or any of the embodiments described below.

[0144] Formula (CT-C)

[0145] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-C):

[0146]

[0147] (CT-C),

[0148] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X1 X 2 X 3 X 4 R Z Y 1 Y 2 R 2 R 3 R 4 R 5 R 6 R 7 R 8 and R 9 As described in Formula (CT) or any of the embodiments described below.

[0149] Formula (CT-D)

[0150] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-D):

[0151]

[0152] (CT-D),

[0153] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 4 R 5 R 6 R 7 R 8 and R 9 As described in Formula (CT) or any of the embodiments described below.

[0154] Formula (CT-D')

[0155] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-D'):

[0156]

[0157] (CT-D'),

[0158] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 RZ R 2 R 3 R 4 R 5 R 6 R 7 R 8 and R 9 As described in Formula (CT) or any of the embodiments described below.

[0159] Formula (CT-E)

[0160] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-E):

[0161]

[0162] (CT-E),

[0163] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 Z, X 2 X 3 X 4 R Z Y 1 Y 2 R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0164] Formula (CT-E')

[0165] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-E'):

[0166]

[0167] (CT-E'),

[0168] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 Z, X 2 X 3 X 4 R Z Y 1 Y 2 R 2 R 3 R 6 R 7and R 8 As described in Formula (CT) or any of the embodiments described below.

[0169] Formula (CT-E'')

[0170] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-E''):

[0171]

[0172] (CT-E'')

[0173] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 Z, X 2 X 3 X 4 R Z Y 1 Y 2 R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0174] Formula (CT-F)

[0175] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-F):

[0176]

[0177] (CT-F),

[0178] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 Z, X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0179] Formula (CT-F')

[0180] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-F'):

[0181]

[0182] (CT-F'),

[0183] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 Z, X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0184] Formula (CT-F'')

[0185] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-F''):

[0186]

[0187] (CT-F''),

[0188] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 Z, X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0189] Formula (CT-F''')

[0190] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-F'''):

[0191]

[0192] (CT-F'''),

[0193] Or a pharmaceutically acceptable salt thereof, wherein R1 , R, X 1 Z, X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0194] Formula (CT-F)

[0195] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-F''''):

[0196]

[0197] (CT-F'''')

[0198] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 Z, X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0199] Formula (CT-F)

[0200] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-F'''''):

[0201]

[0202] (CT-F''''')

[0203] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 Z, X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R8 As described in Formula (CT) or any of the embodiments described below.

[0204] Formula (CT-G)

[0205] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-G):

[0206]

[0207] (CT-G),

[0208] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 Y 1 Y 2 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0209] Formula (CT-G')

[0210] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-G'):

[0211]

[0212] (CT-G'),

[0213] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 Y 1 Y 2 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0214] Formula (CT-G'')

[0215] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-G''):

[0216]

[0217] (CT-G''),

[0218] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 Y 1 Y 2 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0219] Formula (CT-H)

[0220] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-H):

[0221]

[0222] (CT-H),

[0223] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0224] Formula (CT-H')

[0225] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-H'):

[0226]

[0227] (CT-H'),

[0228] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0229] Formula (CT-H'')

[0230] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-H''):

[0231]

[0232] (CT-H''),

[0233] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0234] Formula (CT-H''')

[0235] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-H'''):

[0236]

[0237] (CT-H'''),

[0238] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R8 As described in Formula (CT) or any of the embodiments described below.

[0239] Formula (CT-H)

[0240] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-H''''):

[0241]

[0242] (CT-H''''),

[0243] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0244] Formula (CT-H)

[0245] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-H).

[0246]

[0247] (CT-H'''''),

[0248] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0249] Formula (CT-I)

[0250] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-I):

[0251]

[0252] (CT-I),

[0253] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z Y 1 Y 2 R 2 R 3 R 4 R 5 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0254] Formula (CT-J)

[0255] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-J):

[0256]

[0257] (CT-J),

[0258] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 4 R 5 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0259] Formula (CT-J')

[0260] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-J'):

[0261]

[0262] (CT-J'),

[0263] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 4 R 5 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0264] Formula (CT-K)

[0265] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-K):

[0266]

[0267] (CT-K),

[0268] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 Y 1 Y 2 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0269] Formula (CT-K')

[0270] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-K'):

[0271]

[0272] (CT-K'),

[0273] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 Y 1 Y 2 X 4R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0274] Formula (CT-K'')

[0275] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-K''):

[0276]

[0277] (CT-K''),

[0278] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 Y 1 Y 2 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0279] Formula (CT-L)

[0280] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-L):

[0281]

[0282] (CT-L),

[0283] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0284] Formula (CT-L')

[0285] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-L'):

[0286]

[0287] (CT-L'),

[0288] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0289] Formula (CT-L'')

[0290] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-L''):

[0291]

[0292] (CT-L''),

[0293] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0294] Formula (CT-L''')

[0295] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-L'''):

[0296]

[0297] (CT-L'''),

[0298] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0299] Formula (CT-L'''')

[0300] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-L''''):

[0301]

[0302] (CT-L'''')

[0303] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0304] Formula (CT-L)

[0305] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-L'''''):

[0306]

[0307] (CT-L''''')

[0308] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0309] Formula (CT-M)

[0310] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-M):

[0311]

[0312] (CT-M),

[0313] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 2 X 3 X 4 R Z Y 1 Y 2 R 2 R 3 R 4 R 5 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0314] Formula (CT-N)

[0315] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-N):

[0316]

[0317] (CT-N),

[0318] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 4 R 5 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0319] Formula (CT-N')

[0320] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-N'):

[0321]

[0322] (CT-N'),

[0323] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 4 R 5 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0324] Formula (CT-O)

[0325] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-O):

[0326]

[0327] (CT-O),

[0328] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 Y 1 Y 2 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0329] Formula (CT-O')

[0330] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-O'):

[0331]

[0332] (CT-O'),

[0333] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 Y 1 Y 2 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0334] Formula (CT-O'')

[0335] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-O''):

[0336]

[0337] (CT-O''),

[0338] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 Y 1 Y 2 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0339] Formula (CT-P)

[0340] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-P):

[0341]

[0342] (CT-P),

[0343] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0344] Formula (CT-P')

[0345] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-P'):

[0346]

[0347] (CT-P'),

[0348] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0349] Formula (CT-P'')

[0350] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-P''):

[0351]

[0352] (CT-P''),

[0353] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0354] Formula (CT-P''')

[0355] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-P'''):

[0356]

[0357] (CT-P'''),

[0358] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0359] Formula (CT-P)

[0360] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-P''''):

[0361]

[0362] (CT-P'''')

[0363] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0364] Formula (CT-P)

[0365] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-P'''''):

[0366]

[0367] (CT-P''''')

[0368] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0369] Formula (CT-Q)

[0370] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-Q):

[0371]

[0372] (CT-Q),

[0373] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z Y 1 Y 2 R 2 R 3 R 4 R 5 R 6 R 7 R 8 and R 9 As described in Formula (CT) or any of the embodiments described below.

[0374] Formula (CT-Q1)

[0375] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-Q1):

[0376]

[0377] (CT-Q1),

[0378] Or its pharmaceutically acceptable salt, wherein

[0379] Y 1 and Y 2 Choose independently from the following groups:

[0380] , , , , and ;

[0381] The key marked with "*" is attached to Y. 1 R 2 Or Y 2 R 3 ;and

[0382] R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 4 R 5 R 6 R 7 R 8 and R 9 As described in Formula (CT) or any of the embodiments described below.

[0383] Formula (CT-R)

[0384] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-R):

[0385]

[0386] (CT-R),

[0387] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 4 R 5 R 6 R 7 R 8 and R 9 As described in Formula (CT) or any of the embodiments described below.

[0388] Formula (CT-R')

[0389] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-R'):

[0390]

[0391] (CT-R'),

[0392] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 4 R 5 R 6 R 7 R 8 and R 9 As described in Formula (CT) or any of the embodiments described below.

[0393] Formula (CT-S)

[0394] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-S):

[0395]

[0396] (CT-S),

[0397] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z Y 1 Y 2 R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0398] Formula (CT-S')

[0399] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-S'):

[0400]

[0401] (CT-S'),

[0402] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z Y 1 Y 2 R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0403] Formula (CT-S'')

[0404] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-S''):

[0405]

[0406] (CT-S''),

[0407] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z Y 1 Y 2 R 2 R 3 R 6 R 7 R 8 and R 9 As described in Formula (CT) or any of the embodiments described below.

[0408] Formula (CT-T)

[0409] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-T):

[0410]

[0411] (CT-T),

[0412] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0413] Formula (CT-T')

[0414] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-T'):

[0415]

[0416] (CT-T'),

[0417] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0418] Formula (CT-T'')

[0419] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-T''):

[0420]

[0421] (CT-T''),

[0422] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0423] Formula (CT-T''')

[0424] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-T'''):

[0425]

[0426] (CT-T'''),

[0427] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0428] Formula (CT-T'''')

[0429] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-T''''):

[0430]

[0431] (CT-T''''),

[0432] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0433] Formula (CT-T)

[0434] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-T'''''):

[0435]

[0436] (CT-T''''')

[0437] Or a pharmaceutically acceptable salt thereof, wherein R 1 , R, X 1 X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0438] Formula (CT-U)

[0439] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-U):

[0440]

[0441] (CT-U),

[0442] Or a pharmaceutically acceptable salt thereof, wherein X 1 X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0443] Formula (CT-U')

[0444] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-U'):

[0445]

[0446] (CT-U'),

[0447] Or a pharmaceutically acceptable salt thereof, wherein X 1 X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8As described in Formula (CT) or any of the embodiments described below.

[0448] Formula (CT-U'')

[0449] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-U''):

[0450]

[0451] (CT-U''),

[0452] Or a pharmaceutically acceptable salt thereof, wherein X 1 X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0453] Formula (CT-U''')

[0454] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-U'''):

[0455]

[0456] (CT-U'''),

[0457] Or a pharmaceutically acceptable salt thereof, wherein X 1 X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0458] Formula (CT-U'''')

[0459] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-U''''):

[0460]

[0461] (CT-U''''),

[0462] Or a pharmaceutically acceptable salt thereof, wherein X 1 X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0463] Formula (CT-U)

[0464] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-U'''''):

[0465]

[0466] (CT-U'''''),

[0467] Or a pharmaceutically acceptable salt thereof, wherein X 1 X 2 X 3 X 4 R Z R 2 R 3 R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0468] Formula (CT-V)

[0469] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-V):

[0470]

[0471] (CT-V),

[0472] Or a pharmaceutically acceptable salt thereof, wherein X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8As described in Formula (CT) or any of the embodiments described below.

[0473] Formula (CT-V')

[0474] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-V'):

[0475]

[0476] (CT-V'),

[0477] Or a pharmaceutically acceptable salt thereof, wherein X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0478] Formula (CT-V'')

[0479] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-V''):

[0480]

[0481] (CT-V''),

[0482] Or a pharmaceutically acceptable salt thereof, wherein X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0483] Formula (CT-V''')

[0484] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-V'''):

[0485]

[0486] (CT-V'''),

[0487] Or a pharmaceutically acceptable salt thereof, wherein X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0488] Formula (CT-V)

[0489] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-V''''):

[0490]

[0491] (CT-V'''')

[0492] Or a pharmaceutically acceptable salt thereof, wherein X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8 As described in Formula (CT) or any of the embodiments described below.

[0493] Formula (CT-V)

[0494] In some embodiments, the lipids of this disclosure have a structure of formula (CT), wherein the lipids of this disclosure have a structure of formula (CT-V''''):

[0495]

[0496] (CT-V''),

[0497] Or a pharmaceutically acceptable salt thereof, wherein X 1 X 2 X 3 R 2 R 3 X 4 R Z R 6 R 7 and R 8As described in Formula (CT) or any of the embodiments described below.

[0498] A

[0499] As disclosed in formula (CT), in some embodiments, A is CH or N. In some embodiments, A is CH. In some embodiments, A is N. As disclosed in formula (CT'), in some embodiments, A is CR, where R is -H or C1-C6 aliphatic.

[0500] Z

[0501] As disclosed in Formula (CT), in some embodiments, Z is

[0502] , , , , , , , , , or The keys marked with "*" are attached to X. 1 。 In some implementations, Z is , , , , , , , or In some implementations, Z is or In some implementations, Z is In some implementations, Z is In some implementations, Z is In some implementations, Z is In some implementations, Z is In some implementations, Z is In some implementations, Z is In some implementations, Z is In some implementations, Z is In some implementations, Z is In some implementations, Z is As disclosed in formula (CT), in some embodiments, A is N and Z is a bond.

[0503] X 1

[0504] As disclosed in Formula (CT), in some embodiments, where A is N, X 1 It is an optionally substituted C1-C6 aliphatic compound. In some embodiments, where A is N, X 1 It is an unsubstituted C1-C6 aliphatic compound. In some implementations, X 1 It is an optionally substituted C1-C6 alkylene group. In some embodiments, X 1 It is an unsubstituted C1-C6 alkylene group. In some embodiments, X 1 It is an unsubstituted C2-C6 alkylene group. In some embodiments, X 1 It is an optionally substituted methylene group. In some embodiments, R 2 It is an optionally substituted C2 alkylene group. In some embodiments, X 1 It is an optionally substituted C3 alkylene group. In some embodiments, X 1 It is an optionally substituted C4 alkylene group. In some embodiments, X 1 It is an optionally substituted C5 alkylene group. In some embodiments, X 1 It is an optionally substituted C6 alkylene group. In some embodiments, X 1 It is -(CH2)-. In some implementations, X 1 It is -(CH2)2-. In some implementations, X 1 It is -(CH2)3-. In some implementations, X 1 It is -(CH2)4-. In some implementations, X 1 It is -(CH2)5-. In some implementations, X 1 It is -(CH2)6-.

[0505] As disclosed in Formula (CT), in some embodiments, where A is CH, X 1 It is a C1-C6 aliphatic compound with a bond or optional substitution. In some embodiments, X 1 It is a key. In some implementations, X 1 It is an optionally substituted C1-C6 alkylene group. In some embodiments, X 1 It is an unsubstituted C1-C6 alkylene group. In some embodiments, X 1 It is an unsubstituted C2-C6 alkylene group. In some embodiments, X 1 It is an optionally substituted methylene group. In some embodiments, R 2 It is an optionally substituted C2 alkylene group. In some embodiments, X 1 It is an optionally substituted C3 alkylene group. In some embodiments, X 1It is an optionally substituted C4 alkylene group. In some embodiments, X 1 It is an optionally substituted C5 alkylene group. In some embodiments, X 1 It is an optionally substituted C6 alkylene group. In some embodiments, X 1 It is -(CH2)-. In some implementations, X 1 It is -(CH2)2-. In some implementations, X 1 It is -(CH2)3-. In some implementations, X 1 It is -(CH2)4-. In some implementations, X 1 It is -(CH2)5-. In some implementations, X 1 It is -(CH2)6-.

[0506] R 1

[0507] As disclosed in Formula (CT), in some embodiments, R 1 Selected from -OH, -OAc, -NR2, , , , , , , , , , and .

[0508] As disclosed in formula (CT'), in some embodiments, R 1 Selected from -OH, -OAc, -NR2, , , , , , , , , , , , , , , , , , , , , , and , where R Z It is NR2 or OH; and X 4It is an optional substitution of C2-C 14 Alkylene or optionally substituted C2-C 14 Alkenyl group.

[0509] In some implementations, R 1 It is -OH. In some embodiments, R 1 Yes -OAc. In some implementations, R 1 It is -NR2. In some implementations, R 1 It is -NH2. In some implementations, R 1 It is -NMe2. In some implementations, R 1 Yes -NEt2. In some implementations, R 1 yes In some implementations, R 1 yes In some implementations, R 1 yes In some implementations, R 1 yes In some implementations, R 1 yes In some implementations, R 1 yes In some implementations, R 1 yes In some implementations, R 1 yes In some implementations, R 1 yes In some implementations, R 1 yes In some implementations, R 1 yes .

[0510] In some implementations, R 1 It is -(CH2)4-, X 1 It is -OH, A is N and Z is a bond. In some embodiments, R 1 It is -(CH2)4-, X 1 It is -OH, A is N and Z is a bond.

[0511] X 2 and X 3

[0512] As disclosed in Formula (CT), in some embodiments, X 2 and X 3 Each of the C1-Cs can be substituted independently and optionally. 12 Aliphatic. In some implementations, X2 and X 3 Same. In some implementations, X 2 and X 3 different.

[0513] In some implementations, X 2 It is the optional substitution of C1-C 12 Alkylene. In some embodiments, X 2 It is the optional substitution of C1-C 12 Alkenyl group. In some embodiments, X 2 It is the optional substitution of C1-C 10 Aliphatic. In some implementations, X 2 It is the optional substitution of C1-C 10 Alkylene. In some embodiments, X 2 It is the optional substitution of C1-C 10 Alkenyl group. In some embodiments, X 2 It is an optionally substituted C1-C8 aliphatic compound. In some embodiments, X 2 It is an optionally substituted C1-C8 alkylene group. In some embodiments, X 2 It is an optionally substituted C1-C8 alkenyl group. In some embodiments, X 2 It is an optionally substituted C1-C6 aliphatic compound. In some embodiments, X 2 It is an optionally substituted C1-C6 alkylene group. In some embodiments, X 2 It is an optionally substituted C1-C6 alkenyl group. In some embodiments, X 2 It is an optional substitution of C2-C 12 Aliphatic. In some implementations, X 2 It is an optional substitution of C2-C 12 Alkylene. In some embodiments, X 2 It is an optional substitution of C2-C 12 Alkenyl group. In some embodiments, X 2 It is an optional replacement of C4-C 12 Aliphatic. In some implementations, X 2 It is an optional replacement of C4-C 12 Alkylene. In some embodiments, X 2 It is an optional replacement of C4-C 12 Alkenyl group. In some embodiments, X 2 It is an optional replacement of C4-C 10 Aliphatic. In some implementations, X 2 It is an optional replacement of C4-C 10Alkylene. In some embodiments, X 2 It is an optional replacement of C4-C 10 Alkenyl group. In some embodiments, X 2 It is an optionally substituted C6-C8 aliphatic compound. In some embodiments, X 2 It is an optionally substituted C6-C8 alkylene group. In some embodiments, X 2 It is an optionally substituted C6-C8 alkenyl group. In some embodiments, X 2 It is -(CH2)-. In some implementations, X 2 It is -(CH2)2-. In some implementations, X 2 It is -(CH2)3-. In some implementations, X 2 It is -(CH2)4-. In some implementations, X 2 It is -(CH2)5-. In some implementations, X 2 It is -(CH2)6-. In some implementations, X 2 It is -(CH2)7-. In some implementations, X 2 It is -(CH2)8-. In some implementations, X 2 It is -(CH2)9-. In some implementations, X 2 It is -(CH2) 10 -

[0514] In some implementations, X 3 It is the optional substitution of C1-C 12 Alkylene. In some embodiments, X 3 It is the optional substitution of C1-C 12 Alkenyl group. In some embodiments, X 3 It is the optional substitution of C1-C 10 Aliphatic. In some implementations, X 3 It is the optional substitution of C1-C 10 Alkylene. In some embodiments, X 3 It is the optional substitution of C1-C 10 Alkenyl group. In some embodiments, X 3 It is an optionally substituted C1-C8 aliphatic compound. In some embodiments, X 3 It is an optionally substituted C1-C8 alkylene group. In some embodiments, X 3 It is an optionally substituted C1-C8 alkenyl group. In some embodiments, X 3 It is an optionally substituted C1-C6 aliphatic compound. In some embodiments, X 3 It is an optionally substituted C1-C6 alkylene group. In some embodiments, X3 It is an optionally substituted C1-C6 alkenyl group. In some embodiments, X 3 It is an optional substitution of C2-C 12 Aliphatic. In some implementations, X 3 It is an optional substitution of C2-C 12 Alkylene. In some embodiments, X 3 It is an optional substitution of C2-C 12 Alkenyl group. In some embodiments, X 3 It is an optional replacement of C4-C 12 Aliphatic. In some implementations, X 3 It is an optional replacement of C4-C 12 Alkylene. In some embodiments, X 3 It is an optional replacement of C4-C 12 Alkenyl group. In some embodiments, X 3 It is an optional replacement of C4-C 10 Aliphatic. In some implementations, X 3 It is an optional replacement of C4-C 10 Alkylene. In some embodiments, X 3 It is an optional replacement of C4-C 10 Alkenyl group. In some embodiments, X 3 It is an optionally substituted C6-C8 aliphatic compound. In some embodiments, X 3 It is an optionally substituted C6-C8 alkylene group. In some embodiments, X 3 It is an optionally substituted C6-C8 alkenyl group. In some embodiments, X 3 It is -(CH2)-. In some implementations, X 3 It is -(CH2)2-. In some implementations, X 3 It is -(CH2)3-. In some implementations, X 3 It is -(CH2)4-. In some implementations, X 3 It is -(CH2)5-. In some implementations, X 3 It is -(CH2)6-. In some implementations, X 3 It is -(CH2)7-. In some implementations, X 3 It is -(CH2)8-. In some implementations, X 3 It is -(CH2)9-. In some implementations, X 3 It is -(CH2) 10 -

[0515] In some implementations, X 2 and X3 All are optionally substituted C6-C8 alkylene groups. In some embodiments, X 2 and X 3 Both are -(CH2)8-. In some implementations, X 2 and X 3 Both are -(CH2)7-. In some implementations, X 2 and X 3 Both are -(CH2)6-.

[0516] Y 1 and Y 2

[0517] As disclosed in Formula (CT), in some embodiments, Y 1 and Y 2 Each independently , , , , , , or The key marked with "*" is attached to Y. 1 X 2 Or Y 2 的X 3 。 In some implementations, Y 1 and Y 2 Same. In some implementations, Y 1 and Y 2 different.

[0518] In some implementations, Y 1 and Y 2 Each independently , , , , or In some implementations, Y 1 and Y 2 Each independently or In some implementations, Y 1 yes In some implementations, Y 1 yes In some implementations, Y 1 yes In some implementations, Y 1 yes In some implementations, Y 1 yes In some implementations, Y 1 yes In some implementations, Y 1 yes In some implementations, Y 1 yes In some implementations, Y 2 yes In some implementations, Y 2 yes In some implementations, Y 2 yes In some implementations, Y 2 yes In some implementations, Y 2 yes In some implementations, Y 2 yes In some implementations, Y 2 yes In some implementations, Y 2 yes In some implementations, Y 1 and Y 2 All In some implementations, Y 1 and Y 2 All .

[0519] R 2

[0520] As disclosed in Formula (CT), in some embodiments, R 2 It is a C1-C6 aliphatic compound with a bond or optional substitution. In some embodiments, R 2 It is a key. In some implementations, R 2 It is an optionally substituted C1-C6 aliphatic compound. In some embodiments, R 2 It is an optionally substituted C1-C6 alkylene group. In some embodiments, R 2 It is an optionally substituted methylene group. In some embodiments, R 2 It is an optionally substituted C2 alkylene group. In some embodiments, R 2 It is an optionally substituted C3 alkylene group. In some embodiments, R 2 It is an optionally substituted C4 alkylene group. In some embodiments, R 2 It is an optionally substituted C5 alkylene group. In some embodiments, R 2 It is an optionally substituted C6 alkylene group. In some embodiments, R 2It is -(CH2)-. In some implementations, R 2 It is -(CH2)2-. In some implementations, R 2 It is -(CH2)3-. In some implementations, R 2 It is -(CH2)4-. In some implementations, R 2 It is -(CH2)5-. In some implementations, R 2 It is -(CH2)6-.

[0521] R 3

[0522] As disclosed in Formula (CT), in some embodiments, R 3 It is a C1-C6 aliphatic compound with a bond or optional substitution. In some embodiments, R 2 It is a key. In some implementations, R 2 It is an optionally substituted C1-C6 aliphatic compound. In some embodiments, R 3 It is an optionally substituted C1-C6 alkylene group. In some embodiments, R 3 It is an optionally substituted methylene group. In some embodiments, R 3 It is an optionally substituted C2 alkylene group. In some embodiments, R 3 It is an optionally substituted C3 alkylene group. In some embodiments, R 3 It is an optionally substituted C4 alkylene group. In some embodiments, R 3 It is an optionally substituted C5 alkylene group. In some embodiments, R 3 It is an optionally substituted C6 alkylene group. In some embodiments, R 3 It is -(CH2)-. In some implementations, R 3 It is -(CH2)2-. In some implementations, R 3 It is -(CH2)3-. In some implementations, R 3 It is -(CH2)4-. In some implementations, R 3 It is -(CH2)5-. In some implementations, R 3 It is -(CH2)6-.

[0523] In some implementations, R 2 and R 3 Same. In some implementations, R 2 and R 3 different.

[0524] R 4

[0525] As disclosed in Formula (CT), in some embodiments, R4 It is -CH(OR) 6 (OR) 7 -CH(SR) 6 (SR) 7 ), -CH(R 6 (R) 7 ) or optionally replace C1-C 14 Aliphatic, wherein one or more methylene groups are linked to C3-C8 cycloalkyl groups, each optionally and independently substituted, or to substituted bridging bicyclic or polycyclic C5-C groups. 14 Replacement with cycloalkylene, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-. 4 It is the optional substitution of C1-C 14 Aliphatic. In some implementations, R 4 It is the optional substitution of C1-C 14 Aliphatic, wherein one or more methylene groups are linked to C3-C8 cycloalkyl groups, each optionally and independently substituted, or to substituted bridging bicyclic or polycyclic C5-C groups. 14 Cycloalkylene, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O- are substituted. In some embodiments, R 4 It is the optional substitution of C1-C 14 Aliphatic. In some implementations, R 4 It is -CH(OR) 6 (OR) 7 In some implementations, R 4 It is -CH(R) 6 (R) 7 In some implementations, R 4 It is -CH(SR) 6 (SR) 7 ).

[0526] In some implementations, R 4 One of the methylene links is optionally substituted with a C3-C8 cycloalkyl group or optionally substituted with a bridging bicyclic or polycyclic C5-C group. 14 Cycloalkyl substitution. In some embodiments, R 4 One of the methylene bonds is replaced by a C3-C8 cycloalkyl group. In some embodiments, R 4 One methylene linker in the methylene linkage is optionally replaced by a bridging bicyclic or polycyclic C5-C. 14Cycloalkyl substitution. In some embodiments, R 4 One methylene linker in the methylene linkage is optionally replaced by a bridging bicyclic or polycyclic C5-C. 12 Cycloalkyl substitution. In some embodiments, the bridging bicyclic or polycyclic C5-C is optionally substituted. 14 Cycloalkylene groups are selected from:

[0527] , , , , , , , and .

[0528] In some implementations, the bridging double-ring or multi-ring C5-C is optionally replaced. 14 Cycloalkylene groups are divalent groups, and the structure of the divalent groups is selected from:

[0529] , , , , , , , , , , , , , , , and .

[0530] In some implementations, R 4 Selected from , , , , , , , , , , , , , and .

[0531] In some implementations, R 4 Selected from , , and .

[0532] In some implementations, R 4 Selected from , and In some implementations, R 4 yes .

[0533] R 5

[0534] As disclosed in Formula (CT), in some embodiments, R 5 It is -CH(OR) 8 (OR) 9 -CH(SR) 8 (SR) 9 ), -CH(R 8 (R) 9 -R 8 Or optionally replace -C1-C6 aliphatic -R 8 In some implementations, R 5 Yes -R 8 Or optionally replace -C1-C6 aliphatic -R 8 In some implementations, R 5 Yes -R 8 In some implementations, R 5 It is the optional substitution of C1-C 14 Aliphatic. In some implementations, R 5 It is -CH(OR) 8 (OR) 9 In some implementations, R 5 It is -CH(R) 8 (R) 9 In some implementations, R 5 It is -CH(SR) 8 (SR) 9 ).

[0535] In some implementations, R 4 and R 5 Same. In some implementations, R 4 and R 5 different.

[0536] R 6 and R 7

[0537] As disclosed in Formula (CT), in some embodiments, R 6 and R 7 Each of the C1-Cs can be substituted independently and optionally. 14Aliphatic, wherein one or more methylene groups are linked to C3-C8 cycloalkyl groups, each optionally and independently substituted, or to substituted bridging bicyclic or polycyclic C5-C groups. 14 Replacement with cycloalkylene, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-.

[0538] In some implementations, R 6 and R 7 Same. In some implementations, R 6 and R 7 different.

[0539] In some implementations, R 6 It is the optional substitution of C1-C 14 Aliphatic. In some implementations, R 6 It is the optional substitution of C1-C 14 Alkylene. In some embodiments, R 6 It is the optional substitution of C1-C 14 Branched alkylene groups. In some embodiments, R 6 It is the optional substitution of C1-C 14 Linear alkylene. In some embodiments, R 6 It is the optional substitution of C1-C 14 Alkenyl group. In some embodiments, R 6 It is the optional substitution of C1-C 14 Branched subalkenyl groups. In some embodiments, R 6 It is the optional substitution of C1-C 14 Linear-chain alkenyl groups. In some embodiments, R 6 It is an optional replacement of C6-C 10 Alkylene. In some embodiments, R 6 It is optionally replaced by -(CH2)5CH3. In some embodiments, R 6 It is optionally replaced by -(CH2)6CH3. In some embodiments, R 6 It is optionally replaced by -(CH2)7CH3. In some embodiments, R 6 It is optionally replaced by -(CH2)8CH3. In some embodiments, R 6 It is optionally substituted -(CH2)9CH3.

