Engineered bacterial outer membrane vesicles, and preparation method and application thereof
By constructing a DNA-pyrophosphate mineralization layer on the surface of OMV and designing a targeted A2 aptamer, the problems of immunogenicity signal shielding and release control of OMV were solved, enabling efficient tumor immunotherapy and targeted delivery.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-09
- Publication Date
- 2026-03-31
AI Technical Summary
Existing bacterial outer membrane vesicles (OMVs) can easily trigger a systemic cytokine storm while activating the immune system, affecting treatment safety and exhibiting poor targeting and release control.
A DNA-pyrophosphate mineralization layer was constructed on the surface of OMV to act as a physical barrier to shield immunogenic signals, and intelligent release was achieved by targeting macrophages through A2 aptamers.
It effectively shields the surface immunogenic signals of OMV, improves targeting and release control, enhances anti-tumor effects, and reduces systemic toxicity.
Smart Images

Figure CN121754501A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to an engineered bacterial outer membrane vesicle, its preparation method, and its application. Background Technology
[0002] Bacterial outer membrane vesicles (OMVs) are nanoscale (approximately 20-250 nm in diameter) bilayer membrane structures actively secreted by Gram-negative bacteria during their growth. As a natural bioactive carrier, OMVs carry various pathogen-associated molecular patterns on their surface, including lipopolysaccharides, outer membrane proteins, peptidoglycans, and flagellin. They can effectively activate innate immune responses through pattern recognition receptors on the surface of host immune cells and further induce adaptive immune responses, thus showing significant potential in vaccine development, immunotherapy, and drug delivery.
[0003] In tumor immunotherapy, the lipopolysaccharide, nucleic acid, and protein components carried by OMV can activate key immune signaling pathways such as Toll-like receptors, cGAS-STING, and NLRP3 inflammasomes, inducing immunogenic cell death and releasing damage-related molecules, thereby stimulating a systemic anti-tumor immune response. However, while activating the immune system, OMV induces the production of interferon-γ, which feedback-upregulates the expression of PD-L1 on the surface of tumor cells, leading to the formation of an immunosuppressive microenvironment and thus limiting its monotherapy efficacy. To overcome this limitation, existing technologies have attempted to genetically engineer OMV. For example, Nie Guangjun's team developed a bifunctional engineered OMV capable of simultaneously achieving immune activation and PD-1 / PD-L1 blockade to enhance its anti-tumor effect.
[0004] In the fields of anti-infective immunization and vaccine design, OMV has been used in the development of various bacterial vaccines due to its natural immunogenicity. To further enhance its lymphatic system targeting and delivery efficiency, current research employs physicochemical methods to reconstruct the structure of OMV. For example, Ilkoo Noh's team used styrene-maleic acid copolymers to deconstruct and reconstruct intact OMV into nanodisc structures of approximately 10 nm, significantly improving its enrichment capacity and antigen presentation efficiency in lymph nodes, providing a new approach for developing highly effective broad-spectrum antibacterial vaccines.
[0005] In targeted drug delivery, OMV can serve as a natural delivery carrier for gene drugs, proteins, or chemical drugs. To improve its targeting, Zhou Shaobing's team modified the surface of OMV with the tumor-targeting peptide LyP1, enhancing its endocytosis efficiency on tumor cells that highly express p32 protein. Furthermore, they combined this with electroporation technology to load PD-1 expression plasmids into the OMV, achieving targeted delivery and local expression of gene drugs. In animal models, this demonstrated good local immune blocking effects and synergistic effects with systemic immunity.
[0006] However, despite some progress in the functionalization of OMV, it still faces a key bottleneck in clinical translation: the immunogenic components (such as lipopolysaccharides) present on the surface of OMV can easily overactivate the natural immune system in vivo, especially under systemic administration conditions, triggering severe cytokine storms and other systemic toxic reactions, seriously threatening treatment safety.
[0007] Therefore, how to effectively shield OMV's early immune recognition signals while preserving its immune activation ability, and how to achieve precise spatiotemporal regulation of its biological activity, has become a core technical problem that urgently needs to be solved. Summary of the Invention
[0008] The purpose of this invention is to provide an engineered bacterial outer membrane vesicle, its preparation method and application. The surface of the engineered bacterial outer membrane vesicle is a DNA-pyrophosphate mineralization layer that serves as a physical barrier, which can effectively shield the strong immunogenic signals on the OMV surface. While achieving highly efficient tumor immunotherapy, it has significant advantages such as simple method, high efficiency and high biocompatibility.
[0009] To achieve the above objectives, a specific embodiment of the present invention provides the following technical solution:
[0010] An engineered bacterial outer membrane vesicle, the engineered bacterial outer membrane vesicle comprising a bacterial outer membrane vesicle and a DNA-pyrophosphate mineralization layer covering the surface of the bacterial outer membrane vesicle;
[0011] The DNA in the DNA-pyrophosphate mineralization layer contains the A2 aptamer.