[0540] In some implementations, R 6 One of the methylene links is optionally substituted with a C3-C8 cycloalkyl group or optionally substituted with a bridging bicyclic or polycyclic C5-C group.14 Cycloalkyl substitution. In some embodiments, R 6 One of the methylene bonds is replaced by a C3-C8 cycloalkyl group. In some embodiments, R 6 One methylene linker in the methylene linkage is optionally replaced by a bridging bicyclic or polycyclic C5-C. 14 Cycloalkyl substitution. In some embodiments, R 6 One methylene linker in the methylene linkage is optionally replaced by a bridging bicyclic or polycyclic C5-C. 12 Cycloalkyl substitution. In some embodiments, the bridging bicyclic or polycyclic C5-C is optionally substituted. 14 Cycloalkylene groups are selected from:

[0541] , , , , , , , and .

[0542] In some implementations, the bridging double-ring or multi-ring C5-C is optionally replaced. 14 Cycloalkylene groups are divalent groups, and the structure of the divalent groups is selected from:

[0543] , , , , , , , , , , , , , , , and .

[0544] In some implementations, R 7 It is the optional substitution of C1-C 14 Aliphatic. In some implementations, R 7 It is the optional substitution of C1-C 14 Alkylene. In some embodiments, R 7 It is the optional substitution of C1-C 14 Branched alkylene groups. In some embodiments, R 7 It is the optional substitution of C1-C14 Linear alkylene. In some embodiments, R 7 It is the optional substitution of C1-C 14 Alkenyl group. In some embodiments, R 7 It is the optional substitution of C1-C 14 Branched subalkenyl groups. In some embodiments, R 7 It is the optional substitution of C1-C 14 Linear-chain alkenyl groups. In some embodiments, R 7 It is an optional replacement of C6-C 10 Alkylene. In some embodiments, R 7 It is optionally replaced by -(CH2)5CH3. In some embodiments, R 7 It is optionally replaced by -(CH2)6CH3. In some embodiments, R 7 It is optionally replaced by -(CH2)7CH3. In some embodiments, R 7 It is optionally replaced by -(CH2)8CH3. In some embodiments, R 7 It is optionally substituted -(CH2)9CH3.

[0545] In some implementations, R 7 One of the methylene links is optionally substituted with a C3-C8 cycloalkyl group or optionally substituted with a bridging bicyclic or polycyclic C5-C group. 14 Cycloalkyl substitution. In some embodiments, R 7 One of the methylene bonds is replaced by a C3-C8 cycloalkyl group. In some embodiments, R 7 One methylene linker in the methylene linkage is optionally replaced by a bridging bicyclic or polycyclic C5-C. 14 Cycloalkyl substitution. In some embodiments, R 7 One methylene linker in the methylene linkage is optionally replaced by a bridging bicyclic or polycyclic C5-C. 12 Cycloalkyl substitution. In some embodiments, the bridging bicyclic or polycyclic C5-C is optionally substituted. 14 Cycloalkylene groups are selected from:

[0546] , , , , , , , and .

[0547] In some implementations, the bridging double-ring or multi-ring C5-C is optionally replaced. 14 Cycloalkylene groups are divalent groups, and the structure of the divalent groups is selected from:

[0548] , , , , , , , , , , , , , , , and .

[0549] In some implementations, each R 6 and R 7 Selected from , , , , , , and .

[0550] R 8

[0551] As disclosed in Formula (CT), in some embodiments, R 8 It is the optional substitution of C1-C 14 Aliphatic, wherein at least one methylene bond is replaced by an optionally substituted divalent group, the structure of which is selected from...

[0552] , , , , , , , , , , , , , , , and .

[0553] In some implementation schemes, R 8 It is selected from the following structures: , , , , , , , , , , , , , , , and In some implementations, R 8 It is the optional substitution of C1-C 13 Alkylenes, which are capped with monovalent groups selected from the following structures: , , , , , , , , , , , , , , , and In some implementations, R 8 It is selected from the following structures: , , , , , , , , , , , , , , , , , , , , , , , , , , , , , and .

[0554] In some implementations, R 8 It is the optional substitution of C1-C 13 Alkyl groups, which are selected from the following structural end-capped structures: , , , , , , , , , , , , , , , , , , , , , , , , , , , , , and .

[0555] In some implementations, R 8 It is selected from the following structures: , , , , , , , , , , , , , , , , , , and .

[0556] In some implementations, R 8 It is the optional substitution of C1-C 13 Alkyl groups, which are selected from the following structural end-capped structures: , , , , , , , , , , , , , , , , , , and .

[0557] In some implementations, R 8 The substituted -CH2-, -(CH2)2-, -(CH2)3-, -(CH2)4-, -(CH2)5-, or -(CH2)6- are selected from the following structural end-capsulations: , , , , , , , , , , , , , , , , , , and In some implementations, R 8 The structure is selected from the following groups: , , , , , , , , , , , , , , , , , , , , , , , , , , , , , and In some implementations, R 8 It is selected from the following structures: , , , , , , , , , , , , , , , , , , and .

[0558] In some implementations, R 8 It is selected from the following structures: , and In some implementations, R 8 The substituted -CH2-, -(CH2)2-, -(CH2)3-, -(CH2)4-, -(CH2)5-, or -(CH2)6- are selected from the following structural end-capsulations: , and .

[0559] In some embodiments, the optional substituted divalent group of the above structure is replaced by one or more substituents independently selected from the following: -CH3, -CH2CH3, -(CH2)2CH3, -CH(CH3)2 and -C(CH3)3.

[0560] R 9

[0561] As disclosed in Formula (CT), in some embodiments, R 9 It is the optional substitution of C1-C 14 Aliphatic, wherein one or more methylene groups are linked to C3-C8 cycloalkyl groups, each optionally and independently substituted, or to substituted bridging bicyclic or polycyclic C5-C groups. 14Replacement with cycloalkylene, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-.

[0562] In some implementations, R 8 and R 9 Same. In some implementations, R 8 and R 9 different.

[0563] In some implementations, R 9 It is the optional substitution of C1-C 14 Aliphatic. In some implementations, R 9 It is the optional substitution of C1-C 14 Alkylene. In some embodiments, R 9 It is the optional substitution of C1-C 14 Branched alkylene groups. In some embodiments, R 9 It is the optional substitution of C1-C 14 Linear alkylene. In some embodiments, R 6 It is the optional substitution of C1-C 14 Alkenyl group. In some embodiments, R 9 It is the optional substitution of C1-C 14 Branched subalkenyl groups. In some embodiments, R 9 It is the optional substitution of C1-C 14 Linear-chain alkenyl groups. In some embodiments, R 9 It is an optional replacement of C6-C 10 Alkylene. In some embodiments, R 9 It is optionally replaced by -(CH2)5CH3. In some embodiments, R 9 It is optionally replaced by -(CH2)6CH3. In some embodiments, R 9 It is optionally replaced by -(CH2)7CH3. In some embodiments, R 9 It is optionally replaced by -(CH2)8CH3. In some embodiments, R 9 It is optionally substituted -(CH2)9CH3.

[0564] In some implementations, R 9 One of the methylene links is optionally substituted with a C3-C8 cycloalkyl group or optionally substituted with a bridging bicyclic or polycyclic C5-C group. 14 Cycloalkyl substitution. In some embodiments, R 9One of the methylene bonds is replaced by a C3-C8 cycloalkyl group. In some embodiments, R 9 One methylene linker in the methylene linkage is optionally replaced by a bridging bicyclic or polycyclic C5-C. 14 Cycloalkyl substitution. In some embodiments, R 9 One methylene linker in the methylene linkage is optionally replaced by a bridging bicyclic or polycyclic C5-C. 12 Cycloalkyl substitution. In some embodiments, the bridging bicyclic or polycyclic C5-C is optionally substituted. 14 Cycloalkylene groups are selected from:

[0565] , , , , , , , and .

[0566] In some implementations, the bridging double-ring or multi-ring C5-C is optionally replaced. 14 Cycloalkylene groups are divalent groups, and the structure of the divalent groups is selected from:

[0567] , , , , , , , , , , , , , , , and .

[0568] In some implementations, R 9 Selected from , , , , , , and .

[0569] In some implementation schemes, R 5 It is an optional substitution of -C1-C6 aliphatic-R 8 or -R 8 And R9 It does not exist.

[0570] In some embodiments, the lipids of this disclosure are selected from any lipids in Table (I) below or pharmaceutically acceptable salts thereof:

[0571] Table (I). Non-limiting examples of ionizable lipids of this disclosure

[0572]

[0573]

[0574]

[0575]

[0576]

[0577]

[0578]

[0579]

[0580]

[0581]

[0582]

[0583]

[0584] Where n is an integer selected from 0 to 6. In some implementations, n is 1.

[0585] In some embodiments, the lipids of this disclosure are selected from any lipids in the following table (IA) or pharmaceutically acceptable salts thereof:

[0586] Table (IA). Non-limiting examples of ionizable lipids disclosed herein.

[0587]

[0588]

[0589] In some embodiments, the lipids disclosed herein are selected from any lipids in Tables (I) and (IA) above, any enantiomers thereof, any mixture of enantiomers thereof, or pharmaceutically acceptable salts of any of the foregoing.

[0590] ii. Structural lipids

[0591] In some embodiments, the LNP comprises a structural lipid. In some embodiments, the LNP comprises two or more structural lipids. The structural lipids may be selected from, but are not limited to, the group consisting of, cholesterol, coccosterol, fucosterol, β-sitosterol, phytosterol, ergosterol, campesterol, stigmasterol, brassinosteroids, tomatidine, cholic acid, sitosterol, lithocholic acid, tomatine, ursolic acid, α-tocopherol, vitamin D3, vitamin D2, calcipotriol, botulinum toxin, lupeol, oleanolic acid, β-sitosterol acetate, and mixtures thereof. In some embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid is a cholesterol analogue disclosed in Patel et al., Nat Commun., 11, 983 (2020), which is incorporated herein by reference in its entirety. In some embodiments, the structured lipids include cholesterol and corticosteroids (such as prednisolone, dexamethasone, prednisone, and hydrocortisone) or any combination thereof. In some embodiments, the structured lipids are described in International Patent Application WO2019152557A1, which is incorporated herein by reference in its entirety.

[0592] In some implementations, the structural lipids are cholesterol analogues. The use of cholesterol analogues can enhance endosome escape, as described in Patel et al., Naturally-occurring cholesterol analogues in lipid nanoparticles induce polymorphic shape and enhance intracellular delivery of mRNA, Nature Communications (2020), which is incorporated herein by reference.

[0593] In some implementations, the structural lipids are phytosterols. The use of phytosterols can enhance endosomal escape, as described in Herrera et al., Illuminating endosomal escape of polymorphic lipid nanoparticles that boost mRNA delivery, Biomaterials Science (2020), which is incorporated herein by reference.

[0594] In some implementations, the structural lipids contain phytosterol mimics to enhance endosome release.

[0595] In some embodiments, the structural lipid is cholesterol hemisuccinate (CHEMS). In some embodiments, the structural lipid is 3-(4-((2-(4-morpholinyl)ethyl)amino)-4-oxobutyrate) (Mochol).

[0596] iii. Polyethylene glycol-modified lipids

[0597] Polyethylene glycol-modified lipids are lipids modified with polyethylene glycol. The term "polyethylene glycol-modified lipids" may be used interchangeably with the abbreviation "PEG lipids" in this document.

[0598] In some embodiments, the LNP comprises one, two, or more polyethylene glycol-modified lipids or PEG-modified lipids. The polyethylene glycol-modified lipids may be selected from the non-limiting group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, the PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipids.

[0599] In some embodiments, the PEGylated lipid is selected from (R)-2,3-bis(octadecoxy)propyl-1-(methoxypoly(ethylene glycol)2000)propylcarbamate, PEG-S-DSG, PEG-S-DMG, PEG-PE, PEG-PAA, PEG-OHDSPE C18, PEG-DSPE, PEG-DSG, PEG-DPG, PEG-DOMG, PEG-DMPE Na, PEG-DMPE, PEG-DMG2000, PEG-DMG C14, PEG-DMG, PEG-DMA, PEG-ceramide C16, PEG-C-DOMG, PEG-c-DMOG, PEG-c-DMA, PEG-cDMA, PEGA, PEG750-C-DMA, PEG400, PEG2k-DMG, PE G2k-C11, PEG2000-PE, PEG2000P, PEG2000-DSPE, PEG2000-DOMG, PEG2000-DMG, PEG2000-C-DMA, PEG2000, PEG200, PEG(2k)-DMG, PEG DSPE C18, PEG DMPE C14, PEG DLPE C12, PEG Click DMG C14, PEG Click C12, PEG Click C10, N(carbonyl-methoxy polyethylene glycol-2000)-l,2-distearate-sn-glycerol-3-phosphate ethanolamine, Myrj52, mPEG-PLA, MPEG-DSPE, mPEG3000-DMPE, MPEG-2000-DSPE, MPEG2000-DSPE, mPEG2000-DPPE, mPEG2000-DMPE, mPEG2000-DMG, mDPPE-PEG2000, l,2-Distearyl-sn-glycerol-3-phosphate ethanolamine-PEG2000, HPEG-2K-LIPD, folic acid PEG-DSPE, DSPE-PEGMA 500, DSPE-PEGMA, DSPE-PEG6000, DSPE-PEG5000, DSPE-PEG2K-NAG, DSPE-PEG2k, DSPE-PEG2000 maleimide, DSPE-PEG2000, DSPE-PEG, DSG-PEGMA, DSG-PEG5000, DPPE-PEG-2K, DPPE-PEG, DPPE-mPEG2000, DPPE-mPEG, DPG-PEGMA, DOPE-PE G2000, DMPE-PEGMA, DMPE-PEG2000, DMPE-Peg, DMPE-mPEG2000, DMG-PEGMA, DMG-PEG2000, DMG-PEG, distearylglycerol-polyethylene glycol, C18PEG750, C18PEG5000, C18PEG3000, C18PEG2000, C16PEG2000, C14PEG2000, C18-PEG5000, C18PEG, C16PEG, C16 mPEG (polyethylene glycol) 2000 ceramide, C14-PEG-DSPE200, C14-PEG2000, C14PEG2000, C14-PEG 2000, C14-PEG, C14PEG, 14:0-PEG2KPE, 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine-PEG2000, (R)-2,3-bis(octadecoxy)propyl-1-(methoxypoly(ethylene glycol)2000)propylcarbamate, (PEG)-C-DOMG, PEG-C-DMA, and DSPE-PEG-X.

[0600] In some embodiments, the LNP comprises a polyethylene glycol-modified lipid disclosed in one of the following patents: US2019 / 0240354; US 2010 / 0130588; US 2021 / 0087135; WO 2021 / 204179; US 2021 / 0128488; US 2020 / 0121809; US 2017 / 0119904; US 2013 / 0108685; US 2013 / 0195920; US 2015 / 0005363; US 2014 / 0308304; US 2013 / 0053572; WO 2019 / 232095A1; WO 2021 / 077067; WO2019 / 152557; US US 2015 / 0203446; US 2017 / 0210697; US 2014 / 0200257; or WO 2019 / 089828A1, each of which is incorporated herein by reference in its entirety.

[0601] In some embodiments, the LNP comprises polyethylene glycol-modified lipids disclosed and described in PCT Publication WO2024044728A1, filed August 25, 2023, which is incorporated herein by reference in its entirety. In some embodiments, the polyethylene glycol-modified lipids are of the formulas PL-I', PL-I'', PL-I, PL-Ia, PL-Ib, PL-Iaa, PL-Iab, PL-Iac, PL-Iad, PL-Iae, PL-Iaf, PL-Iag, PL-Iah, PL-Iba, PL-Ibb, PL-Ibc, PL-Ibd, PL-Ibe, PL-Ibf, PL-Ibg, PL-Ibh, PL-Ica, PL-Icb, and PL-Icc. , PL-Icd, PL-Id, PL-Ie, PL-If, PL-Ig, PL-Ih, PL-Ii, PL-Iha, PL-Ihb, PL-Ihc, PL-Ihd, PL-Iia, PL-Iib, PL-I ic, PL-Iid, PL-Ij, PL-Ik, L-Il, PL-Im, PL-In, PL-Io, PL-Ip, PL-Iq, PL-Ioa, PL-Iob, PL-Ioc, PL-Iod, PL-Io e, PL-Iof, PL-Iog, PL-Ioh, PL-Ipa, PL-Ipb, PL-Ipc, PL-Ipd, PL-Ipe, PL-Ipf, PL-Ipg, PL-Iph, PL-Iqa, PL-I qb, PL-Iqc, PL-Iqd, PL-Ir, PL-Is, PL-It, PL-Iu, PL-Iv, PL-Iw, PL-Iva, PL-Ivb, PL-Ivc, PL-Ivd, PL-Iwa, PL -Iwb, PL-Iwc, PL-Iwd, PL-Ix, PL-Ixx, PL-Iy, PL-Iyy, PL-Iyyy, PL-Iz, PL-Izz, PL-Izzz, PL-II', PL-II'', P Lipid of any one of L-II, PL-IIc, PL-IId, PL-IIe, PL-IIf, PL-IIg, PL-IIh, PL-IIa, PL-IIb, PL-IIk, PL-IIm, or PL-IIn.

[0602] In some implementations, the polyethylene glycol-modified lipid is a compound of formula PL-I':

[0603]

[0604] PL-I'

[0605] Or its pharmaceutically acceptable salt, wherein:

[0606] A 1It is a saturated 5-6 membered carbon ring or a saturated 5-6 membered heterocycle containing one or two heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the carbon ring and heterocycle are represented by R appearing t times. 4 replace;

[0607] X 1 It is -N(H)-, -N(C)- 1-6 alkyl)-, -C 1-6 Aliphatic -N(H)-, -C 1-6 Aliphatic-N(C) 1-6 Alkyl group (-, -O-, or -C) 1-6 Aliphatic -O-;

[0608] L 1 It is -C(O)(C 1-6 Aliphatic C(O)-N(R)-、-C(O)(C 1-6 Aliphatic)-N(R)C(O)-、-C(O)(C 1-6 (Aliphatic)C(O)O-、-C(O)(C 1-6 Aliphatic C(O)-、-C(O)(C 1-6 Aliphatic)C(O)OCH2-、-C(O)(C 1-6 Aliphatic)-、-C(O)(C 1-6 Aliphatic) -N(R)- or -C(O)-;

[0609] L 2 and L 3 Independent of covalent bonds or C 1-6 Alkylene, wherein C 1-6 The methylene unit of the alkylene group is optionally replaced by -O-, -NR-, -S-, -SS-, -S(O)-, -S(O)2-, -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)N(R)-, -N(R)C(O)O-, -C(O)N(R)-, -N(R)C(O)N(R)-, -C(R 5 ) = N- or -C(R 5 ) = NO - Replacement;

[0610] R 1 It is H, C 1-6 Alkyl, -(C 1-6 alkyl)-N3, -(C 1-6 Alkyl)-SH or C 3-8 alkynyl group;

[0611] R 2 and R 3 C can be a straight chain or a branched chain independently. 6-30 Alkyl, straight-chain or branched C6-30 Alkenyl, straight-chain, or branched C 6-30 Alkyne group; wherein one, two, or three methylene units are independently and optionally saturated or partially unsaturated C. 3-6 Carbocyclic or phenylene substitution; wherein alkyl, alkenyl, and ynyl groups, as well as any carbocyclic or phenylene group, are replaced by R x Replace m instances;

[0612] R 4 It is C 1-4 alkyl;

[0613] R 5 It is C 1-6 Alkyl or C 2-14 alkenyl;

[0614] Each R is independently hydrogen or a group selected from the following optionally substituted groups: C 1-6 Aliphatic, 3-8 member saturated or partially unsaturated monocyclic carbon rings, phenyl, 8-10 member bicyclic aromatic carbon rings, 4-8 member saturated or partially unsaturated monocyclic heterocycles having 1-2 heteroatoms independently selected from nitrogen, oxygen and sulfur, 5-6 member monocyclic heteroaromatic rings having 1-4 heteroatoms independently selected from nitrogen, oxygen and sulfur, or 8-10 member bicyclic heteroaromatic rings having 1-5 heteroatoms independently selected from nitrogen, oxygen or sulfur;

[0615] Each R x Independently halogen, -CN, -OR, -SR, -C(O)R, -C(O)OR or -OC(O)OR;

[0616] n is an integer between 10 and 75, including the end values;

[0617] m is 0, 1, 2, 3, or 4; and

[0618] t is 0, 1, or 2.

[0619] In some embodiments, the polyethylene glycol-modified lipid is a compound of formula PL-II':

[0620]

[0621] PL-II'

[0622] Or its pharmaceutically acceptable salt, wherein:

[0623] X 1 It is -N(H)-, -N(C)- 1-6 alkyl)-, -C 1-6 Aliphatic -N(H)-, -C 1-6 Aliphatic-N(C) 1-6 Alkyl group (-, -O-, or -C) 1-6 Aliphatic -O-;

[0624] L 1 It is -C(O)(C 1-6 Aliphatic C(O)-、-C(O)(C 1-6 Aliphatic) or -C(O)-;

[0625] L 2 and L 3 Is it a covalent bond or C 1-6 Alkylene, wherein C 1-6 The methylene unit of the alkylene group is optionally replaced by -O-, -NR-, -S-, -SS-, -S(O)-, -S(O)2-, -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)N(R)-, -N(R)C(O)O-, -C(O)N(R)-, -N(R)C(O)N(R)-, -C(R 6 ) = N- or -C(R 6 ) = NO - Replacement;

[0626] R 1 It is H, C 1-6 Alkyl, -(C 1-6 alkyl)-N3, -(C 1-6 Alkyl)-SH or C 3-8 alkynyl group;

[0627] R 2 and R 3 C can be a straight chain or a branched chain independently. 6-30 Alkyl, straight-chain or branched C 6-30 Alkenyl, straight-chain, or branched C 6-30 Alkyne group; wherein one, two, or three methylene units are independently and optionally saturated or partially unsaturated C. 3-6 Carbocyclic or phenylene substitution; wherein alkyl, alkenyl, and ynyl groups, as well as any carbocyclic or phenylene group, are replaced by R x Replace m instances;

[0628] R 6 It is C 1-6 Alkyl or C 2-14 alkenyl;

[0629] Each R is independently hydrogen or a group selected from the following optionally substituted groups: C 1-6Aliphatic, 3-8 member saturated or partially unsaturated monocyclic carbon rings, phenyl, 8-10 member bicyclic aromatic carbon rings, 4-8 member saturated or partially unsaturated monocyclic heterocycles having 1-2 heteroatoms independently selected from nitrogen, oxygen and sulfur, 5-6 member monocyclic heteroaromatic rings having 1-4 heteroatoms independently selected from nitrogen, oxygen and sulfur, or 8-10 member bicyclic heteroaromatic rings having 1-5 heteroatoms independently selected from nitrogen, oxygen or sulfur;

[0630] Each R x Independently halogen, -CN, -OR, -SR, -C(O)R, -C(O)OR or OC(O)OR;

[0631] n is an integer between 10 and 75, inclusive; and

[0632] m can be 0, 1, 2, 3, or 4.

[0633] In some implementations, the PEGylated lipid compound is one of the compounds shown in Table (IX) or a pharmaceutically acceptable salt thereof.

[0634] Table (IX). Exemplary polyethylene glycol compounds

[0635]

[0636]

[0637]

[0638]

[0639] In some embodiments, the LNP comprises a PEGylated lipid substitute replacing the PEGylated lipid. All embodiments of PEGylated lipids disclosed herein should be understood to also apply to PEGylated lipid substitutes. In some embodiments, the LNP comprises a polysarcosine-lipid conjugate, such as those disclosed in US 2022 / 0001025 A1, which is incorporated herein by reference in its entirety. In some embodiments, the LNP comprises a polyoxazoline-lipid conjugate, such as those disclosed in US 2022 / 0249695 A1, which is incorporated herein by reference in its entirety.

[0640] iv. Phospholipids

[0641] In some embodiments, the LNP of this disclosure comprises phospholipids. In some embodiments, the LNP of this disclosure comprises two or more phospholipids. The phospholipids available in the compositions and methods may be selected from the non-limiting group consisting of: 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycerol-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycerol-3-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycerol-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine (DMPC). The following are listed: 1,2-diundecanoyl-sn-glycerol-3-phosphate choline (DPPC), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphate choline (POPC), 1,2-di-O-octadecenyl-sn-glycerol-3-phosphate choline (18:0 diether PC), 1-oleoyl-2-cholesterol hemisuccinoyl-sn-glycerol-3-phosphate choline (OChemsPC), 1-hexadecyl-sn-glycerol-3-phosphate choline (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycerol-3-phosphate choline, 1,2-disarachidonicoyl-sn-glycerol-3-phosphate choline, 1,2-docosahexaenoyl-sn-glycerol-3-phosphate choline, and 1,2-diphydanoyl-sn-glycerol-3-phosphate ethanolamine (ME 16.0). PE), 1,2-distearate-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-diarachidonicoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-docosahexaenooyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dioleoyl-sn-glycerol-3-phosphate-rac-(1-glycerol) sodium salt (DOPG), (S)-2-ammonium-3-((((R)-2-(oleoyloxy)-3-(stearoyloxy)propoxy)oxy)phosphoyl)oxy)propionate sodium salt (L-α-phosphatidylserine);Brain PS), myristoyl phosphatidylcholine (DMPC), myristoyl phosphatidyl ethanolamine (DMPE), myristoyl phosphatidylglycerol (DMPG), dioleoyl-phosphatidyl ethanolamine 4-(N-maleimidemethyl)-cyclohexane-1-carboxylate (DOPE-mal), dioleoyl phosphatidylglycerol (DOPG), 1,2-dioleoyl-sn-glycerol-3-(phospho-L-serine) (DOPS), Cell Fusion Phospholipids (DPhPE), Dipalmitoylphosphatidylethanolamine (DPPE), 1,2-Dioleoyl-sn-phosphatidylethanolamine (DEPE), Dipalmitoylphosphatidylglycerol (DPPG), Dipalmitoylphosphatidylserine (DPPS), Distearylphosphatidylcholine (DSPC), Distearyl-phosphatidyl-ethanolamine (DSPE), Distearylphosphatidylethanolamine imidazole (DSPEI), 1,2-Diundecanoyl-sn-glycerol-phosphocholine (DUPC), Lecithinylcholine (EPC), 1,2-Dioleoyl-sn-glycerol-3-phosphate (18:1 PA; DOPA), Bis((S)-2-hydroxy-3-(oleoyloxy)propyl)ammonium phosphate (18:1 DMP; LBPA), 1,2-Dioleoyl-sn-glycerol-3-phosphate-(1'-muscleinositol) (DOPI; 18:1) PI), 1,2-distearyl-sn-glycerol-3-phosphate-L-serine (18:0 PS), 1,2-dilinoleoyl-sn-glycerol-3-phosphate-L-serine (18:2 PS), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphate-L-serine (16:0-18:1 PS; POPS), 1-stearoyl-2-oleoyl-sn-glycerol-3-phosphate-L-serine (18:0-18:1 PS), 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphate-L-serine (18:0-18:2 PS), 1-oleoyl-2-hydroxy-sn-glycerol-3-phosphate-L-serine (18:1 Lyso PS), 1-stearoyl-2-hydroxy-sn-glycerol-3-phosphate-L-serine (18:0 Lyso PS) and sphingomyelin. In some embodiments, the LNP contains DSPC. In some embodiments, the LNP contains DOPE. In some embodiments, the LNP contains both DSPC and DOPE.

[0642] In some embodiments, the LNP comprises a phospholipid selected from the following: 1-pentadecanoyl-2-oleoyl-sn-glycerol-3-phosphate choline, 1-myristoyl-2-palmitoyl-sn-glycerol-3-phosphate choline, 1-myristoyl-2-stearoyl-sn-glycerol-3-phosphate choline, 1-palmitoyl-2-myristoyl-sn-glycerol-3-phosphate choline, 1-palmitoyl-2-stearoyl-sn-glycerol-3-phosphate choline, 1-palmitoyl-2-oleoyl-glycerol-3-phosphate choline, 1-palmitoyl-2-linoleoyl-sn-glycerol-3-phosphate choline, 1-palmitoyl-2-arachidonico-sn -Glyceryl-3-phosphocholine, 1-palmitoyl-2-docosahexaenoyl-sn-glyceryl-3-phosphocholine, 1-stearoyl-2-myristoyl-sn-glyceryl-3-phosphocholine, 1-stearoyl-2-palmitoyl-sn-glyceryl-3-phosphocholine, 1-stearoyl-2-oleoyl-sn-glyceryl-3-phosphocholine, 1-stearoyl-2-linoleoyl-sn-glyceryl-3-phosphocholine, 1-stearoyl-2-arachidonicoyl-sn-glyceryl-3-phosphocholine, 1-stearoyl-2-docosahexaenoyl-sn-glyceryl-3-phosphocholine, 1-oleoyl-2-myristoyl-sn-glyceryl-3-phosphocholine Oleyl-3-phosphate choline, 1-oleoyl-2-palmitoyl-sn-glycerol-3-phosphate choline, 1-oleoyl-2-stearoyl-sn-glycerol-3-phosphate choline, 1-palmitoyl-2-acetyl-sn-glycerol-3-phosphate choline, 1,2-dioleoyl-sn-glycerol-3-phosphate-(1'-muskininositol-3',4'-bisphosphate), 1,2-dioleoyl-sn-glycerol-3-phosphate-(1'-muskininositol-3',5'-bisphosphate), 1,2-dioleoyl-sn-glycerol-3-phosphate-(1'-muskininositol-4',5'-bisphosphate), 1,2-dioleoyl-sn-glycerol-3-phosphate Phosphate-(1'-muskininositol-3',4',5'-triphosphate), 1,2-dioleoyl-sn-glycerol-3-phosphate-(1'-muskininositol-3'-phosphate), 1,2-dioleoyl-sn-glycerol-3-phosphate-(1'-muskininositol-4'-phosphate), 1,2-dioleoyl-sn-glycerol-3-phosphate-(1'-muskininositol-5'-phosphate), 1,2-dioleoyl-sn-glycerol-3-phosphate-(1'-muskininositol), 1,2-dioleoyl-sn-glycerol-3-phosphate-L-serine, and 1-(8Z-octadecenoyl)-2-palmitoyl-sn-glycerol-3-phosphate choline.

[0643] In some embodiments, the LNP comprises a phospholipid selected from the following: DSPS (distearylphosphatidylserine), DSPG (1,2-distearyl-sn-glycerol-3-phosphate-(1'-rac-glycerol)), DSPA (1,2-distearyl-sn-glycerol-3-phosphate), diPhyPC (1,2-diphytanyl-sn-glycerol-3-phosphate choline), diPhy-diether-PC (1,2-di-O-phytanyl-sn-glycerol-3-phosphate choline), diPhyPE (1,2-diphytanyl-sn-glycerol-3-phosphate ethanolamine), diPhy-diether-PE (1,2-di-O-phytanyl-sn-glycerol-3-phosphate ethanolamine), diPhyPS (1,2-diphytanyl-sn-glycerol-3-phosphate-L-serine), diPhyPG (1,2-Diphytyl-sn-glycerol-3-phosphate-(1'-rac-glycerol)), diPhyPA (1,2-Diphytyl-sn-glycerol-3-phosphate), egg PA (L-α-phosphatidic acid) and soybean PA (L-α-phosphatidic acid).

[0644] In some embodiments, the LNP comprises phospholipids selected from the following: 18:1 (Δ9-Cis) PE (DOPE), 18:0-18:1 PE (SOPE), C16-18:1 PE, 16:0-18:1 PE (POPE), 18:1 BMP (S,R), 18:0-18:1 PC (SOPC), 16:0-18:1 PC (POPC), 4ME 16:0 diether PE (4Me), 18:1 (Δ9-Trans) PE (DEPE), 16:1 PE (DPPE), and CL. In some embodiments, the LNP comprises phospholipids described and disclosed in Alvarez-Benedicto et al. (Biomater. Sci., 2022, 10, 549) and Li et al. (Asian Journal of Pharmaceutical Sciences, 2015, 10, 81-98).

[0645] In some embodiments, the phospholipid is a sphingosine lipid or sphingolipid, such as, but not limited to, sphingomyelin. As used herein, the terms "sphingosine lipid" and "sphingolipid" refer to a class of lipids containing a backbone comprising a sphingosine base. An exemplary sphingosine base is sphingosine. In some embodiments, the LNP comprises a sphingolipid selected from the following: egg sphingomyelin (egg SM / ESM / (2S,3R,E)-3-hydroxy-2-palmitoyl-octadecane-4-en-1-yl(2-(trimethylammonium)ethyl) phosphate), brain or porcine sphingomyelin (brain SM / (2S,3R,E)-3-hydroxy-2-stearoyl-octadecane-4-en-1-yl(2-(trimethylammonium)ethyl) phosphate), milk or bovine sphingomyelin (milk SM / (2S,3R,E)-3-hydroxy-2-tricarbonamide octadecane-4-en-1-yl(2-(trimethylammonium)ethyl) phosphate), 28:0 SM (N-octacosanoyl-D-erythrosphocholine), 14:0 SM (N-myristoyl-D-erythrosphocholine), 16:1 SM (N-Palmyl-D-erythrosphocholine), 12:0 dihydroSM (N-Lauroyl-D-erythrosphocholine), Lyso SM (Sphingocholine), Lyso SM (Sphingocholine), Lyso SM (Dihydro) (Sphingocholine), 24:1 SM (N-Ceramide-D-erythrosphocholine), 24:0 SM (N-Teicosicoyl-D-erythrosphocholine), 18:1 SM (N-Oleoyl-D-erythrosphocholine), 18:0 SM (N-Stearyl-D-erythrosphocholine), 17:0 SM (N-Heptadecanyl-D-erythrosphocholine), 16:0 SM (N-Palmyl-D-erythrosphocholine), 12:0 SM (N-Lauroyl-D-erythrosphocholine), 06:0 SM (N-hexanoyl-D-erythrosphocholine), 02:0 SM (N-acetyl-D-erythrosphocholine), 3-O-methylLyso SM (3-O-methyl-sphocholine), 3-O-methyl-N-methylLyso SM (3-O-methyl-N-methyl-sphocholine) and 3-N-methylLyso SM (3-N-methyl-sphocholine).

[0646] In some embodiments, the LNP contains at least two phospholipids. In some embodiments, at least a portion of the total phospholipid content comprises nonphosphatidylcholine phospholipids, wherein "nonphosphatidylcholine phospholipids" are phospholipids that do not contain a phosphatidylcholine fraction. Exemplary nonphosphatidylcholine phospholipids include, but are not limited to, DOPE, DSPS, and DSPG. In some embodiments, the LNP contains at least 5 mol% of nonphosphatidylcholine phospholipids. In some embodiments, the LNP contains at least 6 mol% of nonphosphatidylcholine phospholipids. In some embodiments, the LNP contains at least 10 mol% of nonphosphatidylcholine phospholipids.

[0647] In some embodiments, the LNP comprises a phospholipid containing at least one constrained tail, such as those described by Gan (Bioeng Transl Med. 2020 Sep; 5(3): e10161.). In some embodiments, the phospholipid is selected from one of the following:

[0648] .

[0649] In some embodiments, the LNP contains phospholipids containing ceramide analogs with triazole linkages, such as those described by Kim et al., Bioorg. Med. Chem. Lett., 17(16), 2007, 4584-4587.

[0650] In some embodiments, the LNP comprises the phospholipids disclosed in WO 2023 / 141470, which is incorporated herein by reference in its entirety. In some embodiments, the phospholipids are (a15:0-i15:0 PE).

[0651] In some embodiments, the LNP comprises the phospholipids disclosed in WO 2022 / 040641, which is incorporated herein by reference in its entirety.

[0652] In some embodiments, the phospholipid tail may be modified to facilitate endosome escape, as described in US 2021 / 0121411, which is incorporated herein by reference.

[0653] In some implementations, the LNP comprises the phospholipid disclosed in one of the following patents: US 2019 / 0240354; US 2010 / 0130588; US 2021 / 0087135; WO 2021 / 204179; US 2021 / 0128488; US2020 / 0121809; US 2017 / 0119904; US 2013 / 0108685; US 2013 / 0195920; US 2015 / 0005363; US 2014 / 0308304; US 2013 / 0053572; WO 2019 / 232095A1; WO 2021 / 077067; WO 2019 / 152557; US 2017 / 0210697; or WO 2019 / 089828A1, each of which is incorporated herein by reference in its entirety.

[0654] In some embodiments, the phospholipids disclosed in US 2020 / 0121809 have the following structure:

[0655]

[0656] R1 and R2 are each independently a branched or straight-chain, saturated or unsaturated carbon chain (e.g., alkyl, alkenyl, alkynyl).

[0657] v. Targeting part

[0658] In some embodiments, the lipid nanoparticles further include a targeting portion. The targeting portion may be an antibody or a fragment thereof. The targeting portion may be capable of binding to a target antigen. In some embodiments, the lipid nanoparticles include more than one targeting portion. In some embodiments, the lipid nanoparticles include more than one targeting portion, wherein the targeting portion targets at least two different receptors, and in some embodiments, the at least two different receptors are ubiquitous in different types of cells or tissues.

[0659] In some embodiments, the pharmaceutical composition includes a targeting portion operatively linked to the lipid nanoparticles. In some embodiments, the targeting portion is capable of binding to a target antigen. In some embodiments, the target antigen is expressed in a target organ. In some embodiments, the target antigen is expressed in a greater extent in the target organ than in the liver.

[0660] In some embodiments, the targeting portion is an antibody as described in WO2016189532A1, which is incorporated herein by reference. For example, in some embodiments, the targeting particle is conjugated to a specific anti-CD38 monoclonal antibody (mAb), which enables the siRNA encapsulated within the particle to be specifically delivered to B-cell lymphocytic malignancies (such as MCL) at a greater percentage than to other subtypes of leukocytes.

[0661] In some embodiments, the targeting portion targets receptors selected from the following: CD20, CCR7, CD3, CD4, CD5, CD8, CD16, CD19, CD20, CD21, CD22, CD25, CD28, CD35, CD40, CD45RA, CD45RO, CD52, CD62L, CD80, CD95, CD127, and CD137. In some embodiments, the targeting portion targets receptors selected from the following: CD1, CD2, CD3, CD5, CD7, CD8, CD16, CD25, CD26, CD27, CD28, CD30, CD38, CD39, CD40L, CD44, CD45, CD62L, CD69, CD73, CD80, CD83, CD86, CD95, CD103, CD119, CD126, CD150, CD153. The target receptors are CD154, CD161, CD183, CD223, CD254, CD275, CD45RA, CXCR3, CXCR5, FasL, IL18R1, CTLA-4, OX40, GITR, LAG3, ICOS, PD-1, leu-12, TCR, TLR1, TLR2, TLR3, TLR4, TLR6, NKG2D, CCR, CCR1, CCR2, CCR4, CCR6, and CCR7. In some embodiments, the target portion targets receptors selected from CD2, CD3, CD5, and CD7. In some embodiments, the target portion targets receptors selected from CD2, CD3, CD5, CD7, CD8, CD4, β7 integrin, β2 integrin, and C1q. In some embodiments, the target portion targets CD117. In some embodiments, the target portion targets CD90. In some implementations, the targeting portion targets receptors selected from the following: mannose receptor, CD206, and C1q.In some implementations, the targeting portion is selected from T-cell receptor motif antibodies, T-cell α-chain antibodies, T-cell β-chain antibodies, T-cell γ-chain antibodies, T-cell δ-chain antibodies, CCR7 antibodies, CD3 antibodies, CD4 antibodies, CD5 antibodies, CD7 antibodies, CD8 antibodies, CD11b antibodies, CD11c antibodies, CD16 antibodies, CD19 antibodies, CD20 antibodies, CD21 antibodies, CD22 antibodies, CD25 antibodies, CD28 antibodies, CD34 antibodies, CD35 antibodies, CD40 antibodies, CD45RA antibodies, CD45RO antibodies, CD52 antibodies, CD56 antibodies, CD62L antibodies, CD68 antibodies, CD80 antibodies, CD95 antibodies, CD117 antibodies, CD127 antibodies, CD133 antibodies, and CD137 antibodies. (4-1BB) antibodies, CD163 antibodies, F4 / 80 antibodies, IL-4Rα antibodies, Sca-1 antibodies, CTLA-4 antibodies, GITR antibodies, GARP antibodies, LAP antibodies, granzyme B antibodies, LFA-1 antibodies, transferrin receptor antibodies, and fragments thereof. In some embodiments, the target portion is any of the target portions described or contemplated in the following patents: US20230312713A1, US20230203538A1, US20230320995A1, US20160145348, and US20110038941, each of which is incorporated herein by reference in its entirety.

[0662] In some embodiments, the targeting portion is a small molecule. In some embodiments, the small molecule binds to an extracellular enzyme on an immune cell, wherein the extracellular enzyme is selected from the group consisting of CD38, CD73, adenosine 2a receptor, and adenosine 2b receptor. In some embodiments, the small molecule is mannose, lectin, acivicin, biotin, or digoxigenin.

[0663] In some implementations, the lipid nanoparticles can be targeted when they are conjugated / attached / associated with a target portion (such as an antibody or a fragment thereof).

[0664] vi. zwitterionic amino lipids

[0665] In some embodiments, the LNP contains zwitterionic lipids. In some embodiments, the LNP containing zwitterionic lipids does not contain phospholipids.

[0666] Zwitterionic aminolipids have been shown to self-assemble into LNPs in the absence of phospholipids, thereby loading, stabilizing, and releasing mRNA within cells, as described in U.S. Patent Application 20210121411, which is incorporated herein by reference in its entirety. Zwitterionic, ionizable cation, and permanently cationic assist lipids enable tissue-selective mRNA delivery and CRISPR-Cas9 gene editing in the spleen, liver, and lung, as described in Liu et al., Membrane-destablizingionizable phospholipids for organ-selective mRNA delivery and CRISPR-Cas geneediting, Nat Mater. (2021), which is incorporated herein by reference in its entirety.

[0667] Zwitterionic lipids can have head groups containing cationic amines and anionic carboxylates, as described in Walsh et al., Synthesis, Characterization and Evaluation of Ionizable Lysine-Based Lipids for siRNA Delivery, Bioconjug Chem. (2013), which is incorporated herein by reference in its entirety. Ionizable lysine-based lipids containing lysine head groups linked to long-chain dialkylamines via amide bonds at the lysine α-amine group can reduce immunogenicity, as described in Walsh et al., Synthesis, Characterization and Evaluation of Ionizable Lysine-Based Lipids for siRNA Delivery, Bioconjug Chem. (2013).

[0668] vii. Additional lipid components

[0669] In some embodiments, the LNP compositions of this disclosure further comprise one or more additional lipid components capable of influencing the tropism of the LNP. In some embodiments, the LNP further comprises at least one lipid selected from the group consisting of DDAB, EPC, 14PA, 18BMP, DODAP, DOTAP, and C12-200 (see Cheng et al. Nat Nanotechnol. April 2020; 15(4): 313–320.; Dillard et al. PNAS 2021 Vol. 118 No. 52).

[0670] In some embodiments, the LNP of this disclosure further comprises one or more additional ionizable lipids, such as, but not limited to, those ionizable lipids disclosed in one of the following patents: US 2023 / 0053437; US 2019 / 0240354; US 2010 / 0130588; US 2021 / 0087135; WO 2021 / 204179; US 2021 / 0128488; US2020 / 0121809; US 2017 / 0119904; US 2013 / 0108685; US 2013 / 0195920; US 2015 / 0005363; US 2014 / 0308304; US 2013 / 0053572; WO 2019 / 232095A1; WO WO 2021 / 077067; WO 2019 / 152557; US 2017 / 0210697; or WO 2019 / 089828A1, each of which is incorporated herein by reference in its entirety. In some embodiments, the LNP of this disclosure further comprises one or more additional ionizable lipids selected from those disclosed in WO2023044343A1 or WO2023044333A1, which are incorporated herein by reference in their entirety.

[0671] In some embodiments, the LNP compositions of this disclosure comprise or further comprise one or more lipids selected from the group consisting of: 1,2-di-O-octadecenyl-sn-glycerol-3-phosphocholine (18:0 diether PC), 1,2-dilinoyl-sn-glycerol-3-phosphocholine (18:3 PC), acylcarnosine (AC), 1-hexadecyl-sn-glycerol-3-phosphocholine (C16 LysoPC), N-oleoyl-sphingomyelin (SPM) (C18:1), and N-tetracosyl-SPM. (C24:0), N-sphingomyelin (C24:l), cardiolipin (CL), 1,2-bis(tetrazol-10,12-diynyl)-sn-glycerol-3-phosphocholine (DC8-9PC), diceryl phosphate (DCP), dihexadecyl phosphate (DCP1), 1,2-dipalmitoylglycerol-3-hemisuccinate (DGSucc), short-chain bis-n-heptadecanoylphosphatidylcholine (DHPC), dihexadecanoyl-phosphoethanolamine (DHPE), 1,2-dilinoleoyl-sn-glycerol-3-phosphocholine (DLPC), 1,2-dilauroyl-sn-glycerol-3-PE (DLPE), Dimyroxyglycerol hemisuccinate (DMGS), Dimyroxyphosphatidylcholine (DMPC), Dimyroxyphosphatidylethanolamine (DMPE), Dimyroxyphosphatidylglycerol (DMPG), Dioleoylbenzyl alcohol (DOBA), 1,2-Dioleoylglycerol-3-hemisuccinate (DOGHEMS), N-[2-(2-{2-[2-(2,3-bis-octadecane-9-enoxy-propoxy)-ethoxy]-ethoxy}-ethoxy)- [3,4,5-Dihydroxy-6-hydroxymethyl-tetrahydro-pyran-2-ylthioalkyl]-propionamide (DOGP4αMan), dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylethanolamine (DOPE), dioleoylphosphatidylethanolamine 4-(N-maleimidemethyl)-cyclohexane-1-carboxylate (DOPE-mal), dioleoylphosphatidylglycerol (DOPG), 1,2-dioleoyl-sn-glycerol-3-(phospho-L-serine) (DOPS), Cell Fusion Phospholipids (DPhPE), Dipalmitoylphosphatidylethanolamine (DPPE), Dipalmitoylphosphatidylglycerol (DPPG), Dipalmitoylphosphatidylserine (DPPS), Distearylphosphatidylcholine (DSPC), Distearyl-phosphatidyl-ethanolamine (DSPE), Distearylphosphatidylethanolamine imidazole (DSPEI), 1,2-Diundecanoyl-sn-glycerol-phosphocholine (DUPC), Lecithinylcholine (EPC), Histamine distearylglycerol (HDSG), 1,2-Dipalmitoylglycerol-hemisuccinate-Nα-histidine-hemisuccinate (HistSuccDG), N-(5'-hydroxy-3'-oxopentyl)-10-12-tetradecanodiyneamide (h-Pegi-PCDA), 2-[l-hexyloxyethyl]-2-devinylpyromethesphophyllate-a (HPPH), hydrogenated soybean phosphatidylcholine (HSPC), 1,2-dipalmitoylglycerol-O-α-histidine-Nα-hemisuccinate (IsohistsuccDG), mannosylated dipalmitoylphosphatidylethanolamine (ManDOG), 1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine-N-[4-(p-maleimidemethyl)cyclohexane-formamide] (MCC-PE), 1,2-diphydanoyl-sn-glycerol-3-phosphate ethanolamine (ME 16:0) PE), 1-myristoyl-2-hydroxy-sn-glycerol-choline-phosphocholine (MHPC), thiol-reactive maleimide head lipids (e.g., 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine-N-[4-(p-maleimide phenyl)butyramide (MPB-PE)), nervonic acid (NA), sodium cholate (NaChol), 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine-N-dodecanoyl (NC12-DOPE), 1-oleoyl-2-cholesterol hemisuccinoyl-sn-glycerol-3-phosphocholine (OChemsPC), phosphatidylethanolamine lipids (PE), and PE lipids conjugated with polyethylene glycol (PEG). (e.g., polyethylene glycol-distearate phosphatidylethanolamine lipid (PEG-PE)), phosphatidylglycerol (PG), partially hydrogenated soybean phosphatidylcholine (PHSPC), phosphatidylinositol lipid (PI), phosphatidylinositol-4-phosphate (PIP), palmitoyl oleoyl phosphatidylcholine (POPC), phosphatidylethanolamine (POPE), palmitoyl oleoyl phosphatidylglycerol (POPG), phosphatidylserine (PS), lissamine rhodamine B-phosphatidylethanolamine lipid (Rh-PE), purified soybean-derived phospholipid mixture (SIOO), phosphatidylcholine (SM), 18-1-trans-PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), soybean phosphatidylcholine (SPC), sphingomyelin (SPM), α,α-trehalose-6,6'-dibenzenesulfonate (TDB), 1,2-dioleoyl-sn 1,2-Glycerol-3-phosphate ethanolamine (transDOPE), ((23S,5R)-3-(bis(hexadecyloxy)methoxy)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methylmethyl phosphate, 1,2-arachidonico-sn-glycerol-3-phosphate choline, 1,2-disarachidonico-sn-glycerol-3-phosphate ethanolamine, 1,2-Dicosahenoyl-sn-glycerol-3-phosphate choline, 1,2-Dicosahenoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleyl-sn-glycerol-3-phosphate choline, 1,2-dilinoleyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-distearateyl-sn-glycerol-3-phosphate ethanolamine, 16-O-monomethyl PE, 16-O-dimethyl PE, and dioleoylphosphatidylethanolamine.

[0672] B. Exemplary LNP Compositions

[0673] In some embodiments, the present invention provides an LNP comprising (a): at least one lipid of the present disclosure; (b) at least one PEG lipid; (c) at least one structural lipid; and (d) at least one non-ionizable lipid and / or zwitterionic lipid. In some embodiments, the LNP further comprises additional ionizable lipids besides compounds of any of the types described herein.

[0674] In some implementations, the PEG-lipid is selected from the group consisting of: PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, and PEG-DSPE.

[0675] In some implementations, the structural lipids are selected from the group consisting of: cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassinosteroids, tomatine, ursolic acid, and α-tocopherol.

[0676] In some embodiments, the non-ionizable lipids are phospholipids selected from the group consisting of: 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycerol-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycerol-3-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycerol-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine (DIPC), and 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine. 1,2-Diundecanoyl-sn-glycerol-3-phosphate choline (DPPC), 1,2-Diundecanoyl-sn-glycerol-3-phosphate choline (DUPC), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphate choline (POPC), 1,2-di-O-octadecenyl-sn-glycerol-3-phosphate choline (18:O diether PC), 1-oleoyl-2-cholesterol hemisuccinoyl-sn-glycerol-3-phosphate choline (OChemsPC), 1-hexadecyl-sn-glycerol-3-phosphate choline (C16 Lyso PC), 1,2-dilinoyl-sn-glycerol-3-phosphate choline, 1,2-disarachidonicoyl-sn-glycerol-3-phosphate choline, 1,2-docosahexaenooyl-sn-glycerol-3-phosphate choline, 1,2-diphydanoyl-sn-glycerol-3-phosphate ethanolamine (ME 16).0 PE), 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinolenoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-diarachidonicoyl-sn-glycerol-3-phosphate ethanolamine, 1,2-docosahexaenooyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dioleoyl-sn-glycerol-3-phosphate-rac-(1-glycerol) sodium salt (DOPG), (S)-2-ammonium-3-((((R)-2 Sodium α-phosphatidylserine (L-α-phosphatidylserine; brain PS), myristoyl phosphatidylcholine (DMPC), myristoyl phosphatidylethanolamine (DMPE), myristoyl phosphatidylglycerol (DMPG), dioleoyl-phosphatidylethanolamine 4-(N-maleimidemethyl)-cyclohexane-1-carboxylate (DOPE-mal), dioleoyl phosphatidylglycerol (DOPG), 1,2-dioleoyl-sn-glycerol-3-(phospho-L-serine) (DOPS), Cell Fusion Phospholipids (DPhPE), Dipalmitoylphosphatidylethanolamine (DPPE), Dipalmitoylphosphatidylglycerol (DPPG), Dipalmitoylphosphatidylserine (DPPS), Distearylphosphatidylcholine (DSPC), Distearyl-phosphatidyl-ethanolamine (DSPE), Distearylphosphatidylethanolamine imidazole (DSPEI), 1,2-Diundecanoyl-sn-glycerol-phosphocholine (DUPC), Lecithinylcholine (EPC), 1,2-Dioleoyl-sn-glycerol-3-phosphate (18:1 PA; DOPA), Bis((S)-2-hydroxy-3-(oleoyloxy)propyl)ammonium phosphate (18:1 DMP; LBPA), 1,2-Dioleoyl-sn-glycerol-3-phosphate-(1'-muscleinositol) (DOPI; 18:1) PI), 1,2-distearyl-sn-glycerol-3-phosphate-L-serine (18:0 PS), 1,2-dilinoleoyl-sn-glycerol-3-phosphate-L-serine (18:2 PS), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphate-L-serine (16:0-18:1 PS; POPS), 1-stearoyl-2-oleoyl-sn-glycerol-3-phosphate-L-serine (18:0-18:1 PS), 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphate-L-serine (18:0-18:2 PS), 1-oleoyl-2-hydroxy-sn-glycerol-3-phosphate-L-serine (18:1 Lyso PS), 1-stearoyl-2-hydroxy-sn-glycerol-3-phosphate-L-serine (18:0 Lyso PS) and sphingomyelin.

[0677] In some embodiments, the non-ionizable lipids are phospholipids selected from the group consisting of: egg sphingomyelin (egg SM / ESM / (2S,3R,E)-3-hydroxy-2-palmitoyl-octadecane-4-en-1-yl(2-(trimethylammonium)ethyl) phosphate), brain or porcine sphingomyelin (brain SM / (2S,3R,E)-3-hydroxy-2-stearoamide octadecane-4-en-1-yl(2-(trimethylammonium)ethyl) phosphate), milk or bovine sphingomyelin (milk SM / (2S,3R,E)-3-hydroxy-2-tricarbonamide octadecane-4-en-1-yl(2-(trimethylammonium)ethyl) phosphate), 28:0 SM (N-octadecanoyl-D-erythrosphocholine), 14:0 SM (N-myristoyl-D-erythrosphocholine), 16:1 SM (N-Palmyl-D-erythrosphocholine), 12:0 dihydroSM (N-Lauroyl-D-erythrosphocholine), Lyso SM (Sphingocholine), Lyso SM (Sphingocholine), Lyso SM (Dihydro) (Sphingocholine), 24:1 SM (N-Ceramide-D-erythrosphocholine), 24:0 SM (N-Teicosicoyl-D-erythrosphocholine), 18:1 SM (N-Oleoyl-D-erythrosphocholine), 18:0 SM (N-Stearyl-D-erythrosphocholine), 17:0 SM (N-Heptadecanyl-D-erythrosphocholine), 16:0 SM (N-Palmyl-D-erythrosphocholine), 12:0 SM (N-Lauroyl-D-erythrosphocholine), 06:0 SM (N-hexanoyl-D-erythrosphocholine), 02:0 SM (N-acetyl-D-erythrosphocholine), 3-O-methylLysoSM (3-O-methyl-sphocholine), 3-O-methyl-N-methylLyso SM (3-O-methyl-N-methyl-sphocholine) and 3-N-methylLyso SM (3-N-methyl-sphocholine).

[0678] In some embodiments, (a) the PEG lipid is PEG2k-DMG or PEG2k-DSPE or a mixture thereof; (b) the structural lipid is cholesterol; and (c) the phospholipid, non-ionizable lipid or zwitterionic lipid is a sphingolipid or DSPC or a mixture thereof.

[0679] In some embodiments, the lipid component of the nanoparticles comprises: (a) about 0 mol% to about 10 mol% PEG lipids; (b) about 0 mol% to about 30 mol% structural lipids; (c) about 20 mol% to about 45 mol% phospholipids, non-ionizable lipids, or zwitterionic lipids; and (d) about 30 mol% to about 60 mol% lipids of the present disclosure.

[0680] In some embodiments, the lipid component of the nanoparticles comprises: (a) about 1 mol% to about 2 mol% PEG lipids; (b) about 25 mol% to about 40 mol% structural lipids; (c) about 20 mol% to about 45 mol% phospholipids, non-ionizable lipids, or zwitterionic lipids; and (d) about 30 mol% to about 60 mol% lipids of the present disclosure.

[0681] In some embodiments, the lipid component of the nanoparticles comprises: (a) about 2 mol% PEG lipids; (b) about 25 mol% structural lipids; (c) about 40 mol% phospholipids, non-ionizable lipids, or zwitterionic lipids; and (d) about 33 mol% lipids of the present disclosure.

[0682] In some embodiments, the lipid component of the nanoparticles comprises: (a) about 2.5 mol% PEG lipids; (b) about 39 mol% structural lipids; (c) about 10 mol% phospholipids, non-ionizable lipids, or zwitterionic lipids; and (d) about 48.5 mol% lipids of the present disclosure.

[0683] In some embodiments, the lipid component of the nanoparticles comprises: (a) about 1.5 mol% PEG lipids; (b) about 40 mol% structural lipids; (c) about 10 mol% phospholipids, non-ionizable lipids, or zwitterionic lipids; and (d) about 48.5 mol% lipids of the present disclosure.