[0012] In one or more embodiments of the present invention, the A2 aptamer sequence is shown in SEQ ID NO.4.
[0013] In one or more embodiments of the present invention, the pyrophosphate in the DNA-pyrophosphate mineralization layer is calcium pyrophosphate.
[0014] Another specific embodiment of the present invention provides the following technical solution:
[0015] A method for preparing engineered bacterial outer membrane vesicles, the method comprising the following steps:
[0016] Mix deionized water, circular DNA template containing A2 aptamers, and buffer solution to obtain a mixture;
[0017] Add bacterial outer membrane vesicles to the mixture, mix well, and incubate.
[0018] After incubation, add calcium chloride solution and mix well;
[0019] The mixture with added calcium chloride solution was subjected to rolling ring amplification reaction;
[0020] After the rolling circle amplification reaction was completed, the product was purified by centrifugation to obtain engineered bacterial outer membrane vesicles.
[0021] In one or more embodiments of the present invention, the preparation of the circular DNA template containing the A2 aptamer is as follows:
[0022] Design and synthesize ssDNA-1 modified with 5' end phosphorylation, wherein the ssDNA-1 contains an A2 aptamer antisense sequence;
[0023] Design primers for ssDNA-1 containing the GN6 aptamer, wherein the 5' and 3' ends of ssDNA-1 are complementary to the 3' and 5' ends of the primers, respectively.
[0024] Mix ssDNA-1 and primers, add NaCl, and use sterile water to bring the volume to a suitable level. Then, use a heating annealing process to synthesize circular DNA-1 with a notch at the end.
[0025] Circular DNA-1, T4 DNA ligase, and buffer were mixed and reacted at 4℃-16℃ for 6-12 hours to obtain a circular DNA template containing the A2 aptamer.
[0026] In one or more embodiments of the present invention, the molar ratio of ssDNA-1 to primer is 1:1 to 1:2, NaCl with a final concentration of 60 mmol / L to 80 mmol / L is added, and sterile water is used to bring the volume to 20 μL.
[0027] In one or more embodiments of the present invention, the heating annealing process is as follows:
[0028] Step 1: Hold at 95℃ for 2 minutes;
[0029] Step 2, maintain at 65℃ for 2 minutes;
[0030] Step 3, maintain at 60℃ for 5 minutes and 30 seconds;
[0031] Step 4, maintain at 20℃ for 30 seconds;
[0032] Step 5, store at 10℃;
[0033] In steps 3 and 4, the temperature decreases by 0.5°C every 30 seconds, and the cycle is repeated 80 times.
[0034] In one or more embodiments of the present invention, the incubation conditions for adding bacterial outer membrane vesicles to the mixture are: temperature 35℃-37℃, time 20min-40min.
[0035] In one or more embodiments of the present invention, the rolling circle amplification reaction is performed as follows: dNTPs and phi 29 DNA polymerase are added to the mixture, mixed well, and incubated at 35℃-37℃ for 2h-4h.
[0036] Another specific embodiment of the present invention provides the following technical solution:
[0037] Application of engineered bacterial outer membrane vesicles in immunomodulation and anti-tumor therapy.
[0038] Compared with the prior art, the present invention has the following beneficial effects:
[0039] 1. Existing genetic engineering attenuation or polymer coating technologies are complex to operate or may introduce new biocompatibility problems. This invention constructs a DNA-pyrophosphate mineralization layer in situ on the surface of OMV as a physical barrier, which effectively shields the strong immunogenic signals on the surface of OMV.
[0040] 2. Unlike the uncontrollable or passively slow-release OMV in existing technologies, the mineralization layer of this invention can be rapidly degraded in the acidic environment of lysosomes, achieving "intelligent" release of OMV. Furthermore, by utilizing the programmability of DNA sequences, a poly-A2 aptamer is integrated into the mineralization layer, enabling the engineered OMV to actively target the CD14 protein on the surface of macrophages, enhancing its uptake efficiency on target cells and solving the problem of non-specific distribution.
[0041] 3. With the dual guarantee of efficient targeted delivery and lysosomal controlled release, the engineered bacterial outer membrane vesicles (OMV@Apt) in this invention can more effectively induce macrophages to polarize to the anti-tumor M1 phenotype, exhibiting excellent local and systemic anti-tumor effects in melanoma models. Attached Figure Description
[0042] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0043] Figure 1 This is a scanning transmission electron microscope image of OMV@Apt in one embodiment of the present invention;
[0044] Figure 2 This is a curve showing the size change of OMV@Apt over time in an acidic buffer solution in one embodiment of the present invention.
[0045] Figure 3 This illustrates the uptake of OMV@Apt by macrophages in one embodiment of the present invention.