[0684] In some embodiments, the lipid component of the nanoparticle composition comprises about 30 mol% to about 60 mol% ionizable lipids, about 0 mol% to about 30 mol% phospholipids, about 18.5 mol% to about 48.5 mol% structural lipids, and about 0 mol% to about 10 mol% PEG lipids, provided that the total mol% does not exceed 100%. In some embodiments, the lipid component of the nanoparticle composition comprises about 20 mol% to about 45 mol% ionizable lipids, about 30 mol% to about 60 mol% phospholipids, about 10 mol% to about 30 mol% structural lipids, and about 0 mol% to about 10 mol% PEG lipids, provided that the total mol% does not exceed 100%. In some embodiments, the lipid component of the nanoparticle composition comprises about 35 mol% to about 55 mol% ionizable lipids, about 5 mol% to about 25 mol% phospholipids, about 30 mol% to about 40 mol% structural lipids, and about 0 mol% to about 10 mol% PEG lipids, provided that the total mol% does not exceed 100%. In some embodiments, the lipid component of the nanoparticle composition comprises about 30 mol% to about 40 mol% ionizable lipids, about 35 mol% to about 45 mol% phospholipids, about 20 mol% to about 30 mol% structural lipids, and about 0.5 mol% to about 5 mol% PEG lipids, provided that the total mol% does not exceed 100%. In some embodiments, the lipid component of the nanoparticle composition comprises about 25 mol% to about 45 mol% ionizable lipids, about 35 mol% to about 50 mol% phospholipids, about 10 mol% to about 25 mol% structural lipids, and about 1 mol% to about 5 mol% PEG lipids, provided that the total mol% does not exceed 100%. In a specific embodiment, the lipid component comprises about 50 mol% ionizable lipids, about 10 mol% phospholipids, about 38.5 mol% structural lipids, and about 1.5 mol% PEG lipids. In another specific embodiment, the lipid component comprises about 40 mol% ionizable lipids, about 20 mol% phospholipids, about 38.5 mol% structural lipids, and about 1.5 mol% PEG lipids. In another specific embodiment, the lipid component comprises approximately 48.5 mol% ionizable lipids, approximately 10 mol% phospholipids, approximately 40 mol% structured lipids, and approximately 1.5 mol% PEG lipids. In yet another specific embodiment, the lipid component comprises approximately 48.5 mol% ionizable lipids, approximately 10 mol% phospholipids, approximately 39 mol% structured lipids, and approximately 2.5 mol% PEG lipids.In another specific embodiment, the lipid component comprises approximately 33 mol% ionizable lipids, approximately 40 mol% phospholipids, approximately 25 mol% structural lipids, and approximately 2 mol% PEG lipids. In some embodiments, the phospholipids are DOPE or DSPC. In some embodiments, the phospholipids are DSPC. In some embodiments, the phospholipids are sphingolipids. In some embodiments, the phospholipids are sphingomyelin. In other embodiments, the PEG lipids are PEG-DMG (e.g., PEG2K-DMG). In other embodiments, the PEG lipids are PEG-DSPE (e.g., PEG2K-DSPE). In other embodiments, the PEG lipids are PEG-DMPE (e.g., PEG2K-DMPE). In other embodiments, the structural lipids are cholesterol. In other embodiments, the PEG lipids are PEG-DMG and / or the structural lipids are cholesterol. In some embodiments, the PEG lipids are PEG2K-DMG, the structural lipids are cholesterol, and the phospholipids are DSPC. In some embodiments, the PEG lipids are PEG2K-DMG, the structural lipids are cholesterol, and the phospholipids are sphingomyelin. In some embodiments, the PEG lipid is PEG-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of DSPC and sphingomyelin. In some embodiments, the LNP comprises about 33 mol% ionizable lipids (e.g., at least one ionizable lipid of the formula described herein), about 40 mol% sphingomyelin, about 25 mol% cholesterol, and about 2 mol% PEG2K-DMG. In some embodiments, the PEG lipid is PEG2K-DSPE, the structural lipid is cholesterol, and the phospholipid is DSPC. In some embodiments, the PEG lipid is PEG2K-DSPE, the structural lipid is cholesterol, and the phospholipid is sphingomyelin. In some embodiments, the PEG lipid is PEG-DSPE, the structural lipid is cholesterol, and the phospholipid is a mixture of DSPC and sphingomyelin. In some embodiments, the PEG lipid is PEG2K-DMG, the structural lipid is cholesterol, and the phospholipid is DOPE. In some embodiments, the PEG lipid is PEG2K-DMG, the structural lipid is cholesterol, and the phospholipid is DOPC. In some embodiments, the PEG lipid is PEG2K-DMG, the structural lipid is cholesterol, and the phospholipid is DLPC. In some embodiments, the PEG lipid is PEG2K-DMG, the structural lipid is cholesterol, and the phospholipid is DOPS. In some embodiments, the PEG lipid is PEG-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of phosphatidylcholine lipids and sphingolipids. In some embodiments, the PEG lipid is PEG-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of phosphatidylcholine lipids and phosphatidylserine lipids.In some embodiments, the PEG lipid is PEG-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of phosphatidylcholine lipids and phosphoethanolamine lipids. In some embodiments, the PEG lipid is PEG-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of sphingolipids and phosphatidylserine lipids. In some embodiments, the PEG lipid is PEG-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of sphingolipids and phosphoethanolamine lipids. In some embodiments, the LNP comprises about 33 mol% ionizable lipids, about 20 mol% sphingolipids, about 20 mol% non-sphingolipid phospholipids, about 25 mol% cholesterol, and about 2 mol% polyethylene glycol-modified lipids. In some embodiments, the LNP comprises about 33 mol% ionizable lipids, about 10 mol% sphingolipids, about 30 mol% non-sphingolipid phospholipids, about 25 mol% cholesterol, and about 2 mol% polyethylene glycol-modified lipids. In some embodiments, the LNP comprises approximately 33 mol% ionizable lipids, approximately 30 mol% sphingolipids, approximately 10 mol% non-sphingolipid phospholipids, approximately 25 mol% cholesterol, and approximately 2 mol% PEGylated lipids. In some embodiments, the LNP comprises approximately 33 mol% ionizable lipids, approximately 20 mol% sphingolipids, approximately 20 mol% DSPC, approximately 25 mol% cholesterol, and approximately 2 mol% PEGylated lipids. In some embodiments, the LNP comprises approximately 33 mol% ionizable lipids, approximately 10 mol% sphingolipids, approximately 30 mol% DSPC, approximately 25 mol% cholesterol, and approximately 2 mol% PEGylated lipids. In some embodiments, the LNP comprises approximately 33 mol% ionizable lipids, approximately 30 mol% sphingolipids, approximately 10 mol% DSPC, approximately 25 mol% cholesterol, and approximately 2 mol% PEGylated lipids. In some embodiments, the LNP comprises about 33 mol% ionizable lipids, about 25 mol% cholesterol, about 2 mol% PEGylated lipids, and about 40% a mixture of phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingosine lipids. In some embodiments, the LNP comprises about 33 mol% ionizable lipids, about 25 mol% cholesterol, about 2 mol% PEGylated lipids, and about 40% a mixture of phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingosine lipids, wherein the amount of each of the phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingosine lipids is less than 30 mol% of the total lipid component of the LNP. In some embodiments, the LNP comprises about 33 mol% ionizable lipids, about 25 mol% cholesterol, about 2 mol% polyethylene glycol-modified lipids, and about 40% a mixture of phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingosine lipids, wherein the amount of each of the phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingosine lipids is less than 25 mol of the total lipid component of the LNP.In some embodiments, LNP is any of the foregoing terms in this paragraph, wherein the PEG lipid is PEG2k-DMG. In some embodiments, LNP is any of the foregoing terms in this paragraph, wherein the PEG lipid is PEG2k-DSPE.

[0685] In another specific embodiment, the LNP comprises approximately 33 mol% ionizable lipids, approximately 40 mol% DSPC, approximately 25 mol% cholesterol, and approximately 2 mol% PEG lipids. In another specific embodiment, the LNP comprises approximately 33 mol% ionizable lipids, approximately 40 mol% sphingomyelin, approximately 25 mol% cholesterol, and approximately 2 mol% PEG lipids. In another specific embodiment, the LNP comprises approximately 33 mol% ionizable lipids, approximately 40 mol% DOPE, approximately 25 mol% cholesterol, and approximately 2 mol% PEG lipids. In another specific embodiment, the LNP comprises approximately 33 mol% ionizable lipids, approximately 40 mol% DOPC, approximately 25 mol% cholesterol, and approximately 2 mol% PEG lipids. In another specific embodiment, the LNP comprises approximately 33 mol% ionizable lipids, approximately 40 mol% DLPC, approximately 25 mol% cholesterol, and approximately 2 mol% PEG lipids. In another specific embodiment, the LNP comprises approximately 33 mol% ionizable lipids, approximately 40 mol% DOPS, approximately 25 mol% cholesterol, and approximately 2 mol% PEG lipids. In another specific embodiment, the LNP comprises approximately 33 mol% ionizable lipids, approximately 40 mol% phospholipids, approximately 25 mol% cholesterol, and approximately 2 mol% PEG lipids. In another specific embodiment, the LNP comprises approximately 33 mol% ionizable lipids, approximately 20 mol% sphingomyelin, approximately 20 mol% DSPC, approximately 25 mol% cholesterol, and approximately 2 mol% PEG lipids. In some embodiments, the LNP is any of the foregoing components in this paragraph, wherein the PEG lipid is PEG2k-DMG. In some implementations, LNP is any of the preceding terms in this paragraph, wherein the PEG lipid is PEG2k-DSPE.

[0686] In some embodiments, the LNP comprises about 43 mol% ionizable lipids, about 15 mol% sphingolipids, about 15 mol% non-sphingolipid phospholipids, about 25 mol% cholesterol, and about 2 mol% PEGylated lipids. In some embodiments, the LNP comprises about 33 mol% ionizable lipids, about 25 mol% sphingolipids, about 15 mol% non-sphingolipid phospholipids, about 25 mol% cholesterol, and about 2 mol% PEGylated lipids. In some embodiments, the LNP comprises about 33 mol% ionizable lipids, about 15 mol% sphingolipids, about 25 mol% non-sphingolipid phospholipids, about 25 mol% cholesterol, and about 2 mol% PEGylated lipids. In some embodiments, the PEG lipid is PEG2K-DSPE, the structural lipid is cholesterol, and the phospholipid is a mixture of DSPC and sphingolipids. In some embodiments, the PEG lipid is PEG2K-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of DSPC and sphingolipids. In some embodiments, the LNP comprises approximately 48.5 mol% ionizable lipids, approximately 10 mol% phospholipids (such as DSPC), approximately 40 mol% cholesterol, and approximately 1.5 mol% PEG2K-DSPE. In some embodiments, the LNP comprises approximately 48.5 mol% ionizable lipids, approximately 10 mol% phospholipids (such as DSPC), approximately 40 mol% cholesterol, and approximately 1.5 mol% PEG2K-DMG. In some embodiments, the LNP comprises approximately 48.5 mol% ionizable lipids, approximately 10 mol% phospholipids (such as DSPC), approximately 39 mol% cholesterol, and approximately 2.5 mol% PEG2K-DSPE.

[0687] In another specific embodiment, the lipid component comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids, about 38.5 mol% structured lipids, and about 3 mol% PEG lipids. In another specific embodiment, the lipid component comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids, about 38 mol% structured lipids, and about 3.5 mol% PEG lipids. In some embodiments, the PEG lipid is PEG2K-DPPE, the structured lipid is cholesterol, and the phospholipid is DSPC or a mixture of DSPC and sphingomyelin. In some embodiments, the PEG lipid is PEG2K-DPPE, the structured lipid is cholesterol, and the phospholipid is a mixture of DSPC and sphingomyelin. In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 40 mol% cholesterol, and about 1.5 mol% PEG2K-DPPE. In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 39.5 mol% cholesterol, and about 2 mol% PEG2K-DPPE. In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 39 mol% cholesterol, and about 2.5 mol% PEG2K-DPPE. In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 38.5 mol% cholesterol, and about 3 mol% PEG2K-DPPE. In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 38 mol% cholesterol, and about 3.5 mol% PEG2K-DPPE. In some embodiments, the PEG lipid is PEG2K-DMG, the structural lipid is cholesterol, and the phospholipid is DSPC or a mixture of DSPC and sphingomyelin. In some embodiments, the PEG lipid is PEG2K-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of DSPC and sphingomyelin. In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 40 mol% cholesterol, and about 1.5 mol% PEG2K-DMG. In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 39.5 mol% cholesterol, and about 2 mol% PEG2K-DMG.In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 39 mol% cholesterol, and about 2.5 mol% PEG2K-DMG. In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 38.5 mol% cholesterol, and about 3 mol% PEG2K-DMG. In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 38 mol% cholesterol, and about 3.5 mol% PEG2K-DMG. In some embodiments, the PEG lipid is PEG2K-DSPE, the structural lipid is cholesterol, and the phospholipid is DSPC or a mixture of DSPC and sphingomyelin. In some embodiments, the PEG lipid is PEG2K-DSPE, the structural lipid is cholesterol, and the phospholipid is a mixture of DSPC and sphingomyelin. In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 40 mol% cholesterol, and about 1.5 mol% PEG2K-DSPE. In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 39.5 mol% cholesterol, and about 2 mol% PEG2K-DSPE. In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 39 mol% cholesterol, and about 2.5 mol% PEG2K-DSPE. In some embodiments, the LNP comprises about 48.5 mol% ionizable lipids, about 10 mol% phospholipids (such as DSPC), about 38.5 mol% cholesterol, and about 3 mol% PEG2K-DSPE. In some implementations, LNP contains approximately 48.5 mol% ionizable lipids, approximately 10 mol% phospholipids (such as DSPC), approximately 38 mol% cholesterol, and approximately 3.5 mol% PEG2K-DSPE.

[0688] In some embodiments, the LNP further includes a targeting portion. In some embodiments, the targeting portion is an antibody or a fragment thereof.

[0689] The amount of active agent in the nanoparticle composition can be determined by the size, composition, desired target and / or application, or other characteristics of the nanoparticle composition, as well as the properties of the active agent. For example, the amount of active agent available in the nanoparticle composition can be determined by the size, sequence, and other characteristics of the active agent. The relative amounts of active agents and other elements (e.g., lipids) in the nanoparticle composition may also vary. In some embodiments, the weight / weight ratio of the lipid component to the payload in the nanoparticle composition is from about 5:1 to about 60:1, such as 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. The amount of effective load in the nanoparticle composition can be measured, for example, using absorption spectroscopy (e.g., ultraviolet-visible spectroscopy).

[0690] In some embodiments, the nanoparticle compositions of this disclosure are formulated to provide a specific N:P ratio. The N:P ratio of the composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in an RNA activator (e.g., a linear or circular mRNA payload). Generally, a lower N:P ratio is preferred. One or more enzymes, lipids, and their amounts are selected to provide an N:P ratio of about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In some embodiments, the N:P ratio is about 2:1 to about 8:1. In other embodiments, the N:P ratio is about 5:1 to about 8:1. For example, the N:P ratio is approximately 5.0:1, approximately 5.5:1, approximately 5.67:1, approximately 6.0:1, approximately 6.5:1, or approximately 7.0:1.

[0691] The dosage of the pharmaceutical compositions provided herein can be measured in mg / kg, where mg refers to the total nucleic acid (total mRNA mg / kg) used to prepare the LNP per kg of subject body weight. In some embodiments, the pharmaceutical composition is present in a dosage form at a dose of about 10, 9, 8, 7, 6, 5, 4, 3, 2, 1.5, 1.0, 0.5, 0.2, 0.1, 0.05, 0.02, 0.01, 0.005, 0.002, or 0.001 mg / kg (mg / kg or mpk) of body weight, or in the range between any two of the foregoing values. In some embodiments, the pharmaceutical composition is present in a dosage form at a dose not exceeding about 10 mg / kg (mg / kg or mpk) of body weight. In some embodiments, the pharmaceutical composition is present in a dosage form at a dose not exceeding about 9 mg / kg, not exceeding about 8 mg / kg, not exceeding about 7 mg / kg, not exceeding about 6 mg / kg, not exceeding about 5 mg / kg, not exceeding about 4 mg / kg, not exceeding about 3 mg / kg, not exceeding about 2 mg / kg, not exceeding about 1 mg / kg, not exceeding about 0.5 mg / kg, not exceeding about 0.2 mg / kg, not exceeding about 0.1 mg / kg, not exceeding about 0.05 mg / kg, or not exceeding about 0.01 mg / kg.

[0692] In some embodiments, the pharmaceutical composition is present in the dosage form at a concentration not exceeding about 5 mg / mL. In some embodiments, the pharmaceutical composition is present in the dosage form at a concentration of about 5, 4, 3, 2, 1, 0.5, 0.2, or 0.1 mg / mL, or in the range between any two of the foregoing values ​​(inclusive).

[0693] In some embodiments, the pharmaceutical composition is present in the dosage form at a concentration not exceeding about 5 mg / mL. In some embodiments, the pharmaceutical composition is present in the dosage form at a concentration not exceeding about 2 mg / mL. In some embodiments, the pharmaceutical composition is present in the dosage form at a concentration not exceeding about 1 mg / mL. In some embodiments, the pharmaceutical composition is present in the dosage form at a concentration not exceeding about 0.5 mg / mL. In some embodiments, the pharmaceutical composition is present in the dosage form at a concentration not exceeding about 0.1 mg / mL.

[0694] In some embodiments, the pharmaceutical composition is present in the dosage form at a concentration of about 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.5, 0.2, or 0.1 micrograms per milliliter (μg / mL), or in the range of any two of the foregoing values ​​(inclusive). In some embodiments, the pharmaceutical composition is present in the dosage form at a concentration not exceeding about 10, not exceeding about 9, not exceeding about 8, not exceeding about 7, not exceeding about 6, not exceeding about 5, not exceeding about 4, not exceeding about 3, not exceeding about 2, not exceeding about 1, not exceeding about 0.5, not exceeding about 0.2, or not exceeding about 0.1 micrograms per milliliter (μg / mL).

[0695] The characteristics of nanoparticle compositions can vary depending on their components. For example, a nanoparticle composition containing cholesterol as a structural lipid may have different characteristics than a nanoparticle composition containing different structural lipids. Similarly, the characteristics of a nanoparticle composition can vary depending on the absolute or relative amount of its components. For example, a nanoparticle composition containing a higher molar fraction of phospholipids may have different characteristics than a nanoparticle composition containing a lower molar fraction of phospholipids. Characteristics can also vary depending on the preparation method and conditions of the nanoparticle composition. Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure the zeta potential. Dynamic light scattering can also be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure various characteristics of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.

[0696] In some embodiments, the average size of the nanoparticle composition is in the range of tens to hundreds of nanometers, for example, measured by dynamic light scattering (DLS). For example, the average size can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average size of the nanoparticle composition is about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In some embodiments, the average size of the nanoparticle composition is about 70 nm to about 100 nm. In a specific embodiment, the average size is about 80 nm. In other embodiments, the average size is about 100 nm.

[0697] In some embodiments, the LNP of this disclosure can be characterized by its shape. In some embodiments, the LNP is substantially spherical. In some embodiments, the LNP is substantially rod-shaped (i.e., cylindrical). In some embodiments, the LNP is substantially disk-shaped.

[0698] The nanoparticle composition can be relatively homogeneous. The polydispersity index can be used to indicate the uniformity of the nanoparticle composition, such as its particle size distribution. A smaller polydispersity index (e.g., less than 0.3) generally indicates a narrower particle size distribution. The polydispersity index of the nanoparticle composition can be from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25.

[0699] The zeta potential of a nanoparticle composition can be used to indicate the electrodynamic potential of the composition. For example, the zeta potential can describe the surface charge of the nanoparticle composition. Nanoparticle compositions are generally desirable to have relatively low charge (positive or negative) because species with higher charges can engage in undesirable interactions with cells, tissues, and other components in the body. In some embodiments, the zeta potential of the nanoparticle composition is about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0700] Encapsulation efficiency describes the amount of payload encapsulated or associated with the nanoparticle composition after preparation, relative to the initial amount provided. High encapsulation efficiency (e.g., close to 100%) is desirable. For example, encapsulation efficiency can be measured by comparing the amount of payload in a solution containing the nanoparticle composition before and after decomposition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free payload in solution. For the nanoparticle compositions described herein, the encapsulation efficiency for treatment and / or prevention may be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency is at least 80%. In some embodiments, the encapsulation efficiency is at least 90%.

[0701] Lipids and methods for their preparation are disclosed in, for example, the following patents and documents: U.S. Patent Nos. 8,569,256 and 5,965,542, and U.S. Patent Publications Nos. 2016 / 0199485, 2016 / 0009637, 2015 / 0273068, 2015 / 0265708, 2015 / 0203446, 2015 / 0005363, 2014 / 0308304, and 2014 / 0 No. 200257, No. 2013 / 086373, No. 2013 / 0338210, No. 2013 / 0323269, No. 2013 / 0245107, No. 2013 / 0195920, No. 2013 / 0123338, No. 2013 / 0022649, No. 2013 / 0017223, No. 2012 / 0295832, No. 2012 / 0183581, No. 2012 / 0172411 Numbers: 2012 / 0027803, 2012 / 0058188, 2011 / 0311583, 2011 / 0311582, 2011 / 0262527, 2011 / 0216622, 2011 / 0117125, 2011 / 0091525, 2011 / 0076335, 2011 / 0060032, 2010 / 0130588, 2 Nos. 007 / 0042031, 2006 / 0240093, 2006 / 0083780, 2006 / 0008910, 2005 / 0175682, 2005 / 017054, 2005 / 0118253, 2005 / 0064595, 2004 / 0142025, 2007 / 0042031, 1999 / 009076 and PCT Announcement No. WO The entire disclosure of the patents and documents mentioned herein is incorporated herein by reference for all purposes. (References 99 / 39741, WO2017 / 117528, WO2017 / 004143, WO2017 / 075531, WO2015 / 199952, WO2014 / 008334, WO2013 / 086373, WO2013 / 086322, WO2013 / 016058, WO2013 / 086373, WO2011 / 141705, and WO2001 / 07548, and Semple et al., Nature Biotechnology, 2010, 28, 172-176, are hereby incorporated herein by reference in their entirety.)

[0702] Nanoparticle compositions may contain any substance useful in a pharmaceutical composition. For example, a nanoparticle composition may contain one or more pharmaceutically acceptable excipients or auxiliary ingredients, such as, but not limited to, one or more solvents, dispersion media, diluents, dispersants, suspending agents, granulation aids, disintegrants, fillers, flow aids, liquid media, binders, surfactants, isotonic agents, thickeners or emulsifiers, buffers, lubricants, oils, preservatives, and other substances. Excipients may also be included, such as waxes, butters, colorants, coating agents, flavoring agents, and aromatizers. Pharmaceutically acceptable excipients are well known in the art (see, for example, Remington's *The Science and Practice of Pharmacy*, 21st edition, AR Gennaro: Lippincott, Williams & Wilkins, Baltimore, Md., 2006).

[0703] III. LNP payload

[0704] This specification describes compositions, methods, processes, kits, and devices for selecting, designing, preparing, manufacturing, formulating, and / or using LNP-based RNA drugs (e.g., vaccines, gene therapies, or gene-editing therapeutics). In various embodiments, the LNP-based RNA drug comprises an LNP delivery system (as detailed herein) and an encapsulated cargo / payload (e.g., RNA in the case of an RNA drug).

[0705] In the case of RNA drugs, the payload may be one or more RNA molecules, including coding RNA (e.g., linear or circular mRNA) or non-coding RNA (e.g., guide RNA, pegRNA, or reverse transcriptase ncRNA).

[0706] In various other embodiments, the payload may include any type of nucleic acid molecule, including coding RNA molecules (e.g., mRNA), guide RNA for the editing system (e.g., Cas9 guide, Cas12a guide, base editor guide, and leader editor guide), other non-coding RNAs associated with the editing system (e.g., reverse transcriptase ncRNA), small RNAs (sRNAs)—which refer to various polymeric RNA molecules (such as RNA interference) typically less than 200 nucleotides in length and having various functions, including small interfering RNAs (siRNA), microRNAs (miRNA), piwi-interacting RNAs (piRNA), repeat-associated small interfering RNAs (rasiRNA), small nuclear RNAs (snRNA or U-RNA), small nucleolar RNAs (snoRNA), small rDNA-derived RNAs (srRNA), rRNA fragments (tRF), and Y RNA-derived small RNAs, tRNAs, rRNAs, and self-amplifying RNAs (saRNAs)—and DNA molecules, such as DNA vectors, DNA plasmids, HDR donors, oligonucleotides, primers, etc., as well as chimeric molecules containing both DNA and RNA. The cargo nucleic acid molecule may be single-stranded or double-stranded. This type of nucleic acid shipment may contain exactly one molecule. This type of nucleic acid shipment may contain exactly two molecules. This type of nucleic acid shipment may contain exactly three molecules. This type of nucleic acid shipment may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different molecules. This type of nucleic acid shipment may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 different molecules. This type of nucleic acid shipment may contain 1-25, 5-30, 10-35, 20-40, or up to 100 or more different molecules.

[0707] In various other respects, the LNPs described herein can be used to deliver any payload of interest to biological targets, such as cells or body tissues. The term "payload" refers to an active substance (i.e., not limited to RNA or DNA), such as small molecules, polypeptides, peptides, carbohydrates, or nucleic acid molecules, and includes, but is not limited to, mRNA molecules (including linear and circular mRNAs) or non-coding RNA molecules (e.g., guide RNA, pegRNA, reverse transcriptase ncRNA) encapsulated within the LNPs described herein. In some embodiments, the LNP cargo may comprise an RNP or a ribonucleoprotein, such as a gene-editing nuclease protein complexed with homologous guide RNA.

[0708] In various embodiments, the payload is an RNA molecule, which may be linear or circular, and may contain one or more functional nucleotide sequences of interest, including but not limited to coding and non-coding nucleotide sequences. In various embodiments, in addition to other sequence elements that can affect the function of the RNA or its encoded products, the non-coding nucleotide sequences may also contain regulatory elements affecting post-transcriptional processing of RNA, nuclear translation control sequences, and sequences encoding one or more biological products of interest (e.g., therapeutic proteins or antigens). As used herein, the terms “coding region of interest” or “product coding region” can be used to refer to one or more biological products of interest. Equivalently, the product coding region may be referred to as the “product expression sequence.”

[0709] In the various embodiments described herein, the “starter construct” (or “starter polynucleotide construct”) and “benchmark construct” (or “benchmark polynucleotide construct”) mentioned herein are embodiments that contain a payload of a nucleic acid molecule, i.e., embodiments that contain a linear and / or circular mRNA payload, and may contain product coding regions encoding polypeptides, such as, but not limited to, antigens or therapeutic proteins or components of gene editing systems (e.g., programmable nucleases).

[0710] Figure 2 Examples of starter constructs 100, which may be linear or circular mRNA molecules, are shown. The starter construct 100 may include at least one product-coding region 10, which is or encodes a polypeptide of interest, such as, but not limited to, a vaccine antigen or a therapeutic protein. The starter construct 100 may contain one or two side regions 20. The side regions 20 may be located on the 5' side and / or the 3' side of the product-coding region 10. In some cases, the starter construct 100 does not contain side regions 20. The side regions 20 of the starter construct 100 may include at least one regulatory region 30. At least one side region 20 of the starter polynucleotide construct 100 may include at least one identifier region 40. The identifier region 40 may be, but is not limited to, a barcode, a marker, a signal, and / or a tag. Additionally, the identifier region 40 may be located within the product-coding region 10 or may be located within the product-coding region 10 and at least one side region 20.

[0711] In some implementations, the length of the starter construct comprises about 5 to about 10,000 nucleotides. As a non-limiting example, the length of the starter construct can be 5 to 30, 5 to 50, 5 to 100, 5 to 250, 5 to 500, 5 to 1,000, 5 to 1,500, 5 to 3,000, 5 to 5,000, 5 to 7,000, 5 to 10,000, 30 to 50, 30 to 100, 30 to 250, 30 to 500, 30 to 1,000, 30 to 1,5 ... 00, 30 to 3,000, 30 to 5,000, 30 to 7,000, 30 to 10,000, 100 to 250, 100 to 500, 100 to 1,000, 100 to 1,500, 100 to 3,000, 100 to 5,000, 100 to 7,000, 100 to 10,000, 500 to 1,000, 500 to 1,500, 500 to 2 ,000, 500 to 3,000, 500 to 5,000, 500 to 7,000, 500 to 10,000, 1,000 to 1,500, 1,000 to 2,000, 1,000 to 3,000, 1,000 to 5,000, 1,000 to 7,000, 1,000 to 10,000, 1,500 to 3,000, 1,500 to 5,000, 1,500 to 5,000, 1,500 to 3,000 0 to 7,000, 1,500 to 10,000, 2,000 to 3,000, 2,000 to 5,000, 2,000 to 7,000, 2,000 to 10,000, 3,000 to 5,000, 3,000 to 7,000, 3,000 to 10,000, 5,000 to 7,000, 5,000 to 10,000, and 7,000 to 10,000 nucleotides.

[0712] In some implementations, the length of the product coding region is greater than about 5 nucleotides, such as, but not limited to, lengths of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 1... 80, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, or more than 10,000 nucleotides.

[0713] In some implementations, the length of the side-linked region can independently range from 0 to 10,000 nucleotides, such as, but not limited to, lengths of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 12 0, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, and 10,000 nucleotides.

[0714] In some implementations, the length of the regulatory region can independently range from 0 to 3,000 nucleotides, such as, but not limited to, lengths of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 45, 50, and 55 nucleotides. 1, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides.

[0715] In some implementations, the starting construct may be circularized. In other implementations, the starting construct may be multiplied.

[0716] A starting construct that includes at least one identifier 40 or "identifier region" 40 (e.g., barcode, marker, signal, and / or label) may also be referred to as a "baseline construct" or "baseline polynucleotide construct". A baseline construct may contain one, two, three, four, five, six, seven, eight, nine, or ten or more identifiers, which may be the same or different throughout the baseline polynucleotide construct.

[0717] In some implementations, the length of the identifier region can independently range from 1 to 3,000 nucleotides, such as, but not limited to, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 45, 50, and 55 nucleotides. 1, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000.As a non-limiting example, the length of the identifier region can be 1-5 residues, 2-5 residues, 3-5 residues, 2-7 residues, 3-7 residues, 1-10 residues, 2-10 residues, 3-10 residues, 5-10 residues, 7-10 residues, 1-15 residues, 2-15 residues, 3-15 residues, 5-15 residues, 7-15 residues, 10-15 residues, 12-15 residues, 1-20 residues, 2-20 residues, 3-20 residues, 5-20 residues, 7-20 residues, 10-20 residues, 12-20 residues, 15-20 residues, 17-20 residues, 1-25 residues, 2-25 residues, 3 -25 residues, 5-25 residues, 7-25 residues, 10-25 residues, 12-25 residues, 15-25 residues, 17-25 residues, 20-25 residues, 1-30 residues, 2-30 residues, 3-30 residues, 5-30 residues, 7-30 residues, 10-30 residues, 12-30 residues, 15-30 residues, 17-30 residues, 20-30 residues, 25-30 residues, 1-35 residues, 2-35 residues, 3-35 residues, 5-35 residues, 7-35 residues, 10-35 residues, 12-35 residues, 15-35 residues, 17-35 residues, 20-35 residues Residues, 25-35 residues, 30-35 residues, 1-35 residues, 2-35 residues, 3-35 residues, 5-35 residues, 7-35 residues, 10-35 residues, 12-35 residues, 15-35 residues, 17-35 residues, 20-35 residues, 25-35 residues, 30-35 residues, 1-40 residues, 2-40 residues, 3-40 residues, 5-40 residues, 7-40 residues, 10-40 residues, 12-40 residues, 15-40 residues, 17-40 residues, 20-40 residues, 25-40 residues, 30-40 residues, 35-40 residues, 1-45 residues 2-45 residues, 3-45 residues, 5-45 residues, 7-45 residues, 10-45 residues, 12-45 residues, 15-45 residues, 17-45 residues, 20-45 residues, 25-45 residues, 30-45 residues, 35-45 residues, 40-45 residues, 1-50 residues, 2-50 residues, 3-50 residues, 5-50 residues, 7-50 residues, 10-50 residues, 12-50 residues, 15-50 residues, 17-50 residues, 20-50 residues, 25-50 residues, 30-50 residues, 35-50 residues, 40-50 residues, or 45-50 nucleotides.

[0718] In some implementations, the identifier region in the baseline construct overlaps with the product coding region. As used herein, "overlap" means that at least one nucleotide of the identifier region extends into the product coding region. In some aspects, the identifier region overlaps with the product coding region by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 ​​nucleotides, 49 nucleotides, 50 nucleotides or more. In some respects, the identifier region overlaps with the product coding region by 1-5 nucleotides, 2-5 nucleotides, 3-5 nucleotides, 2-7 nucleotides, 3-7 nucleotides, 1-10 nucleotides, 2-10 nucleotides, 3-10 nucleotides, 5-10 nucleotides, 7-10 nucleotides, 1-15 nucleotides, 2-15 nucleotides, 3-15 nucleotides, 5-15 nucleotides, 7-15 nucleotides, 10-15 nucleotides, 12-15 nucleotides, 1-20 nucleotides, 2-20 nucleotides, 3-20 nucleotides, 5-20 nucleotides, 7-20 nucleotides, 10-20 nucleotides, 12-20 nucleotides, 15-20 nucleotides, 17-20 nucleotides, 1-25 nucleotides, 2-25 nucleotides, 3-25 nucleotides, 5-25 nucleotides. 1 nucleotide, 7-25 nucleotides, 10-25 nucleotides, 12-25 nucleotides, 15-25 nucleotides, 17-25 nucleotides, 20-25 nucleotides, 1-30 nucleotides, 2-30 nucleotides, 3-30 nucleotides, 5-30 nucleotides, 7-30 nucleotides, 10-30 nucleotides, 12-30 nucleotides, 15-30 nucleotides, 17-30 nucleotides, 20-30 nucleotides, 25-30 nucleotides, 1-35 nucleotides, 2-35 nucleotides, 3-35 nucleotides, 5-35 nucleotides, 7-35 nucleotides, 10-35 nucleotides, 12-35 nucleotides, 15-35 nucleotides, 17-35 nucleotides, 20-35 nucleotides, 25-35 nucleotides, 30-35 nucleotides1-35 nucleotides, 2-35 nucleotides, 3-35 nucleotides, 5-35 nucleotides, 7-35 nucleotides, 10-35 nucleotides, 12-35 nucleotides, 15-35 nucleotides, 17-35 nucleotides, 20-35 nucleotides, 25-35 nucleotides, 30-35 nucleotides, 1-40 nucleotides, 2-40 nucleotides, 3-40 nucleotides, 5-40 nucleotides, 7-40 nucleotides, 10-40 nucleotides, 12-40 nucleotides, 15-40 nucleotides, 17-40 nucleotides, 20-40 nucleotides, 25-40 nucleotides, 30-40 nucleotides, 35-40 nucleotides, 1-45 nucleotides, 2-45 nucleotides, 3- 45 nucleotides, 5-45 nucleotides, 7-45 nucleotides, 10-45 nucleotides, 12-45 nucleotides, 15-45 nucleotides, 17-45 nucleotides, 20-45 nucleotides, 25-45 nucleotides, 30-45 nucleotides, 35-45 nucleotides, 40-45 nucleotides, 1-50 nucleotides, 2-50 nucleotides, 3-50 nucleotides, 5-50 nucleotides, 7-50 nucleotides, 10-50 nucleotides, 12-50 nucleotides, 15-50 nucleotides, 17-50 nucleotides, 20-50 nucleotides, 25-50 nucleotides, 30-50 nucleotides, 35-50 nucleotides, 40-50 nucleotides, or 45-50 nucleotides.

[0719] In some implementations, the baseline polynucleotide construct includes a product coding region and an identifier region. The identifier region may be located at the 5' end or the 3' end of the product coding region, or the identifier region may overlap with the 5' end or the 3' end of the product coding region.

[0720] In some implementations, the baseline polynucleotide construct includes a product coding region and two identifier regions. Each identifier region may be located independently at the 5' end or the 3' end of the product coding region, or the identifier region may overlap with the 5' end or the 3' end of the product coding region.

[0721] As a non-limiting example, the first identifier area is located at 5' of the product coding area, and the second identifier area is located at 3' of the product coding area. As a non-limiting example, the first identifier area and the second identifier area are located at 5' of the product coding area. As a non-limiting example, the first identifier area and the second identifier area are located at 3' of the product coding area.

[0722] As a non-limiting example, the first identifier area is inverted and located at 5' of the product coding area, and the second identifier area is located at 3' of the product coding area. As a non-limiting example, the first identifier area is inverted and located at 5' of the product coding area, and the second identifier area is inverted and located at 3' of the product coding area. As a non-limiting example, the first identifier area is located at 5' of the product coding area, and the second identifier area is inverted and located at 3' of the product coding area. As a non-limiting example, both the first and second identifier areas are inverted and located at 5' of the product coding area. As a non-limiting example, the first and second identifier areas are located at 5' of the product coding area, and the first identifier area is inverted. As a non-limiting example, both the first and second identifier areas are inverted and located at 3' of the product coding area. As a non-limiting example, the first and second identifier areas are located at 3' of the product coding area, and the first identifier area is inverted. As a non-limiting example, the first identifier area and the second identifier area are located at 3' of the product coding area, and the second identifier area is inverted.

[0723] As a non-limiting example, the first identifier region is located at 5' of the product coding region and overlaps with the product coding region, and the second identifier region is located at 3' of the product coding region. As a non-limiting example, the first identifier region is located at 5' of the product coding region, and the second identifier region is located at 3' of the product coding region and overlaps with the product coding region.

[0724] As a non-limiting example, the first identifier area and the second identifier area are located at 5' of the product coding area, and the second identifier area overlaps with the product coding area. As a non-limiting example, the first identifier area and the second identifier area are located at 3' of the product coding area, and the first identifier area overlaps with the product coding area.

[0725] As a non-limiting example, the first identifier area is inverted, located at 5' of the product coding area, and overlaps with the product coding area, and the second identifier area is located at 3' of the product coding area. As a non-limiting example, the first identifier area is inverted and located at 5' of the product coding area, and the second identifier area is located at 3' of the product coding area and overlaps with the product coding area. As a non-limiting example, the first identifier area is inverted and located at 5' of the product coding area, the second identifier area is located at 3' of the product coding area, and both the first and second identifier areas overlap with the product coding area.

[0726] As a non-limiting example, the first identifier area is inverted, located at 5' of the product coding area, and overlaps with the product coding area, and the second identifier area is inverted and located at 3' of the product coding area. As a non-limiting example, the first identifier area is inverted and located at 5' of the product coding area, and the second identifier area is inverted, located at 3' of the product coding area, and overlaps with the product coding area. As a non-limiting example, the first identifier area is inverted and located at 5' of the product coding area, and the second identifier area is inverted and located at 3' of the product coding area, and both the first and second identifier areas overlap with the product coding area.

[0727] As a non-limiting example, the first identifier area is located at 5' of the product coding area and overlaps with the product coding area, and the second identifier area is inverted and located at 3' of the product coding area. As a non-limiting example, the first identifier area is located at 5' of the product coding area, and the second identifier area is inverted, located at 3' of the product coding area, and overlaps with the product coding area. As a non-limiting example, the first identifier area is located at 5' of the product coding area, and the second identifier area is inverted and located at 3' of the product coding area, and both the first and second identifier areas overlap with the product coding area.

[0728] As a non-limiting example, both the first and second identifier areas are inverted and located at 5' of the product coding area, and the second identifier area overlaps with the product coding area. As a non-limiting example, both the first and second identifier areas are located at 5' of the product coding area, and the first identifier area is inverted, and the second identifier area overlaps with the product coding area. As a non-limiting example, both the first and second identifier areas are located at 5' of the product coding area, and the second identifier area is inverted and overlaps with the product coding area. As a non-limiting example, both the first and second identifier areas are inverted and located at 3' of the product coding area, and the first identifier area overlaps with the product coding area. As a non-limiting example, both the first and second identifier areas are located at 3' of the product coding area, and the first identifier area is inverted and overlaps with the product coding area. As a non-limiting example, both the first and second identifier areas are located at 3' of the product coding area, and the second identifier area is inverted, and the first product coding area overlaps with the product coding area.

[0729] In some embodiments, at least one identifier portion may associate with a reference polynucleotide construct. The reference polynucleotide construct may have one, two, three, four, five, six, seven, eight, nine, or ten or more identifier portions associated with it, said identifier portions may be the same or different portions associated with the reference polynucleotide construct. Each identifier portion may be independently located on the 5' side region of the product coding region, on the 3' side region of the product coding region, or the identifier portion may be located across the 5' end or 3' end of the product coding region and the side region. In some aspects, the location of the identifier portion may include one or more nucleotides of the product coding region, such as, but not limited to, 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides. nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 ​​nucleotides, 49 nucleotides, 50 nucleotides or more. In some aspects, the location of the identifier portion may include one or more nucleotides of the product coding region, such as, but not limited to, 1-5 nucleotides, 2-5 nucleotides, 3-5 nucleotides, 2-7 nucleotides, 3-7 nucleotides, 1-10 nucleotides, 2-10 nucleotides, 3-10 nucleotides, 5-10 nucleotides, 7-10 nucleotides, 1-15 nucleotides, 2-15 nucleotides, 3-15 nucleotides, 5-15 nucleotides, 7-15 nucleotides, 10-15 nucleotides, 12-15 nucleotides, 1-20 nucleotides, 2-20 nucleotides. 3-20 nucleotides, 5-20 nucleotides, 7-20 nucleotides, 10-20 nucleotides, 12-20 nucleotides, 15-20 nucleotides, 17-20 nucleotides, 1-25 nucleotides, 2-25 nucleotides, 3-25 nucleotides, 5-25 nucleotides, 7-25 nucleotides, 10-25 nucleotides, 12-25 nucleotides, 15-25 nucleotides, 17-25 nucleotides, 20-25 nucleotides, 1-30 nucleotides, 2-30 nucleotides, 3-30 nucleotides, 5-30 nucleotides, 7-30 nucleotides10-30 nucleotides, 12-30 nucleotides, 15-30 nucleotides, 17-30 nucleotides, 20-30 nucleotides, 25-30 nucleotides, 1-35 nucleotides, 2-35 nucleotides, 3-35 nucleotides, 5-35 nucleotides, 7-35 nucleotides, 10-35 nucleotides, 12-35 nucleotides, 15-35 nucleotides, 17-35 nucleotides, 20-35 nucleotides, 25-35 nucleotides, 30-35 nucleosides Acid, 1-35 nucleotides, 2-35 nucleotides, 3-35 nucleotides, 5-35 nucleotides, 7-35 nucleotides, 10-35 nucleotides, 12-35 nucleotides, 15-35 nucleotides, 17-35 nucleotides, 20-35 nucleotides, 25-35 nucleotides, 30-35 nucleotides, 1-40 nucleotides, 2-40 nucleotides, 3-40 nucleotides, 5-40 nucleotides, 7-40 nucleotides, 10-40 nucleotides, 12 -40 nucleotides, 15-40 nucleotides, 17-40 nucleotides, 20-40 nucleotides, 25-40 nucleotides, 30-40 nucleotides, 35-40 nucleotides, 1-45 nucleotides, 2-45 nucleotides, 3-45 nucleotides, 5-45 nucleotides, 7-45 nucleotides, 10-45 nucleotides, 12-45 nucleotides, 15-45 nucleotides, 17-45 nucleotides, 20-45 nucleotides, 25-45 nucleotides, 3 0-45 nucleotides, 35-45 nucleotides, 40-45 nucleotides, 1-50 nucleotides, 2-50 nucleotides, 3-50 nucleotides, 5-50 nucleotides, 7-50 nucleotides, 10-50 nucleotides, 12-50 nucleotides, 15-50 nucleotides, 17-50 nucleotides, 20-50 nucleotides, 25-50 nucleotides, 30-50 nucleotides, 35-50 nucleotides, 40-50 nucleotides, or 45-50 nucleotides.

[0730] In some embodiments, an identifier portion may associate with a baseline polynucleotide construct. As a non-limiting example, the identifier portion may associate with a baseline polynucleotide construct at the 5' end. As a non-limiting example, the identifier portion may associate with a baseline polynucleotide construct at the 5' flanking region. As a non-limiting example, the identifier portion may associate with a baseline polynucleotide construct at the 3' flanking region. As a non-limiting example, the identifier portion may associate with a baseline polynucleotide construct at the 3' end. As a non-limiting example, the identifier portion may associate with a baseline polynucleotide construct on the product coding region. As a non-limiting example, the baseline polynucleotide construct includes an identifier portion, and the identifier portion is located across the 5' end and 5' flanking region of the product coding region. As a non-limiting example, the baseline polynucleotide construct includes an identifier portion, and the identifier portion is located across the 3' end and 3' flanking region of the product coding region.

[0731] In some embodiments, the two identifier portions are associated with a baseline polynucleotide construct. As a non-limiting example, the first and second identifier portions are located on a 5' flanking region. As a non-limiting example, the first and second identifier portions are located on a product coding region. As a non-limiting example, the first and second identifier portions are located on a 3' flanking region. As a non-limiting example, the first and second identifier portions are located at the 5' end of the baseline polynucleotide construct. As a non-limiting example, the first and second identifier portions are located at the 3' end of the baseline polynucleotide construct.

[0732] As a non-limiting example, the first identifier portion is located at the 5' end of the benchmark polynucleotide construct, and the second identifier portion is located on the 5' flanking region. As a non-limiting example, the first identifier portion is located at the 5' end of the benchmark polynucleotide construct, and the second identifier portion is located on the product coding region. As a non-limiting example, the first identifier portion is located at the 5' end of the benchmark polynucleotide construct, and the second identifier portion is located on the 3' flanking region. As a non-limiting example, the first identifier portion is located at the 5' end of the benchmark polynucleotide construct, and the second identifier portion spans both the 5' flanking region and the product coding region. As a non-limiting example, the first identifier portion is located at the 5' end of the benchmark polynucleotide construct, and the second identifier portion spans both the 3' flanking region and the product coding region. As a non-limiting example, the first identifier portion is located at the 5' end of the benchmark polynucleotide construct, and the second identifier portion is located at the 3' end of the benchmark polynucleotide construct.

[0733] As a non-limiting example, the first identifier portion is located on the 5' side region, and the second identifier portion is located on the product coding region. As a non-limiting example, the first identifier portion is located on the 5' side region, and the second identifier portion is located on the 3' side region. As a non-limiting example, the first identifier portion is located on the 5' side region, and the position of the second identifier portion spans both the 5' side region and the product coding region. As a non-limiting example, the first identifier portion is located on the 5' side region, and the position of the second identifier portion spans both the 3' side region and the product coding region. As a non-limiting example, the first identifier portion is located on the 5' side region, and the second identifier portion is located at the 5' end of the baseline polynucleotide construct. As a non-limiting example, the first identifier portion is located on the 5' side region, and the second identifier portion is located at the 3' end of the baseline polynucleotide construct.

[0734] As a non-limiting example, the first identifier portion spans the 5' side region and the product coding region, and the second identifier portion is located at the 5' end of the baseline polynucleotide construct. As a non-limiting example, the first identifier portion spans the 5' side region and the product coding region, and the second identifier portion is located on the 5' side region. As a non-limiting example, the first identifier portion spans the 5' side region and the product coding region, and the second identifier portion is located on the product coding region. As a non-limiting example, the first identifier portion spans the 5' side region and the product coding region, and the second identifier portion spans the 3' side region and the product coding region. As a non-limiting example, the first identifier portion spans the 5' side region and the product coding region, and the second identifier portion is located on the 3' side region. As a non-limiting example, the first identifier portion spans the 5' side region and the product coding region, and the second identifier portion is located at the 3' end of the baseline polynucleotide construct.

[0735] As a non-limiting example, the first identifier portion is located on the product coding region, and the second identifier portion is located on the 5' end of the baseline polynucleotide construct. As a non-limiting example, the first identifier portion is located on the product coding region, and the second identifier portion is located on the 5' flanking region. As a non-limiting example, the first identifier portion is located on the product coding region, and the position of the second identifier portion spans the 5' flanking region and the product coding region. As a non-limiting example, the first identifier portion is located on the product coding region, and the position of the second identifier portion spans the 3' flanking region and the product coding region. As a non-limiting example, the first identifier portion is located on the product coding region, and the second identifier portion is located on the 3' flanking region. As a non-limiting example, the first identifier portion is located on the product coding region, and the second identifier portion is located on the 3' end of the baseline polynucleotide construct.

[0736] As a non-limiting example, the first identifier portion spans the 3' side region and the product coding region, and the second identifier portion is located at the 5' end of the baseline polynucleotide construct. As a non-limiting example, the first identifier portion spans the 3' side region and the product coding region, and the second identifier portion is located on the 5' side region. As a non-limiting example, the first identifier portion spans the 3' side region and the product coding region, and the second identifier portion spans the 5' side region and the product coding region. As a non-limiting example, the first identifier portion spans the 3' side region and the product coding region, and the second identifier portion is located on the product coding region. As a non-limiting example, the first identifier portion spans the 3' side region and the product coding region, and the second identifier portion is located on the 3' side region. As a non-limiting example, the first identifier portion spans the 3' side region and the product coding region, and the second identifier portion is located on the 3' end of the baseline polynucleotide construct.

[0737] As a non-limiting example, the first identifier portion spans the 3' side region and the product coding region, and the second identifier portion is located on the 5' side region. As a non-limiting example, the first identifier portion spans the 5' side region and the product coding region, and the second identifier portion is located on the product coding region. As a non-limiting example, the first identifier portion spans the 5' side region and the product coding region, and the second identifier portion spans the 3' side region and the product coding region. As a non-limiting example, the first identifier portion spans the 5' side region and the product coding region, and the second identifier portion is located on the 3' side region. As a non-limiting example, the first identifier portion spans the 5' side region and the product coding region, and the second identifier portion is located on the 3' end of the baseline polynucleotide construct.

[0738] As a non-limiting example, the first identifier portion is located on the 3' side region, and the second identifier portion is located on the 5' end of the baseline polynucleotide construct. As a non-limiting example, the first identifier portion is located on the 3' side region, and the second identifier portion is located on the 5' side region. As a non-limiting example, the first identifier portion is located on the 3' side region, and the position of the second identifier portion spans the 5' side region and the product coding region. As a non-limiting example, the first identifier portion is located on the 3' side region, and the second identifier portion is located on the product coding region. As a non-limiting example, the first identifier portion is located on the 3' side region, and the position of the second identifier portion spans the 3' side region and the product coding region. As a non-limiting example, the first identifier portion is located on the 3' side region, and the second identifier portion is located on the 3' end of the baseline polynucleotide construct.

[0739] As a non-limiting example, the first identifier portion is located at the 3' end of the benchmark polynucleotide construct, and the second identifier portion is located at the 5' end of the benchmark polynucleotide construct. As a non-limiting example, the first identifier portion is located at the 3' end of the benchmark polynucleotide construct, and the second identifier portion is located on the 5' flanking region. As a non-limiting example, the first identifier portion is located at the 5' end of the benchmark polynucleotide construct, and the position of the second identifier portion spans the 5' flanking region and the product coding region. As a non-limiting example, the first identifier portion is located at the 3' end of the benchmark polynucleotide construct, and the second identifier portion is located on the product coding region. As a non-limiting example, the first identifier portion is located at the 5' end of the benchmark polynucleotide construct, and the position of the second identifier portion spans the 3' flanking region and the product coding region. As a non-limiting example, the first identifier portion is located at the 3' end of the benchmark polynucleotide construct, and the second identifier portion is located on the 3' flanking region.

[0740] In some embodiments, three identifier portions associate with the benchmark polynucleotide construct. In some embodiments, four identifier portions associate with the benchmark polynucleotide construct. In some embodiments, five identifier portions associate with the benchmark polynucleotide construct. In some embodiments, six identifier portions associate with the benchmark polynucleotide construct. In some embodiments, seven identifier portions associate with the benchmark polynucleotide construct. In some embodiments, eight identifier portions associate with the benchmark polynucleotide construct. In some embodiments, nine identifier portions associate with the benchmark polynucleotide construct. In some embodiments, ten identifier portions associate with the benchmark polynucleotide construct.

[0741] In some embodiments, the product-coding region encodes a biologically active molecule, such as, but not limited to, a therapeutic protein or antigen. As used herein, the term "biologically active" refers to the characteristic of any agent that is active in a biological system and particularly in an organism. For example, an agent is considered biologically active when administered to an organism that has a biological effect on said organism. In some embodiments, the CROI encodes one or more preventative or therapeutically active proteins, peptides, or other factors. As a non-limiting example, the CROI may encode an agent that enhances tumor-killing activity in cancer, such as, but not limited to, TRAIL or tumor necrosis factor (TNF). As another non-limiting example, a CROI may encode an agent suitable for treating conditions such as: muscular dystrophy (e.g., CROI encoding dystrophin), cardiovascular disease (e.g., CROI encoding SERCA2a, GATA4, Tbx5, Mef2C, Hand2, Myocd, etc.), neurodegenerative diseases (e.g., CROI encoding NGF, BDNF, GDNF, NT-3, etc.), chronic pain (e.g., CROI encoding GlyRal), enkephalins or glutamate decarboxylases (e.g., CROI encoding GAD65, GAD67, or another isoform), lung diseases (e.g., CROI encoding CFTR), hemophilia (e.g., CROI encoding factor VIII or factor IX), tumorigenesis (e.g., CROI encoding PTEN, ATM, ATR, EGFR, ERBB2, ERBB3, ERBB4, Notch1, Notch2, Notch3, Notch4, AKT, AKT2, AKT3, HIF, HI). Fla, HIF3a, Met, HRG, Bcl2, PPARα, PPARγ, WT1 (Wilms Tumor), FGF receptor family members (5 members: 1, 2, 3, 4, 5), CDKN2a, APC, RB (retinoblastoma), MEN1, VHL, BRCA1, BRCA2, AR (androgen receptor), TSG101, IGF, IGF receptor, Igfl (4 variants), Igf2 (3 variants), Igfl receptor, Igf2 receptor, Bax, Bcl2, caspase family (9 members: 1, 2, 3, 4, 6, 7, 8, 9, 12), Kras, Ape), age-related macular degeneration (e.g.,CROI encodes Aber, Ccl2, Cc2, cp (ceruloplasmin), Timp3, cathepsin D, Vldlr), schizophrenia (e.g., neuroregulatory protein (Nrgl), Erb4 (receptor of neuroregulatory protein), complex protein-1 (Cplxl), Tphl tryptophan hydroxylase, Tph2 tryptophan hydroxylase 2, axonin 1, GSK3, GSK3a, GSK3b, 5-HIT (Slc6a4), COMT, DRD (Drdla), SLC6A3, DAOA, DTNBPI, Dao (Daol)), trinucleotide repeat disorders (e.g., HTT (Huntington's Dx), SBMA / SMAXI / AR (Kennedy's Dx), FXN / X25 (Friedrich's Ataxia), ATX3 (Machado-Joseph's Dx)). (Machado-Joseph's Dx), ATXNI and ATXN2 (spinocerebellar ataxia), DMPK (myotonic dystrophy), dystrophin-1 and Atnl (DRPLA Dx), CBP (Creb-BP-global instability), VLDLR (Alzheimer's disease), Atxn7, Atxn10), Fragile X syndrome (e.g., CROI encoding FMR2, FXRI, FXR2, mGLUR5), secretase-related disorders (e.g., CROI encoding APH-1 (α and β), presenilin (Psenl), nicastrin (Ncstn), PEN-2), ALS (e.g., CROI encoding SOD1, ALS2, STEX, FUS, TARD BP, VEGF) (VEGF-a, VEGF-b, VEGF-c)), autism (e.g., CROI encodes Mecp2, BZRAP1, MDGA2, Sema5A, axonin 1), Alzheimer's disease (e.g., CROI encodes E1, CHIP, UCH, UBB, Tau, LRP, PICALM, clustering protein, PS1, SORL1, CR1, Vldlr, Upal, Uba3, CHIP28 (Aqpl, aquaporin 1), Uchll, Uchl3, APP), inflammation (e.g.,CROI encodes IL-10, IL-1 (IL-1a, IL-1b), IL-13, IL-17 (IL-17a (CTLA8), IL-17b, IL-17c, IL-17d, IL-171), IL-11-23, Cx3crl, ptpn22, TNFα, NOD2 / CARD15 (for IBD), IL-6, IL-12 (IL-12a, IL-12b), CTLA4, Cx3crl, and Parkinson's Disease. (e.g., X-synuclein, DJ-1, LRRK2, Parkin, PINK1), blood and coagulation disorders (such as, for example, anemia, naked lymphocyte syndrome, bleeding disorder, hemophagocytic lymphohistiocytosis, hemophilia A, hemophilia B, hemorrhagic disorder), leukopenia and thalassemia, sickle cell anemia and thalassemia (e.g., CROI encoding CRAN1, CDA1, RPS19). DBA, PKLR, PK1, NT5C3, UMPH1, PSNI, RHAG, RH50A, NRAMP2, SPTB, ALAS2, ANH1, ASB, ABCB7, ABC7, ASAT, TAPBP, TPSN, TAP2, ABCB3, PSF2, RING11, MHC2TA, C2TA, RFX5, RFXAP, RFX5, TBXA2R, P2RX1, P2X1, HF1, CFH, HUS, MCFD2, FANCA, FAC A, FA1, FA, FA A. FAAP95, FAAP90, FLJ34064, FANCB, FANCC, FACC, BRCA2, FANCDI, FANCD2, FANCD, FACD, FAD, FANCE, FACE, FANCF, D, MUNC13-4, HPLH3, HLH3, FHL3, F8, FSC, PI, ATT, F5, ITGB2, CD18, LCAMB, LAD, EIF2B1, EIF2BA, EIF2B2, EIF2B3, EIF2B5, LVWM, CACH, CLE, EIF2B4, HBB, HBA2, HBB, HBD, LCRB, HBA1), B-cell non-Hodgkin lymphoma or leukemia (e.g.,CROI codes BCL7A, BCL7, ALI, TCL5, SCL, TAL2, FLT3, NBS1, NBS, ZNFN1AI, 1KI, LYF1, HOXD4, HOX4B, BCR, CM L, PHL, ALL, ARNT, KRAS2, RASK2, GMPS, AFIO, ARHGEF12, LARG, KIAA0382, CALM, CLTH, CEBPA, CEBP, CHI C2, BTL, FLT3, KIT, PBT, LPP, NPMI, NUP214, D9S46E, CAN, CAIN, RUNXI, CBFA2, AML1, WHSC1LI, NSD3, FL T3, AF1Q, NPMI, NUMA1, ZNF145, PLZF, PML, MYL, STAT5B, AF1Q, CALM, CLTH, ARL11, ARLTS1, P2RX7, P2X7 BCR, CML, PHL, ALL, GRAF, NF1, VRNF, WSS, NFNS, PTPNII, PTP2C, SHP2, NS1, BCL2, CCND1, PRAD1, BCL1, TCRA, GATA1, GF1, ERYF1, NFE1, ABLI, NQO1, DIA4, NMOR1, NUP214, D9S46E, CAN, CAIN), inflammation and immune-related diseases and conditions ( For example, CROI encodes KIR3DL1, NKAT3, NKB1, AMB11, K1R3DS1, IFNG, CXCL12, TNFRSF6, APT1, FAS, CD95, ALPS1A, IL2RG, SCIDX1, SCIDX, IMD4, CCL5, SCYA5, D17S136E, TCP228, IL10, CSIF, CMKBR2, CCR2, CMKBR5, CCCKR5 (CCR5), CD3E, CD3G, AICDA, AID, HIGM2, TNFRSF5, CD40, UNG, DGU, HIGM4, TNFSFS, CD40LG, HIGM1, IGM, FOXP3, IPEX, AIID, XPID, PIDX, TNFRSF14B, TACI), inflammation (e.g.,CROI codes IL-10, IL-1 (IL-IA, IL-IB), IL-13, IL-17 (IL-17a (CTLA8), IL-17b, IL-17c, IL-17d, IL-171), 11-23, Cx3crl, ptpn22, TNFa, NOD2 / CARD15 of IBD, IL-6, IL-12 (IL-12a, IL-12b), CTLA4, Cx3cII), JAK3, JAKL, DCLREIC, ARTEMIS, SCIDA, RAG1, RAG2, ADA, PTPRC, CD45, LCA, IL7R, CD3D, T3D, IL2RG, SCIDX, SCIDX, IMD4), metabolic, liver, kidney and protein diseases and conditions (e.g., CROI encoding TTR, PALB, APOA1, APP, AAA, CVAP, ADI, GSN, FGA, LYZ, TTR, PALB, KRT18, KRT8, CIRH1A, NAIC, TEX292, KIAA1988, CFTR, ABCC7, CF, MRP7, SLC2A2, GLUT2, G6PC, G6PT, G 6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM, TCF1, HNF1A, MODY3, SCOD1, SCOl, CTNNB1, PDGFRL, PGRL, PRLTS, AX1NI, AXIN, CTNNB1, TP53, P53, LFS1, IGF2R, MPRI, MET, CASP8, MCH5, UMOD, HNFJ, FJHN, MCKD2, ADMCKD2, PAH, PKU1, QDPR, DHPR, PTS, FCYT, PKHD1, ARPKD, PKD1, PKD2, PKD4, PKDTS, PRKCSH, G19P1, PCLD, SEC63), musculoskeletal disorders and conditions (e.g.,CROI encoding DMD, BMD, MYF6, LMNA, LMN1, EMD2, FPLD, CMDIA, HGPS, LGMDIB, LMNA, LMNI, EMD2, FPLD, CMDIA, FSHMD1A, FSHD1A, FKRP, MDC1C, LGMD2I, LAMA2, LAMM, LARGE, KIAA0609, MDC1D, FC MD, TTID, MYOT, CAPN3, CANP3, DYSF, LGMD2B, SGCG, LGMD2C, DMDA1, SCG3, SGCA, ADL, DAG2, LGMD2D, DMDA2, SGCB, LGMD2E, SGCD, SGD, LGMD2F, CMD1L, TCAP, LGMD2G, CMD1N, TRIM32, HT2A LGMD2H, FKRP, MDCIC, LGMD21, TTN, CMD1G, TMD, LGMD2J, POMT1, CAV3, LGMD1C, SEPN1, SELN, RSMD1, PLEC1, PLTN, EBS1, LRP5, BMND1, LRP7, LR3, OPPG, VBCH2, CLCN7, CLC7, OPTA2, OSTMI, GL, TCIRG1, TIRC7, OC116, OPTB1, VAPB, VAPC, ALS8, SMN1, SMA1, SMA2, SMA3, SMA4, BSCL2, SPG17, GARS, SMAD1, CMT2D, HEXB, IGHMBP2, SMUBP2, CATF1, SMARD1), neurological and neuronal diseases and conditions (e.g.,CROI encodes SOD1, ALS2, STEX, FUS, TARDBP, VEGF (VEGF-a, VEGF-b, VEGF-c), APP, AAA, CVAP, ADI, APOE, AD2, PSEN2, AD4, STM2, APBB2, FE65LI, NOS3, PLAU, URK, ACE, DCPI, ACEI, MPO, PAC1PI, PAXIPIL, PTIP, A2M, BLMH, BMH, PSEN1, AD3, Mecp2, BZRAP1, MDGA2, Sema5A, axonin 1, GLO1, MECP2, RTT, PPMX, MRX16, MRX79, NLGN3, NLGN4, KIAA1260, AUTSX2, FMR2, FXR1, FXR2, mGLUR5, HD, and IT15. PRNP, PRIP, JPH3, JP3, HDL2, TBP, SCA17, NR4A2, NURR1, NOT, TINUR, SNCAIP, TBP, SCA17, SNCA, NACP, PARK1, PARK4, DJI, PARK7, LRRK2, PARK8, PINK1, PARK6, UCHL1, PARK5, SNCA, NACP, PARK1, PARK4, PRKN, PARK2, PDJ, DBH, NDUFV2, MECP2, RTT, PPMX, MRX16, MRX79, CDKL5, STK9, MECP2, RTT, PPMX, MRX16, MRX79, X-synuclein, DJ-1, neuromodulatory protein-1 (Nrgl), Erb4 (receptor of neuroregulatory protein), complex protein-1 (Cplxl), Tphl tryptophan hydroxylase, Tph2 tryptophan hydroxylase 2, axonin 1, GSK3, GSK3a, GSK3b, 5-HTT (Slc6a4), CONT, DRD (Drdla), SLC6A, DAOA, DTNBP1, Dao (Daol), APH-1 (α and β), presenilin (Psenl), azoosin (Ncstn), PEN-2, Nosl, Parpl, Natl, Nat2, HTT, SBMA / SMAX1 / AR, FXN / X25, ATX3, TXN, ATXN2, DMPK, atrophic protein-1, Atnl, CBP, VLDLR, Atxn7 and AtxnlO) and eye diseases and conditions (e.g.,Aber, Ccl2, Cc2, cp (ceruloplasmin), Timp3, cathepsin-D, Vldlr, Ccr2, CRYAA, CRYA1, CRYBB2, CRYB2, PITX3, BFSP2, CP49, CP47, CRYAA, CRYAI, PAX6, AN2, MGDA, CRYBA1, CRYB1, CRYGC, CRYG3, CCL, LIM2, MP19, CRYGD, CRYG4, BFSP2, CP49, CP47, HSF4, CTM, HSF4, CTM, MIP, AQPO, CRYAB, CRYA2, CTPP2, CRYBB1 , CRYGD, CRYG4, CRYBB2, CRYB2, CRYGC, CRYG3, CCL, CRYAA, CRYAI, GJA8, CX50, CAE1, GJA3, CX46, CZP3, CAE3, CCM1, CAM, KRIT1, APOA1, TGFBI, CSD2, CDGG1, CSD, BIGH3, CDG2, TACSTD2, TROP2, M1SI, VSX1, RINX, PPCD, PPD, KTCN, COL8A2, FECD, PPCD2, PIP5K3, CFD, KERA, CNA2, MYOC, TIGR, GLCIA, JO AG, GPOA, OPTN, GLC1E, FIP2, HYPL, NRP, CYP1BI, GLC3A, OPA1, NTG, NPG, CYP1BI, GLC3A, CRB1, RP12, CRX, CORD2, CRD, RPGRIPI, LCA6, CORD9, R PE65, RP20, AIPL1, LCA4, GUCY2D, GUC2D, LCA1, CORD6, RDH12, LCA3, ELOVL4, ADMD, STGD2, STGD3, RDS, RP7, PRPH2, PRPH, AVMD, AOFMD and VMD2). ,

[0742] In some implementations, the product coding region of the RNA payload described herein encodes factors that can influence cell differentiation. As a non-limiting example, expression of one or more of Oct4, Klf4, Sox2, c-Myc, L-Myc, dominant-negative p53, Nanog, Glisl, Lin28, TFIID, mir-302 / 367, or other miRNAs can lead to cells becoming induced pluripotent stem (iPS) cells.

[0743] In some embodiments, the product coding region of the RNA payload described herein encodes a factor for transdifferentiated cells. Non-limiting examples of factors include: GATA4, Tbx5, Mef2C, Myocd, Hand2, SRF, Mespl, SMARCD3 of cardiomyocytes; Ascii, Nurl, LmxlA, Bm2, Mytll, NeuroDl, FoxA2 of nerve cells; and one or more of Hnf4a, Foxa1, Foxa2, or Foxa3 of hepatocytes.

[0744] The additional product coding regions of the RNA payload described in this article are described elsewhere.

[0745] A. Nucleic acid payload

[0746] In various embodiments, the LNP compositions described herein can be used to deliver nucleic acid or polynucleotide payloads, such as DNA HDR donors, linear or circular mRNAs, or chimeric DNA / RNA guides.

[0747] In some embodiments, LNPs are capable of delivering polynucleotides to target cells, tissues, or organs. In the broadest sense, a polynucleotide comprises any compound and / or substance incorporated into or capable of incorporating an oligonucleotide chain. Exemplary polynucleotides used according to this disclosure include, but are not limited to, one or more of the following: deoxyribonucleic acid (DNA), ribonucleic acid (RNA) including messenger mRNA (mRNA), hybrids thereof, RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA inducing triple helix formation, aptamers, vectors, etc. The RNA used in the compositions and methods described herein may be selected from, but is not limited to, the group consisting of, shorttimer, antagomir, antisense, ribozymes, short interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), Dicer substrate RNA (dsRNA), short hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), and mixtures thereof. In some embodiments, the polynucleotide is mRNA. In some embodiments, the polynucleotide is circular RNA. In some embodiments, the polynucleotide encodes a protein, such as a vaccine antigen, a therapeutic protein, or a nucleobase editing enzyme. The polynucleotide may encode any polypeptide of interest, including any polypeptide that is naturally occurring or non-naturally present or otherwise modified. The polypeptide may be of any size and may have any secondary structure or activity. In some embodiments, the polypeptide encoded by mRNA may have a therapeutic effect when expressed in cells.

[0748] In other embodiments, the polynucleotide is siRNA. siRNA may be capable of selectively knocking down or downregulating the expression of genes of interest. For example, the siRNA may be selected to silence genes associated with a specific disease, condition, or disorder after administration of a nanoparticle composition containing siRNA to a subject in need. The siRNA may contain a sequence complementary to the mRNA sequence encoding the gene or protein of interest. In some embodiments, the siRNA may be an immunomodulatory siRNA.

[0749] In some implementations, the polynucleotide is shRNA or a vector or plasmid encoding shRNA. Delivery of a suitable construct to the cell nucleus generates shRNA within the target cell. The constructs and mechanisms associated with shRNA are well known in the relevant fields.

[0750] The polynucleotide may comprise a first region (e.g., a coding region) encoding a linker nucleoside of interest, a first flanking region (e.g., a 5'-UTR) located at the 5' end of the first region, a second flanking region (e.g., a 3'-UTR) located at the 3' end of the first region, at least one 5' cap region, and a 3' stabilizing region. In some embodiments, the polynucleotide further comprises a poly-A region or a Kozak sequence (e.g., in the 5'-UTR). In some cases, the polynucleotide may contain one or more intronic nucleotide sequences that can be cleaved from the polynucleotide. In some embodiments, the polynucleotide (e.g., mRNA) may comprise a 5' cap structure, a chain-terminating nucleotide, a stem-loop, a polyA sequence, and / or a polyadenylation signal.

[0751] In various implementations, the nucleic acid payload may contain one or more modifications. Such modifications include a variety of chemical and / or structural modifications. For example, in the case of RNA, the RNA may contain one or more modifications, including chemical modifications (e.g., ribonucleotide analogs, substituted phosphate linkers), sequence modifications (e.g., sequences relative to wild-type sequences), and / or structural modifications (e.g., secondary folding structures, such as, but not limited to, stem-loops, hairpins, and G-quadruplexes, and tertiary structural elements, such as, but not limited to, double helices and triple helices). To date, hundreds of different RNA modifications have been characterized. Among these, several RNA modifications include N... 6 -Methyladenosine (m 6 A), N 6 2'-O-dimethyladenosine (m 6 Am), 8-oxo-7,8-dihydroguanosine (8-oxoG), pseudouridine (Ψ), 5-methylcytidine (m) 5 C) and N 4 - Acetylcytidine (ac) 4C), has been shown to regulate mRNA stability, thereby affecting a variety of cellular and biological processes. This article considers any known modifications to RNA or DNA.

[0752] In some embodiments, the nucleic acid may contain one or more alternative components (e.g., alternative nucleosides). For example, the 3'-stabilizing region may contain alternative nucleosides (such as L-nucleoside, inverted thymidine, or 2'-O-methylnucleoside) and / or the coding region, 5'-UTR, 3'-UTR, or cap region may contain alternative nucleosides, such as 5-substituted uridine (e.g., 5-methoxyuridine), 1-substituted pseudouridine (e.g., 1-methylpseudouridine or 1-ethylpseudouridine), and / or 5-substituted cytidine (e.g., 5-methylcytidine). In some embodiments, the polynucleotide contains only naturally occurring nucleosides. Nucleic acid modification is well known in the field and is further discussed in the following references: (1) Crooke ST, Witztum JL, Bennett CF, Baker BF. RNA-Targeted Therapeutics. Cell Metab. 2018 Apr 3;27(4):714-739. doi: 10.1016 / j.cmet.2018.03.004. Errata: Cell Metab. 2019 Feb 5;29(2):501. PMID:29617640; (2) JP, Wen W, Zhang F, Oberg KC, Zhang L, Cheng T, Zhang XB. Dynamics and competition of CRISPR-Cas9 ribonucleoproteins and AAV donor-mediated NHEJ, MMEJ and HDR editing. Nucleic Acids Res. January 25, 2021; 49(2):969-985. doi: 10.1093 / nar / gkaa1251. PMID: 33398341; PMCID: PMC7826255;(3)Pradeep SP, Malik S, Slack FJ, Bahal R. Unlocking the potential of chemicallymodified peptide nucleic acids for RNA-based therapeutics. RNA. April 2023; 29(4):434-445. doi: 10.1261 / rna.079498.122. Electronic version January 18, 2023.PMID:36653113; PMCID: PMC10019372;(4) Haruehanroengra P, Zheng YY, Zhou Y, Huang Y, Sheng J. RNA modifications and cancer. RNA Biol. Nov 2020;17(11):1560-1575. doi: 10.1080 / 15476286.2020.1722449. Electronic version February 7, 2020. PMID: 31994439;PMCID: PMC7567502;(5) Heidenreich O, Pieken W, Eckstein F. Chemically modified RNA: approaches and applications. FASEB J. Jan 1993;7(1):90-6. doi:10.1096 / fasebj.7.1.7678566. PMID: 7678566; (6) Zhang HY, Du Q, Wahlestedt C,Liang Z. RNA Interference with chemically modified siRNA. Curr Top Med Chem.2006;6(9):893-900. doi: 10.2174 / 156802606777303676. PMID: 16787282; (7) Jin G,Xu M, Zou M, Duan S. The Processing, Gene Regulation, Biological Functions, and Clinical Relevance of N4-Acetylcytidine on RNA: A Systematic Review. MolTher Nucleic Acids. 2020 Jun 5;20:13-24. doi: 10.1016 / j.omtn.2020.01.037. Electronic version February 8, 2020. PMID: 32171170; PMCID: PMC7068197; (8) Gao M, Zhang Q, Feng XH, Liu J. Synthetic modified messenger RNA for therapeutic applications. Acta Biomater. 2021 Sep 1;131:1-15.doi: 10.1016 / j.actbio.2021.06.020. Electronic version June 13, 2021. PMID: 34133982; PMCID: PMC8198544;(9) Filippova JA, Semenov DV, Juravlev ES, Komissarov AB, Richter VA, Stepanov GA. Modern Approaches for Identification of Modified Nucleotides in RNA. Biochemistry (Mosc). November 2017;82(11):1217-1233. doi: 10.1134 / S0006297917110013. PMID: 29223150;(10) Röthlisberger P, Berk C, Hall J. RNAChemistry for RNA Biology. Chimia (Aarau). May 29, 2019; 73(6):368-373. doi:10.2533 / chimia.2019.368. PMID: 31118118; and (11) Elkhalifa D, Rayan M, Negmeldin AT, Elhissi A, Khalil A. Chemically modified mRNA beyond COVID-19: Potential preventive and therapeutic applications for targeting chronic diseases. Biomed Pharmacother. January 2022; 145:112385. doi: 10.1016 / j.biopha.2021.112385. Electronic version October 28, 2021. PMID: 34915673; PMCID:PMC8552589; (12) Boo SH, Kim YK. The emerging role of RNA modifications in the regulation of mRNA stability. Exp Mol Med. March 2020;52(3):400-408. doi:10.1038 / s12276-020-0407-z. Electronic version March 24, 2020.PMID: 32210357; PMCID:PMC7156397;(13) Varshney D, Spiegel J, Zyner K, Tannahill D, Balasubramanian S. The regulation and functions of DNA and RNA G-quadruplexes. Nat Rev MolCell Biol. Aug 2020;21(8):459-474. doi: 10.1038 / s41580-020-0236-x. Electronic version April 20, 2020. PMID: 32313204; PMCID: PMC7115845;Each of the references mentioned above is incorporated herein by reference in its entirety.

[0753] In some cases, the polynucleotide is longer than 30 nucleotides. In another embodiment, the polynucleotide molecule is longer than 35 nucleotides. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 50 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides. In another embodiment, the length is at least 4000 nucleotides. In another embodiment, the length is at least 5,000 nucleotides or greater than 5,000 nucleotides.

[0754] In some embodiments, the associated polynucleotide molecules, formulas, compositions, or methods comprise one or more polynucleotides containing the features described in the following patents: WO2002 / 098443, WO2003 / 051401, WO2008 / 052770, WO2009 / 127230, WO2006 / 122828, WO2008 / 083949, WO2010 / 088927, WO2010 / 037539, WO2004 / 004743, WO200 5 / 016376, WO2006 / 024518, WO2007 / 095,976, WO2008 / 014979, WO2008 / 077592, WO2009 / 030481, WO2009 / 095226 , WO2011 / 069586, WO2011 / 026641, WO2011 / 144358, WO2012 / 019780, WO2012 / 013326, WO2012 / 089338, WO2012 / 1 13513、WO2012 / 116811、WO2012 / 116810、WO2013 / 113502、WO2013 / 113501、WO2013 / 113736、WO2013 / 143698、WO2 013 / 143699, WO2013 / 143700, WO2013 / 120626, WO2013 / 120627, WO2013 / 120628, WO2013 / 120629, WO2013 / 17440 9. WO2014 / 127917, WO2015 / 024669, WO2015 / 024668, WO2015 / 024667, WO2015 / 024665, WO2015 / 024666, WO2015 / 024664, WO2015 / 101415, WO2015 / 101414, WO2015 / 024667, WO2015 / 062738, WO2015 / 101416, all of which are incorporated herein by reference.

[0755] In some embodiments, the polynucleotide includes one or more microRNA binding sites. In some embodiments, the microRNA binding site is recognized by microRNAs in non-target organs. In some embodiments, the microRNA binding site is recognized by microRNAs in the liver. In some embodiments, the microRNA binding site is recognized by microRNAs in hepatocytes.

[0756] B. Linear mRNA payload

[0757] In various embodiments, the LNP-based RNA vaccines, RNA therapeutics, and pharmaceutical compositions thereof described herein can be used to deliver RNA payloads as linear mRNA molecules.

[0758] In various embodiments, the LNP-based pharmaceutical compositions described herein, such as LNP-based gene editing systems, may comprise one or more linear mRNA molecules or linear mRNA payloads. In various embodiments, the mRNA payload may encode one or more components of the gene editing system described herein. For example, the mRNA payload may encode an amino acid sequence-programmable DNA-binding domain (e.g., TALENS and zinc finger binding domains) or a nucleic acid sequence-programmable DNA-binding domain (e.g., CRISPR Cas9, CRISPR Cas12a, CRISPR Cas12f, CRISPR Cas13a, CRISPR Cas13b, or TnpB).

[0759] Depending on the nature of the gene editing system, the mRNA payload may also encode one or more functional effector domains that provide to facilitate alterations in nucleotide sequence and / or gene expression, such as, but not limited to, single-stranded DNA-binding proteins, nucleases, endonucleases, exonucleases, deaminases (e.g., cytidine deaminase or adenosine deaminase), polymerases (e.g., reverse transcriptase), integrases, recombinases, and fusion proteins containing one or more functional domains linked together.

[0760] Ribonucleic acid (RNA) is a molecule composed of nucleotides, which are ribose sugars attached to a nitrogenous base and a phosphate group. Nitrogenous bases include adenine (A), guanine (G), uracil (U), and cytosine (C). RNA is typically single-stranded, but can exist in double strands in some cases. The length, form, and structure of RNA vary depending on its purpose. For example, RNA can range in length from short sequences (e.g., siRNA) to long sequences (e.g., lncRNA), can be linear (e.g., mRNA) or circular (e.g., oRNA), and can be coding (e.g., mRNA) or non-coding (e.g., lncRNA) sequences.

[0761] In various embodiments, the LNP-based RNA vaccines, RNA therapeutics, gene editing systems, and pharmaceutical compositions thereof described herein can be used to deliver mRNA payloads as linear mRNA molecules. In embodiments, the mRNA payload may contain one or more nucleotide sequences encoding products of interest, such as, but not limited to, vaccine antigens, components of the gene editing system (e.g., endonucleases, leader editors, etc.), and / or therapeutic proteins.

[0762] In some implementations, the RNA payload may be linear mRNA. As used herein, the term "messenger RNA" (mRNA) refers to any polynucleotide that encodes a protein of interest and is capable of being translated in vitro, in vivo, in situ, or ex vivo to produce the encoded protein of interest.

[0763] Typically, mRNA molecules contain at least a coding region, a 5' untranslated region (UTR), a 3' UTR, a 5' cap, and a poly-A tail. In some respects, RNA may contain one or more structural and / or chemical modifications or alterations that can reduce the innate immune response of the cell upon introduction of the mRNA. As used herein, a "structural" feature or modification is a feature or modification in which two or more linked nucleotides are inserted, deleted, duplicated, inverted, or randomized, without significantly modifying the nucleotides themselves chemically. Because chemical bonds inevitably break and reform to affect structural modifications, structural modifications are chemical in nature and are therefore chemical modifications. However, structural modifications will result in different sequences of nucleotides. For example, the polynucleotide "ATCG" can be chemically modified to "AT-5meC-G".

[0764] Typically, the coding regions of interest in the mRNA used herein encode dipeptides, tripeptides, tetrapeptides, pentapeptides, hexapeptides, heptapeptides, octapeptides, nonapeptides, or decapeptides. In another embodiment, the mRNA may encode peptides of 2-30 amino acids, such as 5-30, 10-30, 2-25, 5-25, 10-25, or 10-20 amino acids. mRNA may encode a peptide of at least 10, 11, 12, 13, 14, 15, 17, 20, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 amino acids, or a peptide of no more than 10, 11, 12, 13, 14, 15, 17, 20, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 amino acids.

[0765] Typically, the region of mRNA encoding the product of interest is longer than about 30 nucleotides (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1,100, 1,200, 1,300, or 1,400 nucleotides). 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500 and 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000 or up to and including 100,000 nucleotides.

[0766] In some implementations, the total length of the mRNA spans from about 30 to about 100,000 nucleotides (e.g., 30 to 50, 30 to 100, 30 to 250, 30 to 500, 30 to 1,000, 30 to 1,500, 30 to 3,000, 30 to 5,000, 30 to 7,000, 30 to 10,000, 30 to 25,000, 30 to 50,000, 30 to 70,000, 100 to 250, 100 to 500, 100 to 1,000, 10...). 0 to 1,500, 100 to 3,000, 100 to 5,000, 100 to 7,000, 100 to 10,000, 100 to 25,000, 100 to 50,000, 100 to 70,000, 100 to 100,000, 500 to 1,000, 500 to 1,500, 500 to 2,000, 500 to 3,000, 500 to 5,000, 500 to 7,000, 500 to 10,000, 500 to 25,000, 50 0 to 50,000, 500 to 70,000, 500 to 100,000, 1,000 to 1,500, 1,000 to 2,000, 1,000 to 3,000, 1,000 to 5,000, 1,000 to 7,000, 1,000 to 10,000, 1,000 to 25,000, 1,000 to 50,000, 1,000 to 70,000, 1,000 to 100,000, 1,500 to 3,000, 1,500 to 5,000 1,500 to 7,000, 1,500 to 10,000, 1,500 to 25,000, 1,500 to 50,000, 1,500 to 70,000, 1,500 to 100,000, 2,000 to 3,000, 2,000 to 5,000, 2,000 to 7,000, 2,000 to 10,000, 2,000 to 25,000, 2,000 to 50,000, 2,000 to 70,000, and 2,000 to 100,000 nucleotides.

[0767] In some implementations, the length of one or more regions lateralized to encode the product of interest can independently range from 15 to 1,000 nucleotides (e.g., greater than 30, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500 nucleotides). 600, 700, 800, and 900 nucleotides, or at least 30, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, and 1,000 nucleotides.

[0768] In some embodiments, the mRNA includes a tailing sequence whose length can range from absent to 500 nucleotides (e.g., at least 60, 70, 80, 90, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or 500 nucleotides). When the tailing region is a polyA tail, the length can be determined based on the number of polyA-binding protein monomers bound or the relationship to the polyA-binding protein binding. In this embodiment, the polyA tail is long enough to bind at least four polyA-binding protein monomers. The polyA-binding protein monomers bind to an extension of approximately 38 nucleotides. Therefore, polyA tails of approximately 80 and 160 nucleotides have been observed to be functional.

[0769] In some embodiments, the mRNA includes a capping sequence comprising a single cap or a series of nucleotides forming a cap. The length of the capping sequence can be from 1 to 10, for example 2-9, 3-8, 4-7, 1-5, 5-10, or at least 2 or 10 or fewer nucleotides. In some embodiments, there is no capping sequence.

[0770] In some implementations, the mRNA contains a region containing a start codon. The length of the region containing the start codon can range from 3 to 40 nucleotides, for example, 5-30, 10-20, 15, or at least 4, 30, or fewer nucleotides.

[0771] In some implementations, the mRNA contains a region containing a stop codon. The length of the region containing the stop codon can range from 3 to 40 nucleotides, for example, 5-30, 10-20, 15, or at least 4, 30, or fewer nucleotides.

[0772] In some implementations, the mRNA contains a region containing a restriction sequence. The length of the region containing the restriction sequence can range from 3 to 40 nucleotides, for example, 5-30, 10-20, 15, or at least 4, 30, or fewer nucleotides.

[0773] Untranslated Region (UTR)

[0774] In various embodiments, the mRNA payload of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein may include at least one untranslated region (UTR) flanked by a region encoding a product of interest and / or incorporated into the mRNA molecule. The UTR is transcribed but not translated. The mRNA payload may include a 5' UTR sequence and a 3' UTR sequence, as well as an internal UTR.

[0775] The RNA payloads disclosed herein may include one or more regions or portions that function as untranslated regions or perform untranslated regions. When the nucleic acid is designed to encode at least one polypeptide of interest, the nucleic acid may include one or more of these untranslated regions (UTRs). The wild-type untranslated region of the nucleic acid is transcribed but not translated. In mRNA, the 5' UTR begins at the transcription start site and extends to the start codon, but does not include the start codon; while the 3' UTR immediately follows the stop codon and extends until the transcription termination signal. Increasing evidence suggests that UTRs play a regulatory role in the stability and translation of nucleic acid molecules. Regulatory features of UTRs may be incorporated into the RNA payload molecules of this disclosure (e.g., linear and circular mRNA molecules) to enhance molecular stability, among other things. Specific features may also be incorporated to ensure controlled downregulation of transcripts to prevent them from being misdirected to undesired organ sites. Various 5' UTR and 3' UTR sequences are known and available in the art.

[0776] In various embodiments, the mRNA payload of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein may include at least one UTR, which may be selected from any UTR sequence listed in Table 19 or Table 20 of U.S. Patent No. 10,709,779, which is incorporated herein by reference.

[0777] 5' UTR zone

[0778] In various embodiments, the mRNA payload of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein may contain at least one 5' UTR.

[0779] In the implementation, the 5' UTR comprises the sequence provided in Table (II) or a sequence or a variant or fragment thereof having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the 5' UTR sequence provided in Table (II) (e.g., a fragment lacking the first one, two, three, four, five or six nucleotides of the 5' UTR sequence provided in Table (II)). In embodiments, the 5' UTR comprises SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13. SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26. SEQ ID NO: 27 or SEQ ID NO: 28 sequences with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity.

[0780] Exemplary nucleotide sequences of Table (II) - 5' UTR

[0781]

[0782] The 5' UTR is a region in mRNA located 5' upstream of the start codon (the first codon in the mRNA transcript translated by the ribosome). The 5' UTR does not encode proteins (it is non-coding). Native 5' UTRs are characterized by their role in translation initiation. They are characterized by sequences such as the Kozak sequence, which is known to be involved in the ribosome-initiated translation of many genes. The Kozak sequence has a consistent CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), followed by another 'G'. 5' UTRs are also known to form secondary structures involved in elongation factor binding. 5' UTR sequences are also known to be important for ribosome recruitment to mRNA and have been reported to play a role in translation (Hinnebusch A et al., (2016) Science, 352:6292:1413-6). In addition, the 5' UTR sequence can confer increased half-life, increased expression, and / or increased activity to the polypeptide encoded by the RNA payload described herein.

[0783] In various implementations, the RNA payload constructs considered herein may include 5'UTRs found in nature and 5'UTRs not found in nature. For example, the 5'UTR may be synthetic and / or may be altered in sequence relative to the naturally occurring 5'UTR. Such altered 5'UTRs may include one or more modifications relative to the naturally occurring 5'UTR, such as, for example, insertions, deletions, or altered sequences, or substitution of the naturally occurring nucleotide with one or more nucleotide analogs.

[0784] The 5' UTR begins at the transcription start site and extends to the start codon, but does not include the start codon; while the 3' UTR immediately follows the stop codon and extends until the transcription termination signal. Although we do not wish to be bound by theory, UTRs can play a regulatory role in nucleic acid translation and stability.

[0785] Natural 5' UTRs often contain features that play a role in translation initiation because they tend to contain Kozak sequences, which are generally considered to be involved in the ribosomal initiation of translation for many genes. The Kozak sequence has a consistent CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), followed by another 'G'. 5' UTRs are also known to form secondary structures involved in elongation factor binding.

[0786] In some embodiments of this disclosure, the 5' UTR is a heterologous UTR, i.e., a UTR found in nature that associates with a different mRNA. In another embodiment, the 5' UTR is a synthetic UTR, i.e., not found in nature. Synthetic UTRs include UTRs that have been mutated to improve their properties (e.g., increase gene expression) as well as completely synthetic UTRs. Exemplary 5' UTRs contain Xenopus laevis or human-derived α-globin or β-globin (e.g., US8,278,063 and US9,012,219), human cytochrome b-245 polypeptide and hydroxysteroid (17b) dehydrogenase and tobacco etch virus. The CMV Immediate Early 1 (IE1) gene (see US20140206753 and WO2013 / 185069), GGGAUCCUACC (SEQ ID NO: 29) (WO2014144196) may also be used. In another embodiment, the 5' UTR of the TOP gene is the 5' UTR of the TOP gene lacking the 5' TOP motif (oligopyrimidine bundle) (e.g., WO / 2015101414, WO2015101415, WO / 2015 / 062738, WO2015024667, WO2015024667; 5' UTR elements derived from the ribosomal macroprotein 32 (L32) gene (WO / 2015101414, WO2015101415, WO / 2015 / 062738)), and may use a 5' UTR element derived from the 5' UTR of the hydroxysteroid (17-β) dehydrogenase 4 gene (HSD17B4) (WO2015024667) or a 5' UTR element derived from the ATP5A1 (WO2015024667). In one implementation, the internal ribosome entry site (IRES) is used as a substitute for the 5' UTR.

[0787] In some embodiments, the 5' UTR of this disclosure contains SEQ ID NO: 30 (GGGAAAUAAGAGAGAAAAGA AGAGUAAGAA GAAAUAUAAG AGCCACC).

[0788] 3' UTR zone

[0789] In various embodiments, the mRNA payload of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein may include at least one 3' UTR. The 3' UTR may be heterologous or synthetic.

[0790] The 3' UTR is a region in mRNA located directly downstream (3') of a stop codon (the codon in the mRNA transcript that signals the termination of translation). The 3' UTR does not encode proteins (it is non-coding). Natural or wild-type 3' UTRs are known to contain embedded adenosine and uridine extensions. These AU-rich features are particularly prevalent in genes with high turnover rates. Based on their sequence characteristics and functional properties, AU-rich elements (AREs) can be classified into three classes (Chen et al., 1995): Class I AREs contain several scattered copies of the AUUUA motif within the U-rich region. C-Myc and MyoD contain Class I AREs. Class II AREs have two or more overlapping UUAUUUA(U / A)(U / A) nonmers. Molecules containing this type of ARE include GM-CSF and TNF-α. Class III AREs are not well-defined. These U-rich regions do not contain the AUUUA motif. c-Jun and myopoietin are two well-studied examples of this class. Most proteins that bind to AREs are known to destabilize messengers, while members of the ELAV family (most notably HuR) have been shown to increase mRNA stability. HuR binds to all three classes of AREs. Engineering a HuR-specific binding site into the 3' UTR of a nucleic acid molecule will result in HuR binding, thereby stabilizing in vivo signaling.

[0791] 3' UTRs are known to contain extensions of adenosine and uridine. These AU-rich features are particularly prevalent in genes with high turnover rates. Based on their sequence characteristics and functional properties, AU-rich elements (AREs) can be classified into three classes (Chen et al., 1995): Class I AREs contain several scattered copies of the AUUUA motif within the U-rich region. C-Myc and MyoD contain Class I AREs. Class II AREs have two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Molecules containing this type of ARE include GM-CSF and TNF-α. Class III AREs are not well-defined. These U-rich regions do not contain the AUUUA motif. c-Jun and myopoietin are two well-studied examples of this class. Most proteins that bind to AREs are known to destabilize messengers, while members of the ELAV family (most notably HuR) have been shown to increase mRNA stability. HuR binds to all three classes of AREs. Engineering a HuR-specific binding site into the 3' UTR of a nucleic acid molecule will result in HuR binding, thereby stabilizing in vivo information.

[0792] The introduction, removal, or modification of AU-rich elements (AREs) in the 3' UTR can be used to modulate the stability of the mRNA payload described herein. For example, one or more copies of ARE can be introduced to make the mRNA less stable, thereby reducing the translation of the resulting protein and decreasing its production. Alternatively, AREs can be identified and removed or mutated to increase intracellular stability, thereby increasing the translation and production of the resulting protein.

[0793] In some embodiments, introducing a feature typically expressed in genes of a target organ can enhance mRNA stability and protein production in that organ and / or tissue. As a non-limiting example, the feature may be a UTR. As another example, the feature may be an intron or a portion of an intron sequence.

[0794] Those skilled in the art will understand that heterologous or synthetic 5' UTRs can be used with any desired 3' UTR sequence. For example, a heterologous 5' UTR can be used with a synthetic 3' UTR having a heterologous 3' UTR.

[0795] Non-UTR sequences can also be used as regions or subregions within the RNA payload construct. For example, introns or portions of intron sequences can be incorporated into the nucleic acid regions of this disclosure. Incorporation of intron sequences can increase protein production and nucleic acid levels.

[0796] Combinations of features may be included in flanking regions and may be contained within other features. For example, a polypeptide coding region of interest in the mRNA payload may be flanked by a 5' UTR (which may contain a strong Kozak translation initiation signal) and / or a 3' UTR (which may contain a gamma nucleotide (dT) sequence for template addition of a poly-A tail). The 5' UTR may contain a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different genes, such as the 5' UTR described in U.S. Patent Application Publication No. 20100293625 and PCT / US2014 / 069155, which are incorporated herein by reference in their entirety.

[0797] It should be understood that any UTR from any gene can be incorporated into a region of an RNA payload molecule (e.g., linear mRNA). Furthermore, multiple wild-type UTRs of any known gene can be utilized. Artificial UTRs that provide variants that are not wild-type regions are also within the scope of this disclosure. These UTRs, or portions thereof, may be positioned in the same orientation as the transcript from which they were selected, or may be altered in orientation or position. Thus, a 5' UTR or a 3' UTR can be inverted, shortened, lengthened, or made from one or more other 5' UTRs or 3' UTRs. As used herein, the term "altered" when referring to a UTR sequence means that the UTR has been altered to some extent relative to a reference sequence. For example, a 3' UTR or a 5' UTR can be altered relative to a wild-type or native UTR by changes in orientation or position as taught above, or by changes including additional nucleotides, deletions of nucleotides, exchanges, or transposable nucleotides. Any of these alterations that produce an "altered" UTR (whether 3' or 5') includes a variant UTR.

[0798] In some implementations, dual, triple, or quadruple UTRs, such as 5' UTRs or 3' UTRs, may be used. As used herein, a "dual" UTR is a UTR that encodes copies of two identical UTRs in a tandem or substantially tandem manner. For example, a dual β-globin 3' UTR may be used, as described in U.S. Patent Publication 20100129877, the contents of which are incorporated herein by reference in their entirety.

[0799] Patterned UTRs are also within the scope of this disclosure. As used herein, a “patterned UTR” is a UTR that reflects a repeating or alternating pattern, such as ABABAB or AABBAABBAABB or ABCABCABC or variants thereof repeated once, twice or more than three times. In these patterns, each letter A, B or C represents a different UTR at the nucleotide level.

[0800] In some embodiments, the lateral region is selected from a family of transcripts whose proteins share a common function, structure, characteristic, or property. For example, the polypeptide of interest may belong to a family of proteins expressed in a particular cell, tissue, or at a specific time during development. A UTR from any of these genes may be exchanged with any other UTR from the same or different protein families to produce a new polynucleotide. As used herein, "family of proteins" is used in the broadest sense to refer to a group of two or more polypeptides of interest that share at least one function, structure, characteristic, location, origin, or expression pattern.

[0801] The untranslated region may also contain translation enhancement sub-elements (TEEs). As a non-limiting example, TEEs may include those described in U.S. Application No. 20090226470 (which is incorporated herein by reference in its entirety) and those TEEs known in the art.

[0802] 5' with a hat

[0803] In various implementations, the mRNA payload of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein may include a 5' cap structure.

[0804] The 5' cap structure of mRNA participates in nuclear export, increases mRNA stability, and binds to mRNA cap-binding proteins (CBPs). These CBPs associate with poly(A)-binding proteins to form mature circular mRNA species responsible for mRNA stability and translational capacity in the cell. The cap further assists in the removal of 5' proximal introns during mRNA splicing.

[0805] Endogenous mRNA molecules can be capped at the 5' end, thereby creating a 5'-ppp-5'-triphosphate bond between the terminal guanylate cap residue and the 5'-terminal transcription sense nucleotide of the mRNA molecule. This 5'-guanylate cap can then be methylated to produce an N7-methyl-guanylate residue. The ribose of the terminal and / or preterminal transcription nucleotides at the 5' end of the mRNA can also optionally be 2'-O-methylated. 5'-uncapping, performed by hydrolysis and cleavage of the guanylate cap structure, can target nucleic acid molecules (such as mRNA molecules) for degradation.

[0806] Modification of mRNA can create a non-hydrolyzable cap structure, preventing decapping and thus increasing the mRNA half-life. Since cap hydrolysis requires cleavage of the 5'-ppp-5' phosphodiester bond, modified nucleotides can be used during the capping reaction. For example, vaccinia capping enzyme from New England Biolabs (Ipswich, MA) can be used with α-thioguanosine nucleotides, according to the manufacturer's instructions, to generate phosphothiodiester bonds in the 5'-ppp-5' cap.

[0807] Additional modified guanosine nucleotides, such as α-methylphosphonates and selenyl phosphate nucleotides, can be used.

[0808] Additional modifications include, but are not limited to, 2'-O-methylation of the ribose of the 5' terminal and / or 5' preterminal nucleotides of mRNA on the 2'-hydroxyl group of the sugar ring (as described above). A variety of different 5'-cap structures can be used to generate 5'-caps for nucleic acid molecules (such as mRNA molecules).

[0809] Cap analogs, also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, have a chemical structure that differs from the natural (i.e., endogenous, wild-type, or physiological) 5'-cap while retaining cap function. Cap analogs can be synthesized and / or ligated to nucleic acid molecules via chemical (i.e., non-enzymatic) or enzymatic methods.

[0810] For example, the cap of an antiretroviral cap analog (ARCA) contains two guanines linked by 5'-5'-triphosphate groups, one of which contains an N7-methyl group and a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine (m 7 G-3'mppp-G; which can be equivalently represented as 3' O-Me-m7G(5')ppp(5')G). The 3'-O atom of another unmodified guanine is attached to the 5' terminal nucleotide of the capped nucleic acid molecule (e.g., mRNA). N7-methylated guanine and 3'-O-methylated guanine provide the terminal portion of the capped nucleic acid molecule (e.g., mRNA).

[0811] Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-O-methyl group on the guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m 7 Gm-ppp-G).

[0812] Although cap analogs allow for simultaneous capping of nucleic acid molecules during in vitro transcription reactions, up to 20% of the transcripts remain uncapped. This phenomenon, along with the structural differences between cap analogs and the endogenous 5'-cap structure of nucleic acids produced by endogenous cellular transcription mechanisms, can lead to decreased translational capacity and reduced cell stability.

[0813] To produce a more realistic 5'-cap structure, mRNA can also be capped post-transcriptionally using an enzyme. As used herein, the phrase "more realistic" refers to a feature that structurally or functionally closely reflects or mimics an endogenous or wild-type characteristic. That is, a "more realistic" feature better represents endogenous, wild-type, natural, or physiological cellular function and / or structure compared to existing synthetic features or analogues, or outperforms the corresponding endogenous, wild-type, natural, or physiological characteristic in one or more aspects. Non-limiting examples of more realistic 5'-cap structures are those 5'-cap structures that, compared to synthetic 5'-cap structures (or wild-type, natural, or physiological 5'-cap structures) known in the art, have, among other things, enhanced cap-binding protein binding, increased half-life, reduced sensitivity to 5' endonucleases, and / or reduced 5' uncapping. For example, recombinant vaccinia virus capping enzymes and recombinant 2'-O-methyltransferases can create a canonical 5'-5'-triphosphate bond between the 5' terminal nucleotide and the guanine cap nucleotide of mRNA, wherein the guanine cap contains N7 methylation and the 5' terminal nucleotide of mRNA contains 2'-O-methylation. This structure is called the Capl structure. Compared with other 5' cap analogs known in the art, this cap produces higher translational efficiency and cell stability, as well as reduced activation of pro-inflammatory cytokines. Cap structures include, but are not limited to, 7mG(5 * )ppp(5 * )N,pN2p (cap 0), 7mG(5 * )ppp(5 * )NlmpNp (cap 1) and 7mG (5 * )-ppp(5')NlmpN2mp (hat2).

[0814] In some implementations, the 5' end cap may include an endogenous cap or cap analogue.

[0815] In some embodiments, the 5' terminal cap may contain a guanine analog. Useful guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-dezo-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0816] IRES sequence

[0817] In various implementations, the mRNA payload of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein may include one or more IRES sequences.

[0818] In some implementations, the mRNA may contain an internal ribosome entry site (IRES). IRES were initially identified as a characteristic feature of picorna virus RNA, playing a crucial role in initiating protein synthesis in the absence of a 5' cap. An IRES may serve as a single ribosome binding site or as one of multiple ribosome binding sites for the mRNA. mRNAs containing more than one functional ribosome binding site may encode several peptides or polypeptides that are independently translated by ribosomes. Non-limiting examples of IRES sequences that may be used include, but are not limited to, those from: picorna viruses (e.g., FMDV), insect pest viruses (CFFV), poliovirus (PV), encephalomyocytovirus (ECMV), foot-and-mouth disease virus (FMDV), hepatitis C virus (HCV), classical swine fever virus (CSFV), murine leukemia virus (MLV), simian immunodeficiency virus (SIV), or cricket paralysis virus (CrPV).

[0819] In some implementations, IRES are derived from Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, simian virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, reticuloendotheliosis virus, human poliovirus 1, Plautia stali enterovirus, Kashmir bee virus, human rhinovirus 2, Homalodisca coagulata virus-1, human immunodeficiency virus type 1, Homalodisca coagulata virus-1, Himetobi P virus, hepatitis C virus, hepatitis A virus, GB hepatitis virus, foot-and-mouth disease virus, human enterovirus 71, equine rhinitis virus, and Ectropis microRNA-like virus. Obliquapicorna-like virus, encephalomyocarditis virus, Drosophila type C virus, human coxsackievirus B3, cruciferous tobacco mosaic virus, cricket paralysis virus, bovine viral diarrhea virus 1, Black Queen Cell virus, aphid-causing paralysis virus, avian encephalomyelitis virus, acute bee paralysis virus, hibiscus chlorotic ringspot virus, classical swine fever virus, human FGF2, human SFTPA1, human AML1 / RUNX1, Drosophila antennae (… Antennapedia), human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAP1, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kip1, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, Drosophila reaper, canine Scamper, Drosophila Ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP, Drosophila hairless, Saccharomyces cerevisiae (S).Cerevisiae (TFIID), Saccharomyces cerevisiae YAP1, Tobacco etch virus, Turnip crinkle virus, EMCV-A, EMCV-B, EMCV-Bf, EMCV-Cf, EMCV pEC9, Picobirnavirus, HCV QC64, Human Cosavirus E / D, Human Cosavirus F, Human Cosavirus JMY, Rhinovirus NAT001, HRV14, HRV89, HRVC-02, HRV-A21, Salivary virus A SH1, Salivary virus FHB, Salivary virus NG-J1, Human paraenteric orphan virus 1, Crohivirus B, Yc-3, Rosavirus M-7, Shanbavirus A, Pasivirus A, Pasivirus A2, Echovirus E14, Human Paraenterovirus 5, Aichi Virus, Hepatitis A Virus HA16, Phopivirus, CVA10, Enterovirus C, Enterovirus D, Enterovirus J, Human Pegivirus 2, GBV-C GT110, GBV-C K1737, GBV-C Iowa, Pegivirus A 1220, Pasi Virus A 3, Sapelovirus, Rose Virus B, Bakunsa Virus, Tremovirus A, Porcine Pasi Virus 1, PLV-CHN, Pasi Virus A, Sicinivirus, Hepatitis Virus K, Hepatitis Virus A, BVDV1, Border Disease Virus, BVDV2, CSFV-PK15C, SF573 Bicistronic Virus, Hubei Picorna-like Virus, CRPV, Salivary Virus A Aptamers of BNS, salivary virus A BN2, salivary virus A 02394, salivary virus A GUT, salivary virus A CH, salivary virus A SZ1, salivary virus FHB, CVB3, CVB1, echovirus 7, CVBS, EVA71, CVA3, CVA12, EV24, or eIF4G.

[0820] Poly-A tail and 3' stability region

[0821] In various embodiments, the mRNA payload of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein may include a poly-A tail.

[0822] During RNA processing, a long adenine nucleotide chain (poly-A tail) can be added to polynucleotides (such as mRNA molecules) to increase stability. Post-transcriptionally, the 3' end of the transcript can be immediately cleaved to release the 3' hydroxyl group. Then, a poly-A polymerase adds an adenine nucleotide chain to the free 3' hydroxyl end. This process, called polyadenylation, adds a poly-A tail of a certain length.

[0823] In some embodiments, the poly-A tail is longer than 30 nucleotides. In another embodiment, the poly-A tail is longer than 35 nucleotides (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1...). (100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500 and 3,000 nucleotides) and the length does not exceed approximately 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 2,000 or 3,000 nucleotides. In some embodiments, the mRNA comprises about 30 to about 3,000 nucleotides (e.g., 30 to 50, 30 to 100, 30 to 250, 30 to 500, 30 to 750, 30 to 1,000, 30 to 1,500, 30 to 2,000, 30 to 2,500, 50 to 100, 50 to 250, 50 to 500, 50 to 750, 50 to 1,000, 50 to 1,500, 50 to 2,000, 50 to 2,500, 50 to 3,000, 100 to 500, 100 to 750, 100 to 1,000, 100 to 1,500). 100 to 2,000, 100 to 2,500, 100 to 3,000, 500 to 750, 500 to 1,000, 500 to 1,500, 500 to 2,000, 500 to 2,500, 500 to 3,000, 1,000 to 1,500, 1,000 to Poly-A tails of 2,000, 1,000 to 2,500, 1,000 to 3,000, 1,500 to 2,000, 1,500 to 2,500, 1,500 to 3,000, 2,000 to 2,500 and 2,500 to 3,000.

[0824] In some implementations, the poly-A tail is designed relative to the length of the overall mRNA. This design may be based on the length of the region encoding the target of interest, the length of a specific feature or region (such as a flanking region), or the length of the final product expressed from the mRNA.

[0825] In this context, the length of the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% greater than the mRNA or its characteristics. The poly-A tail can also be engineered as a part of its parent mRNA. In this context, the poly-A tail can be the total length of the construct or the total length of the construct minus 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the poly-A tail. Furthermore, conjugation of engineered binding sites to the mRNA of poly-A binding proteins can enhance expression.

[0826] Additionally, various mRNAs can be linked to PABP (Poly-A binding protein) via the 3' end using modified nucleotides at the poly-A tail. Transfection experiments can be performed in relevant cell lines, and protein production can be measured by ELISA at 12, 24, 48, 72 hours, and day 7 post-transfection.

[0827] In some implementations, the mRNA is designed to contain a polyA-G tetrad. A G tetrad is a cyclic hydrogen-bonded array of four guanine nucleotides, which can be formed from G-rich sequences in DNA and RNA. In this implementation, the G tetrad is incorporated into the end of the poly-A tail.

[0828] stop codon

[0829] In various embodiments, the mRNA payload of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein may contain one or more translation stop codons. Translation stop codons UAA, UAG, and UGA are important components of the genetic code and signal the termination of mRNA translation. During protein synthesis, stop codons interact with protein release factors, and this interaction can regulate ribosome activity, thereby affecting translation (Tate WP et al., (2018) Biochem Soc Trans, 46(6):1615-162).

[0830] As used herein, a termination element refers to a nucleic acid sequence containing a stop codon. In the case of DNA, the stop codon may be selected from TGA, TAA, and TAG, or in the case of RNA, the stop codon may be selected from UGA, UAA, and UAG. In one embodiment, the termination element contains two consecutive stop codons. In another embodiment, the termination element contains three consecutive stop codons. In yet another embodiment, the termination element contains four consecutive stop codons. In yet another embodiment, the termination element contains five consecutive stop codons.

[0831] In some embodiments, the mRNA may contain one stop codon. In some embodiments, the mRNA may contain two stop codons. In some embodiments, the mRNA may contain three stop codons. In some embodiments, the mRNA may contain at least one stop codon. In some embodiments, the mRNA may contain at least two stop codons. In some embodiments, the mRNA may contain at least three stop codons. As non-limiting examples, the stop codons may be selected from TGA, TAA, and TAG.

[0832] In other embodiments, the termination codon may be selected from one or more of the following termination elements in Table (III):

[0833] Table (III): Additional Termination Elements

[0834]

[0835] In some implementations, the mRNA contains a stop codon TGA and an additional stop codon. In a further implementation, the added stop codon may be TAA.

[0836] microRNA binding sites and other regulatory elements

[0837] In various embodiments, the mRNA payload of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems and pharmaceutical compositions thereof described herein may include one or more regulatory elements, including but not limited to microRNA (miRNA) binding sites, structured mRNA sequences and / or motifs, artificial binding sites that bind to endogenous nucleic acid binding molecules, and combinations thereof.

[0838] Unmodified nucleotides

[0839] In some embodiments, the mRNA payload of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein is unmodified and comprises standard ribonucleotides consisting of adenosine, guanosine, cytosine, and uridine. In some embodiments, the nucleotides and nucleosides of this disclosure comprise standard nucleoside residues, such as those present in transcribed RNA (e.g., A, G, C, or U). In some embodiments, the nucleotides and nucleosides of this disclosure comprise standard deoxyribonucleosides, such as those present in DNA (e.g., dA, dG, dC, or dT).

[0840] Chemically modified nucleotides

[0841] In some embodiments, the mRNA payload of the LNP-based RNA vaccines, RNA therapeutics, nucleobase editing systems, and pharmaceutical compositions thereof described herein includes, in some embodiments, at least one chemical modification.

[0842] The terms “chemically modified” and “chemically modified” refer to modifications of at least one of adenosine (A), guanosine (G), uridine (U), thymidine (T), or cytidine (C) ribonucleosides or deoxyribonucleosides in position, pattern, percentage, or population. Typically, these terms do not refer to modifications of ribonucleotides in the 5' cap portion of naturally occurring mRNA. For peptides, the term “modification” refers to a modification relative to the canonical set of 20 amino acids. As provided herein, a peptide is also considered “modified” if it contains amino acid substitutions, insertions, or combinations of substitutions and insertions.

[0843] In some embodiments, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) contains a variety (more than one) different modifications. In some embodiments, a specific region of the polynucleotide contains one, two, or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, the modified RNA polynucleotide (e.g., modified mRNA polynucleotide) introduced into a cell or organism exhibits reduced degradation in the cell or organism relative to the unmodified polynucleotide. In some embodiments, the modified RNA polynucleotide (e.g., modified mRNA polynucleotide) introduced into a cell or organism may exhibit reduced immunogenicity (e.g., reduced innate response) in the cell or organism.

[0844] Modifications to polynucleotides include, but are not limited to, those described herein. Polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) may contain naturally occurring, non-naturally occurring modifications, or a combination of naturally occurring and non-naturally occurring modifications. Polynucleotides may contain any useful modifications, such as sugar, nucleobase, or internucleotide linkages (e.g., linkages to phosphate esters, phosphodiester linkages, or phosphodiester backbones).

[0845] In some implementations, the polynucleotide (e.g., RNA polynucleotides, such as mRNA polynucleotides) comprises non-naturally modified nucleotides introduced during or after polynucleotide synthesis to achieve the desired function or property. Modifications can be present at internucleotide links, purine or pyrimidine bases, or sugars. Modifications can be introduced at the ends of the chain or at any other location in the chain by chemical synthesis or polymerase. Any region of the polynucleotide can be chemically modified.

[0846] This disclosure provides modified nucleosides and nucleotides of polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides). A “nucleoside” is a compound containing a sugar molecule (e.g., pentose or ribose) or a derivative thereof combined with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as a “nucleobase”). A “nucleotide” is a nucleoside containing a phosphate group. Modified nucleotides can be synthesized by any useful method, such as, for example, chemical methods, enzymatic methods, or recombinant methods, to contain one or more modified or non-natural nucleosides. Polynucleotides may contain one or more regions linking nucleosides. Such regions may have variable backbone bonds. The bonds may be standard phosphodiester bonds, in which case the polynucleotide will contain the nucleotide region.

[0847] Modified nucleotide base pairings encompass not only standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides containing non-standard or modified bases and / or between modified nucleotides, wherein the arrangement of hydrogen bond donors and acceptors allows hydrogen bonding between non-standard bases and standard bases or between two complementary non-standard base structures. An example of such non-standard base pairings is the base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil. Any combination of base / sugar or linker can be incorporated into the polynucleotides of this disclosure.

[0848] In some embodiments, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) comprises a combination of at least two (e.g., 2, 3, 4 or more) of the aforementioned modified nucleobases.

[0849] In some embodiments, the modified nucleobases in the polynucleotide (e.g., RNA polynucleotides, such as mRNA polynucleotides) are selected from the group consisting of: pseudouridine (ψ), N1-methylpseudouridine (m... 1 ψ), N1-ethylpseuuridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deazo-pseuuridine, 2-thio-1-methyl-pseuuridine, 2-thio-5-aza-uridine, 2-thio-dihydropseuuridine, 2-thio-dihydrouridine, 2-thio-pseuuridine, 4-methoxy-2-thio-pseuuridine, 4-methoxy-pseuuridine, 4-thio-1-methyl-pseuuridine, 4-thio-pseuuridine, 5-aza-uridine, dihydropseuuridine, 5-methoxyuridine, and 2'-O-methyluridine. In some embodiments, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) comprises a combination of at least two (e.g., 2, 3, 4 or more) of the aforementioned modified nucleobases.

[0850] In some embodiments, the modified nucleobases in the polynucleotide (e.g., RNA polynucleotides, such as mRNA polynucleotides) are selected from the group consisting of: 1-methyl-pseuuridine (mRNA polynucleotides) 1 ψ), 5-methoxy-uridine (mo) 5 U), 5-methyl-cytidine (m 5 C) pseudouridine (ψ), α-thio-guanosine, and α-thio-adenosine. In some embodiments, the polynucleotide comprises a combination of at least two (e.g., two, three, four, or more) of the aforementioned modified nucleobases.

[0851] In some implementations, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) comprises pseudouridine (ψ) and 5-methylcytidine (m) 5 C). In some embodiments, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) contains 1-methyl-pseudour...

Claims

1. A compound of Formula (CT): (CT), or a pharmaceutically acceptable salt thereof, wherein: i) A is N; Z is a bond, , , , , , , , , , or wherein the bond marked with an “*” is attached to X 1 ; X 1 is optionally substituted C1-C6 aliphatic; and R 1 is selected from the group consisting of -OH, -OAc, -NR2, , , , , , , , , , and ; or ii) A is CH; Z is , , , , , , , , , or wherein the bond marked with an "*" is attached to X 1 ; X 1 is a bond or optionally substituted C1-C6aliphatic; and R 1 is selected from the group consisting of -OH, -OAc, -NR2, , , , , , , , , , and ; each R is independently -H or C1-C6 aliphatic; X 2 and X 3 each independently is optionally substituted C1-C 12 aliphatic; Y 1 and Y 2 are independently selected from the group consisting of: , , , , , , and ; wherein the bond marked "*" is attached to Y 1 X of Y 2 or Y 2 X of Y 3 ; R 2 is a bond or optionally substituted C1-C6aliphatic; R 3 is a bond or optionally substituted C1-C6aliphatic; R 4 is -CH(OR 6 )(OR 7 ), -CH(SR 6 )(SR 7 ), -CH(R 6 )(R 7 ), or optionally substituted C1-C 14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with optionally substituted C3-C8cycloalkylene, optionally substituted bridged bicyclic or polycyclic C5-C 14 cycloalkylene, phenyl, -0-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-; R 5 is -R 8 ; -CH(OR 8 )(OR 9 ); -CH(SR 8 )(SR 9 ); -CH(R 8 )(R 9 ); or optionally substituted -C1-C6aliphatic-R 8 ; R 6 and R 7 each independently is an optionally substituted C1-C 14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylene, an optionally substituted bridged bicyclic or polycyclic C5-C 14 cycloalkylene, phenyl, -0-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-; R 8 is optionally substituted C1-C 14 aliphatic, wherein at least one methylene linkage is replaced by a bivalent radical optionally substituted with a structure selected from the group consisting of , , , , , , , , , , , , , , , and ; and R 9 is optionally substituted C1-C 14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced by optionally substituted C3-C8cycloalkylene, optionally substituted bridged bicyclic or polycyclic C5-C 14 cycloalkylene, phenyl, -0-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)-, or -C(O)O-.

2. The compound of claim 1, wherein A is CH.

3. The compound of claim 1, wherein the compound is a compound of Formula (CT-A): (CT-A), or a pharmaceutically acceptable salt thereof.

4. The compound of claim 1, wherein the compound is a compound of Formula (CT-A1): (CT-A1), or a pharmaceutically acceptable salt thereof, wherein Z is or wherein the bond marked with an "*" is attached to X 1 ; and Y 1 and Y 2 are independently selected from the group consisting of: , , , , and ; wherein the bond marked "*" is attached to Y 1 of R 2 or Y 2 of R 3 .

5. The compound of claim 1, wherein the compound is a compound of Formula (CT-A2): (CT-A2), or a pharmaceutically acceptable salt thereof, wherein Z is or wherein the bond marked with an "*" is attached to X 1 ; and Y 1 and Y 2 each is wherein the bond marked "*" is attached to Y 1 R 2 or R 2 of Y 3 .

6. The compound of claim 1, wherein the compound is a compound of Formula (CT-B) or (CT-B’) (CT-B) (CT-B'), or a pharmaceutically acceptable salt thereof.

7. The compound of claim 1, wherein the compound is a compound of Formula (CT-C): (CT-C), or a pharmaceutically acceptable salt thereof.

8. The compound of claim 1, wherein the compound is a compound of Formula (CT-D) or (CT-D’): (CT-D), (CT-D'), or a pharmaceutically acceptable salt thereof.

9. The compound of claim 1, wherein the compound is a compound of Formula (CT-E), (CT-E’), or (CT-E”): (CT-E), (CT-E'), (CT-E''), or a pharmaceutically acceptable salt thereof.

10. The compound of claim 1, wherein the compound is a compound of Formula (CT-F), (CT-F’), (CT-F”), (CT-F’”), (CT-F’””), or (CT-F””’): (CT-F), (CT-F'), (CT-F''), (CT-F''), (CT-F''''), (CT-F''''), or a pharmaceutically acceptable salt thereof.

11. The compound of claim 1, wherein the compound is a compound of Formula (CT-G), (CT-G’), or (CT-G”): (CT-G), (CT-G'), (CT-G''), or a pharmaceutically acceptable salt thereof.

12. The compound of claim 1, wherein the compound is a compound of Formula (CT-H), (CT-H’), (CT-H”), (CT-H’”), (CT-H’””), or (CT-H””’): (CT-H), (CT-H'), (CT-H''), (CT-H'''), (CT-H''''), (CT-H''''), or a pharmaceutically acceptable salt thereof.

13. The compound of claim 1, wherein the compound is a compound of Formula (CT-I): (CT-I), or a pharmaceutically acceptable salt thereof.

14. The compound of claim 1, wherein the compound is a compound of Formula (CT-J) or (CT-J’): (CT-J), (CT-J'), or a pharmaceutically acceptable salt thereof.

15. The compound of claim 1, wherein the compound is a compound of Formula (CT-K), (CT-K’), or (CT-K”): (CT-K), (CT-K'), (CT-K"), or a pharmaceutically acceptable salt thereof.

16. The compound of claim 1, wherein the compound is a compound of Formula (CT-L), (CT-L’), (CT-L”), (CT-L’”), (CT-L’””), or (CT-L””’): (CT-L), (CT-L'), (CT-L''), (CT-L'''), (CT-L''''), (CT-L''''), or a pharmaceutically acceptable salt thereof.

17. The compound of claim 1, wherein the compound is a compound of formula (CT-M): (CT-M), or a pharmaceutically acceptable salt thereof.

18. The compound of claim 1, wherein the compound is a compound of formula (CT-N) or (CT-N’): (CT-N)、 (CT-N'), or a pharmaceutically acceptable salt thereof.

19. The compound of claim 1, wherein the compound is a compound of formula (CT-O), (CT-O’), or (CT-O”): (CT-O), (CT-O'), (CT-O"), or a pharmaceutically acceptable salt thereof.

20. The compound of claim 1, wherein the compound is a compound of formula (CT-P), (CT-P’), (CT-P”), (CT-P’”), (CT-P’””), or (CT-P””’): (CT-P), (CT-P'), (CT-P''), (CT-P'''), (CT-P'''), (CT-P'''), or a pharmaceutically acceptable salt thereof.

21. The compound of claim 1, wherein A is N.

22. The compound of claim 1, wherein the compound is a compound of formula (CT-Q): (CT-Q), or a pharmaceutically acceptable salt thereof.

23. The compound of claim 1, wherein the compound is a compound of formula (CT-Q1): (CT-Q1), or a pharmaceutically acceptable salt thereof, wherein Y 1 and Y 2 are independently selected from the group consisting of: , , , , and ; wherein the bond marked "*" is attached to Y 1 of R 2 or Y 2 of R 3 .

24. The compound of claim 1, wherein the compound is a compound of formula (CT-R) or (CT-R’): (CT-R)、 (CT-R'), or a pharmaceutically acceptable salt thereof.

25. The compound of claim 1, wherein the compound is a compound of formula (CT-S), (CT-S’), or (CT-S”): (CT-S), (CT-S'), (CT-S''), or a pharmaceutically acceptable salt thereof.

26. The compound of claim 1, wherein the compound is a compound of formula (CT-T), (CT-T’), (CT-T”), (CT-T’”), (CT-T’””), or (CT-T””’): (CT-T), (CT-T'), (CT-T''), (CT-T'''), (CT-T'''), (CT-T'''), or a pharmaceutically acceptable salt thereof.

27. The compound of claim 1, wherein the compound is a compound of formula (CT-U), (CT-U’), (CT-U”), (CT-U’”), (CT-U’””), or (CT-U””’): (CT-U), (CT-U'), (CT-U''), (CT-U''), (CT-U''' '), (CT-U''' '), (CT-U''' '), (CT-U''' '), (CT-U' or a pharmaceutically acceptable salt thereof.

28. The compound of claim 1, wherein the compound is a compound of formula (CT-V), (CT-V’), (CT-V”), (CT-V’”), (CT-V’””), or (CT-V””’): (CT-V), (CT-V'), (CT-V''), (CT-V''), (CT-V''''), (CT-V''''' ), or a pharmaceutically acceptable salt thereof.

29. The compound of any one of claims 1-3, 6, and 9, 10, wherein Z is 、 、 、 、 、 、 、 or .

30. The compound of any one of claims 1-3, 6, 9, 10, and 29, wherein Z is or .

31. The compound of any one of claims 1-20 and 29-30, wherein X 1 is a bond.

32. The compound of any one of claims 1-30, wherein X 1 is optionally substituted C1-C6 alkylene.

33. The compound of any one of claims 1-30 and 32, wherein X 1 is unsubstituted C1-C6alkylene.

34. The compound of any one of claims 1-26 and 29-33, wherein R 1 is -OH.

35. The compound of any one of claims 1-26 and 29-33, wherein R 1 is -NR2.

36. The compound of any one of claims 1-35, wherein X 2 is optionally substituted C1-C 12 alkylene.

37. The compound of any one of claims 1-35, wherein X 2 is optionally substituted C1-C 10 alkylene.

38. The compound of any one of claims 1-37, wherein X 3 is optionally substituted C1-C 12 alkylene.

39. The compound of any one of claims 1-37, wherein X 3 is optionally substituted C1-C 10 alkylene.

40. The compound of any one of claims 1-39, wherein X 2 and X 3 are the same.

41. The compound of claim 40, wherein X 2 and X 3 are each optionally substituted C6-C8 alkylene.

42. The compound of claim 40, wherein X 2 and X 3 are each -(CH2)7-.

43. The compound of any one of claims 1-39, wherein X 2 and X 3 are different.

44. The compound of any one of claims 1-5, 7, 9, 11, 13, 15, 17, 19, 21-23, and 29-43, wherein Y 1 and Y 2 each independently is 、 、 、 、 or .

45. The compound of any one of claims 1-5, 7, 9, 11, 13, 15, 17, 19, 21-23, and 29-44, wherein Y 1 and Y 2 each independently is or .

46. The compound of any one of claims 1-5, 7, 9, 11, 13, 15, 17, 19, 21-23, and 29-45, wherein Y 1 and Y 2 are both .

47. The compound of any one of claims 1-5, 7, 9, 11, 13, 15, 17, 19, 21-23, and 29-45, wherein Y 1 and Y 2 are both .

48. The compound of any one of claims 1-47, wherein R 2 is a bond.

49. The compound of any one of claims 1-47, wherein R 2 is optionally substituted C1-C6 alkylene.

50. The compound of any one of claims 1-49, wherein R 3 is a bond.

51. The compound of any one of claims 1-49, wherein R 3 is optionally substituted C1-C6 alkylene.

52. The compound of any one of claims 1-51, wherein R 2 and R 3 are the same.

53. The compound of any one of claims 1-51, wherein R 2 and R 3 are different.

54. The compound of any one of claims 1-8, 13, 14, 17, 18, 21-24, and 29-53, wherein R 4 is optionally substituted C1-C 14 aliphatic.

55. The compound of any one of claims 1-8, 13, 14, 17, 18, 21-24, and 29-54, wherein R 4 is selected from , , and .

56. The compound of any one of claims 1-8, 13, 14, 17, 18, 21-24, and 29-55, wherein R 5 is -R 8 or optionally substituted -C1-C6aliphatic-R 8 .

57. The compound of any one of claims 1-8, 13, 14, 17, 18, 21-24, and 29-56, wherein R 5 is optionally substituted C1-C 14 aliphatic.

58. The compound of any one of claims 1-8, 13, 14, 17, 18, 21-24, and 29-56, wherein R 5 is -R 8 .

59. The compound of any one of claims 1-56 and 58, wherein R 8 is optionally substituted C1-C 13 alkylene terminated with a structure selected from the group consisting of: 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 and .

60. The compound of any one of claims 1-56, 58, and 59, wherein R 8 is optionally substituted C1-C 13 alkylene terminated with a structure selected from the group consisting of: 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 and .

61. The compound of any one of claims 1-56 and 58-60, wherein R 8 is optionally substituted -CH2-, -(CH2)2-, -(CH2)3-, -(CH2)4-, -(CH2)5-, or -(CH2)6- terminated with a structure selected from the group consisting of: , , , , , , , , , , , , , , , , , , and .

62. The compound of any one of claims 1-56 and 58, wherein R 8 is a structure selected from the group consisting of: , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , and .

63. The compound of any one of claims 1-56 and 58-60, wherein R 8 is a structure selected from the group consisting of: , , , , , , , , , , , , , , , , , , , and .

64. The compound of claim 1, selected from any one or more of the compounds of Table (I), or a pharmaceutically acceptable salt thereof.

65. A pharmaceutical composition comprising: a) at least one lipid nanoparticle comprising at least one compound of any one of claims 1-64; and b) at least one nucleobase editing system.

66. The pharmaceutical composition of claim 65, wherein the nucleobase editing system comprises a CRISPR-Cas gene editing system.

67. The pharmaceutical composition of claim 65, wherein the nucleobase editing system comprises a prime editing system or components thereof.

68. The pharmaceutical composition of claim 65, wherein the nucleobase editing system comprises a reverse transcriptase editing system.

69. The pharmaceutical composition of claim 65, wherein the nucleobase editing system comprises a TnpB editing system.

70. The pharmaceutical composition of claim 65, wherein the nucleobase editing system comprises an integrase editing system.

71. The pharmaceutical composition of claim 65, wherein the nucleobase editing system comprises an integrase editing system.

72. The pharmaceutical composition of claim 65, wherein the nucleobase editing system comprises an epigenetic editing system.

73. The pharmaceutical composition of claim 65, wherein the nucleobase editing system comprises a gene writing system.

74. The pharmaceutical composition of claim 65, wherein the nucleobase editing system comprises a gene inactivation system.

75. The pharmaceutical composition of claim 65, wherein the nucleobase editing system comprises a zinc finger nuclease.

76. The pharmaceutical composition of claim 65, wherein the nucleobase editing system comprises a TALE nuclease, a TALE nickase, a zinc finger (ZF) nuclease, a ZF nickase, a meganuclease, or a combination thereof.

77. The pharmaceutical composition of claim 65, wherein the nucleobase editing system comprises a meganuclease.

78. The pharmaceutical composition of any one of claims 65-77, wherein the at least one lipid nanoparticle further comprises: i) at least one structural lipid; ii) at least one phospholipid; and iii) at least one PEGylated lipid.

79. The pharmaceutical composition of claim 78, wherein the at least one structural lipid is selected from the group consisting of cholesterol, coprostanol, fucosterol, beta-sitosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, cholic acid, sitostanol, lithocholic acid, tomatine, ursolic acid, alpha-tocopherol, vitamin D3, vitamin D2, calcipotriene, botulinum, lupeol, oleanolic acid, beta-sitosterol-acetate, and any combination thereof.

80. The pharmaceutical composition of claim 78, wherein the at least one phospholipid is selected from 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1.2-dioleoyl-sn-glycero-3- phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2- ditridecanyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3- phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesteryl hemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1- hexadecyl-sn-glycero-3-phosphocholine (CI 6 LysoPC), 1,2-dilinolenoyl-sn-glycero-3- phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl- sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleyl-sn-glycero-3- phosphoethanolamine, 1,2-dilinolenyl-sn-glycero-3-phosphoethanolamine, 1,2- diarachidoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3- phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sodium (S)-2-ammonio-3-((((R)-2-(oleoyloxy)-3-(stearoyloxy)propyl)oxy)phosphonoxy)propanoate (L-a-phosphatidylserine; brain PS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoyl phosphatidylglycerol (DMPG), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)- cyclohexane-1-carboxylate (DOPE-mal), dioleoyl phosphatidylglycerol (DOPG), 1,2- dioleoyl-sn-glycero-3-(phospho-L-serine) (DOPS), cell-fusion phospholipid (DPhPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), 1,2-dioleoyl-sn-phosphatidyl ethanolamine (DEPE), dipalmitoyl phosphatidylglycerol (DPPG), dipalmitoyl phosphatidylserine (DPPS), distearoyl phosphatidylcholine (DSPC), distearoyl-phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamine imidazole (DSPEI), 1,2-didodecanoyl-sn-glycero-phosphocholine (DUPC), egg phosphatidylcholine (EPC), 1,2-dioleoyl-sn-glycero-3-phosphate (18:1 PA; DOPA), bis((S)-2-hydroxy-3-(oleoyloxy)propyl)phosphonium ammonium (18:1 DMP; LBPA), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-myo-inositol) (DOPI; 18:1 PI), 1,2-distearoyl-sn-glycero-3-phospho-L-serine (18:0 PS), 1,2-dilinoleoyl-sn-glycero-3-phospho-L-serine (18:2 PS), 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (16:0-18:1 PS; POPS), 1-stearoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (18:0-18:1 PS), 1-stearoyl-2-linoleoyl-sn-glycero-3-phospho-L-serine (18:0-18:2 PS), 1-oleoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:1 Lyso PS), 1-stearoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:0 Lyso PS), and sphingomyelin.

81. The pharmaceutical composition of claim 78, wherein the at least one PEGylated lipid is selected from the group consisting of (R)-2,3-bis(octadecyloxy)propyl-l- (methoxypoly(ethylene glycol)2000)propyl aminocarbamate, PEG-S-DSG, PEG-S-DMG, PEG-PE, PEG-PAA, PEG-OH DSPE C18, PEG-DSPE, PEG-DSG, PEG-DPG, PEG-DOMG, PEG-DMPENa, PEG-DMPE, PEG-DMG2000, PEG-DMG C14, PEG-DMG 2000, PEG-DMG, PEG-DMA, PEG-ceramide C16, PEG-c-DOMG, PEG-c-DMOG, PEG-c-DMA, PEG-cDMA, PEGA, PEG750-C-DMA, PEG400, PEG2k-DMG, PEG2k-C11, PEG2000-PE, PEG2000P, PEG2000-DSPE, PEG2000-DOMG, PEG2000-DMG, PEG2000-C-DMA, PEG2000, PEG200, PEG(2k)-DMG, PEG DSPE C18, PEG DMPE C14, PEG DLPEC12, PEG Click DMG C14, PEG Click C12, PEG Click C10, N(carbonyl-methoxypolyethylene glycol-2000)-l,2-distearoyl-sn-glycero 3-phosphoethanolamine, Myrj52, mPEG-PLA, MPEG-DSPE, mPEG3000-DMPE, MPEG-2000-DSPE, MPEG2000-DSPE, mPEG2000-DPPE, mPEG2000-DMPE, mPEG2000-DMG, mDPPE-PEG2000, l,2-distearoyl-sn-glycero-3-phosphoethanolamine-PEG2000, HPEG-2K-LIPD, Folate PEG-DSPE, DSPE-PEGMA 500, DSPE-PEGMA, DSPE-PEG6000, DSPE-PEG5000, DSPE-PEG2K-NAG, DSPE-PEG2k, DSPE-PEG2000 maleimide, DSPE-PEG2000, DSPE-PEG, DSG-PEGMA, DSG-PEG5000, DPPE-PEG-2K, DPPE-PEG, DPPE-mPEG2000, DPPE-mPEG, DPG-PEGMA, DOPE-PEG2000, DMPE-PEGMA, DMPE-PEG2000, DMPE-Peg, DMPE-mPEG2000, DMG-PEGMA, DMG-PEG2000, DMG-PEG, Distearoyl-glycero-polyethylene glycol, Cl8PEG750, CI8PEG5000, CI8PEG3000, CI8PEG2000, CI6PEG2000, CI4PEG2000, C18-PEG5000, C18PEG, C16PEG, C16 mPEG (methoxypolyethylene glycol) 2000 ceramide, C14-PEG-DSPE200, C14-PEG2000, C14PEG2000, C14-PEG 2000, C14-PEG, C14PEG, 14:0-PEG2K PE, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-PEG2000, (R)-2,3-bis(octadecyloxy)propyl-1-(methoxypoly(ethylene glycol) 2000)propyl carbamate, (PEG)-C-DOMG, PEG-C-DMA, and DSPE-PEG-X.

82. The pharmaceutical composition of any one of claims 65-81, wherein the LNP further comprises at least one additional lipid component selected from 1,2-di-O-octadecenyl- sn-glycero-3-phosphocholine (18:0 diether PC), 1,2-dilinolenoyl-sn-glycero-3- phosphocholine (18:3 PC), acylcarnitine (AC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), N-oleoyl-sphingomyelin (SPM) (C18: l), N-tetracosanyl SPM (C24:0), N-ceramide sphingomyelin (C24: l), cardiolipin (CL), l,2-bis(tricos-10,12-diyn-eyl)-sn-glycero-3- phosphocholine (DC8-9 PC), dicetylphosphate (DCP), dipalmitylphosphocholine (DCP1), 1,2-dipalmitoylglycero-3-hemisuccinate (DGSucc), short chain bis-n- heptadecanoyl phosphatidylcholine (DHPC), dihexadecyl-phosphoethanolamine (DHPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), l,2-dilauroyl-sn-glycero-3-PE (DLPE), dimyristoylglycero hemisuccinate (DMGS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoyl phosphatidylglycerol (DMPG), dioleyloxybenzyl alcohol (DOBA), 1,2-dioleoylglycero-3-hemisuccinate (DOGHEMS), N-[2-(2-{2-[2-(2,3-bis-octadec-9-enyloxy-propoxy)-ethoxy]-ethoxy}- ethyl]-3-(3,4,5-trihydroxy-6-hydroxymethyl-tetrahydro-pyran-2-ylsulfanyl)-propionamide (DOGP4aMan), dioleoyl phosphatidylcholine (DOPC), dioleoyl phosphatidyl ethanolamine (DOPE), dioleoyl-phosphatidyl-ethanolamine 4-(N-maleimidomethyl)- cyclohexane-l-carboxylate (DOPE-mal), dioleoyl phosphatidylglycerol (DOPG), 1,2- dioleoyl-sn-glycero-3-(phospho-L-serine) (DOPS), cell fusion phospholipid (DPhPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), dipalmitoyl phosphatidylglycerol (DPPG), dipalmitoyl phosphatidylserine (DPPS), distearoyl phosphatidylcholine (DSPC), distearoyl-phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamine imidazole (DSPEI), 1,2-diphytanoyl-sn-glycero-phosphocholine (DUPC), egg phosphatidylcholine (EPC), histamine distearoylglycerol (HDSG), 1,2-dipalmitoylglycero-hemisuccinate-Na-histidine-hemisuccinate (HistSuccDG), N-(5'-hydroxy-3'-oxapentyl)-10-12-pentacosadiynoic amide (h-Pegi-PCDA), 2-[l-hexyloxyethyl]-2-devinyl pyro-phyllotoxin-a (HPPH), hydrogenated soy phosphatidyl choline (HSPC), l,2-dipalmitoyl glycerol-O-a-histidine-Na-hemisuccinate (IsohistsuccDG), mannosylated dipalmitoyl phosphatidyl ethanolamine (ManDOG), l,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[4-(p- maleimidomethyl)cyclohexane-carboxamide] (MCC-PE), l,2-diphytanoyl-sn-glycero-3- phosphoethanolamine (ME 16:0 PE), l-myristoyl-2-hydroxy-sn-glycero-phosphocholine (MHPC), thiol-reactive maleimide headgroup lipids (e.g., l,2-dioleoyl-sn-glycero-3- phosphoethanolamine-N-[4-(p-maleimidophenyl)butyramide] (MPB-PE)), nervonic acid (NA), sodium cholate (NaChol), l,2-dioleoyl-sn-glycero-3-[phosphoethanolamine-N- dodecanoyl] (NC12-DOPE), l-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3- phosphocholine (OChemsPC), phosphatidyl ethanolamine lipids (PE), PEG conjugated PE lipids (PEG) (e.g., polyethylene glycol-distearyl phosphatidyl ethanolamine lipids (PEG-PE)), phosphatidyl glycerol (PG), partially hydrogenated soy phosphatidyl choline (PHSPC), phosphatidyl inositol lipids (PI), phosphatidylinositol-4-phosphate (PIP), palmitoyloleoyl phosphatidyl choline (POPC), phosphatidyl ethanolamine (POPE), palmitoyloleoyl phosphatidyl glycerol (POPG), phosphatidyl serine (PS), lissamine rhodamine B-phosphatidyl ethanolamine lipids (Rh-PE), purified soy derived phospholipid mixture (S100), phosphatidyl choline (SM), 18-1-trans-PE, l-stearoyl-2-oleoyl-phosphatidyl ethanolamine (SOPE), soy phosphatidyl choline (SPC), sphingomyelin (SPM), a,a-trehalose-6,6'-dibehenate (TDB), l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (transDOPE), ((23S,5R)-3-(bis(hexadecyloxy)methoxy)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methyl methyl phosphate, 1,2-arachidonyl-sn-glycero-3-phosphocholine, 1,2-diarachidonyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaoyl-sn-glycero-3-phosphocholine, 1,2-Dodecahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-Dimaloyl-sn-glycero-3-phosphocholine, 1,2-Dimaloyl-sn-glycero-3-phosphoethanolamine, 1,2-Dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-Dioleyl-sn-glycero-3-phosphoethanolamine, 1,2-Distearoyl-sn-glycero-3-phosphoethanolamine, 16-O-Monomethyl PE, 16-O-Dimethyl PE, and Dioleylphosphatidylethanolamine.

83. A method of delivering a nucleobase editing system to a subject in need thereof, the method comprising administering to the subject the pharmaceutical composition of any one of claims 65-82.

84. The pharmaceutical composition of any one of claims 65-82 for use as a medicament.

85. Use of the pharmaceutical composition of any one of claims 65-82 for the manufacture of a medicament for delivering a nucleobase editing system.

86. A lipid nanoparticle (LNP) comprising the compound of any one of claims 1-64, or a pharmaceutically acceptable salt thereof.

87. The LNP of claim 86, further comprising: (a) a PEG-lipid (b) a structural lipid; and (c) a non-ionic and / or a zwitterionic lipid.

88. The LNP of claim 87, wherein the lipid nanoparticle further comprises an additional ionizable lipid other than the compound of Formula (AC).

89. The LNP of claim 87 or 88, wherein the PEG-lipid is selected from the group consisting of PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, and PEG-DSPE.

90. The LNP of any one of claims 86-89, wherein the structural lipid is selected from the group consisting of cholesterol, coprostanol, sitosterol, ergosterol, elaidosterol, soysterol, brassicasterol, tomatidine, ursolic acid, a-tocopherol.

91. The LNP of any one of claims 87-89, wherein the non-ionizable lipid is a phospholipid selected from the group consisting of 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1.2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-didodecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesteryl hemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3- phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2- diphytadinoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3- phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sodium (S)-2-ammonio-3-((((R)-2-(oleoyloxy)-3-(stearoyloxy)propyl)oxy)phosphonoxy)propanoate (L-a-phosphatidylserine; brain PS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoyl phosphatidylglycerol (DMPG), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)- cyclohexane-1-carboxylate (DOPE-mal), dioleoyl phosphatidylglycerol (DOPG), 1,2- dioleoyl-sn-glycero-3-(phospho-L-serine) (DOPS), cell-fusion phospholipid (DPhPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), dipalmitoyl phosphatidylglycerol (DPPG), dipalmitoyl phosphatidylserine (DPPS), distearoyl phosphatidylcholine (DSPC), distearoyl-phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamine imidazole (DSPEI), 1,2-didodecanoyl-sn-glycero-phosphocholine (DUPC), egg phosphatidylcholine (EPC), 1,2-dioleoyl-sn-glycero-3-phosphate (18:1 PA; DOPA), bis((S)-2-hydroxy-3-(oleoyloxy)propyl)phosphonium ammonium (18:1 DMP; LBPA), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-myo-inositol) (DOPI; 18:1 PI), 1,2-distearoyl-sn-glycero-3-phospho-L-serine (18:0 PS), 1,2-dilinoleoyl-sn-glycero-3-phospho-L-serine (18:2 PS), 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (16:0-18:1 PS; POPS), 1-stearoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (18:0-18:1 PS), 1-stearoyl-2-linoleoyl-sn-glycero-3-phospho-L-serine (18:0-18:2 PS), 1-oleoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:1 Lyso PS), 1-stearoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:0 Lyso PS), and sphingomyelin.

92. The LNP of any one of claims 86-91, further comprising a targeting moiety.

93. The LNP of claim 92, wherein the targeting moiety is an antibody or fragment thereof.

94. The LNP of any one of claims 86-93, further comprising an active agent.

95. The LNP of claim 94, wherein the active agent is a nucleic acid.

96. The LNP of claim 95, wherein the nucleic acid is a ribonucleic acid.

97. The LNP of claim 96, wherein the ribonucleic acid is at least one ribonucleic acid selected from the group consisting of small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), Dicer substrate RNA (dsRNA), small hairpin RNA (shRNA), messenger RNA (mRNA), and long non-coding RNA (lncRNA).

98. The LNP of claim 95, wherein the nucleic acid is a messenger RNA (mRNA) or a circular RNA.

99. The LNP of claim 98, wherein the mRNA comprises an open reading frame encoding a cancer antigen.

100. The LNP of claim 98, wherein the mRNA comprises an open reading frame encoding an immune checkpoint modulator.

101. The LNP of any one of claims 98-100, wherein the mRNA comprises at least one motif selected from the group consisting of a stem loop, a chain terminating nucleoside, a poly A sequence, a polyadenylation signal, and a 5’ cap structure.

102. The LNP of claim 95, wherein the nucleic acid is suitable for a genome editing technique.

103. The LNP of claim 102, wherein the genome editing technique is a clustered regularly interspaced short palindromic repeats (CRISPR) or a transcriptional activator-like effector nuclease (TALEN).

104. The LNP of claim 95, wherein the nucleic acid is at least one nucleic acid suitable for a genome editing technique selected from the group consisting of a CRISPR RNA (crRNA), a trans-activating crRNA (tracrRNA), a single guide RNA (sgRNA), and a DNA repair template.

105. The LNP of claim 98, wherein the mRNA is at least 30 nucleotides in length.

106. The LNP of claim 98, wherein the mRNA is at least 300 nucleotides in length.

107. A pharmaceutical composition comprising the LNP of any one of claims 86-106 and a pharmaceutically acceptable carrier.

108. The pharmaceutical composition of claim 107, formulated for intravenous or intramuscular administration.

109. The pharmaceutical composition of claim 108, formulated for intravenous administration.

110. A method for delivering a nucleic acid to a cell, comprising contacting the cell with the LNP of any one of claims 86-106 or the pharmaceutical composition of any one of claims 107-109.

111. A method for treating a disease characterized by a deficiency in a functional protein, the method comprising administering to a subject having the disease an LNP formulation comprising the LNP of any one of claims 86-106, wherein the mRNA encodes the functional protein or a protein having the same biological activity as the functional protein.

112. A method for treating a disease characterized by overexpression of a polypeptide, the method comprising administering to a subject having the disease an LNP formulation comprising the LNP of any one of claims 86-106 and an siRNA, wherein the siRNA targets expression of the overexpressed polypeptide.

Citation Information

Patent Citations

  • Split combined team food steamer

    CN2553700Y

  • Health shoes capable of acupuncture and magnetotherapy of foot acupoints

    CN2558242Y

  • Relaxing chair

    CN2560263Y

  • Golf club head with shock absorption structure

    CN2562806Y

  • Connector with earthing element

    CN2566494Y