[0046] Figure 4 This is a colocalization map of OMV@Apt in lysosomes in one embodiment of the present invention;
[0047] Figure 5 For the analysis of the secretion levels of inflammatory cytokines after macrophages were stimulated by different materials in one embodiment of the present invention, the material groups were PBS group, OMV group, OMV@NC group and OMV@Apt group;
[0048] Figure 6 In one embodiment of the present invention, tumor images of melanoma mice were taken on day 14 after injection of different materials. The material groups were PBS group, OMV group, OMV@NC group and OMV@Apt group.
[0049] Figure 7 To detect the expression of characteristic proteins of macrophages in melanoma sites on day 14 after injection of different materials in one embodiment of the present invention, the material groups were PBS group, OMV group, OMV@NC group and OMV@Apt group;
[0050] Figure 8 The images shown are of tumors (primordial tumor / distal tumor) in a bilateral melanoma mouse model taken on day 14 after injection of different materials in one embodiment of the present invention. The material groups are PBS group, OMV group and OMV@Apt group. Detailed Implementation
[0051] To enable those skilled in the art to better understand the technical solutions in this disclosure, the technical solutions in the embodiments of this disclosure are described clearly and completely below. Obviously, the described embodiments are only some embodiments of this disclosure, and not all embodiments. Based on the embodiments in this disclosure, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this disclosure.
[0052] One specific embodiment of the present invention provides an engineered bacterial outer membrane vesicle, comprising a bacterial outer membrane vesicle and a DNA-pyrophosphate mineralization layer covering the surface of the bacterial outer membrane vesicle; the DNA in the DNA-pyrophosphate mineralization layer contains an A2 aptamer.
[0053] Specifically, by coating the surface of bacterial outer membrane vesicles (OMVs) with a DNA-pyrophosphate mineralization layer, a physical barrier is formed, effectively shielding the strong immunogenic signals on the OMV surface. The DNA-pyrophosphate mineralization layer can be rapidly degraded in the acidic environment of lysosomes, achieving "intelligent release" of OMVs. In addition, by introducing the A2 aptamer, the engineered OMVs can actively target macrophages to avoid CD14 protein, enhancing their uptake efficiency on target cells and solving the problem of non-specific distribution.
[0054] Furthermore, the A2 aptamer sequence is shown in SEQ ID NO.4, specifically GAAGAGTAGATGAAACGTTTTTTCGCCCGATAAAAGGGACGTGCGTCAGACA.
[0055] Furthermore, the pyrophosphate in the DNA-pyrophosphate mineralization layer is calcium pyrophosphate.
[0056] Another specific embodiment of the present invention provides a method for preparing engineered bacterial outer membrane vesicles, which specifically includes the following steps:
[0057] Step 1: Design a circular DNA template containing the A2 aptamer.
[0058] Specifically, DNA primers containing the GN6 aptamer sequence and DNA templates containing the A2 aptamer antisense sequence were designed. More specifically, ssDNA-1 modified with 5' phosphorylation and containing the A2 aptamer antisense sequence was designed and synthesized; primers for ssDNA-1 containing the GN6 aptamer were designed, with the 5' and 3' ends of ssDNA-1 complementary to the 3' and 5' ends of the primers, respectively.
[0059] Phosphorylated ssDNA-1 at the 5' end and primers were mixed at a molar ratio of 1:1 to 1:2. NaCl was added to a final concentration of 60 mmol / L to 80 mmol / L, and the volume was brought up to 20 μL with sterile water. A pre-designed heating annealing program was followed to synthesize circular DNA-1 with a terminal notch and a final concentration of 10 μmol. The heating annealing program was as follows: Step 1, 95°C for 2 min; Step 2, 65°C for 2 min; Step 3, 60°C for 5 min 30 s; Step 4, 20°C for 30 s; Step 5, maintained at 10°C. In steps 3 and 4, the temperature was decreased by 0.5°C every 30 s, and the cycle was repeated 80 times.
[0060] Add 7 μL of T4 DNA ligase to 20 μL of circular DNA-1, and use 1 × T4 buffer to make the total volume 80 μL. React at 4℃-16℃ for 6 to 12 hours to obtain a circular DNA template product containing A2 aptamers.
[0061] Step 2: Mix deionized water, circular DNA template containing A2 aptamer, and buffer solution to obtain a mixture.
[0062] Specifically, the buffer solution is 10 × NH4Cl buffer.
[0063] Step 3: Add bacterial outer membrane vesicles to the mixture, mix well, and incubate.
[0064] Specifically, the mixture is incubated in a constant temperature mixer at 35℃-37℃ and 450rpm for 20min-40min.
[0065] Step 4: After incubation, add calcium chloride solution and mix well.
[0066] Specifically, the concentration of the calcium chloride solution is 1.25 mmol / L.
[0067] Step 5: Perform rolling circle amplification (RCA) reaction on the mixture containing calcium chloride solution.
[0068] Specifically, add dNTPs solution to the mixture, mix, then add phi 29 DNA polymerase and mix again. Then incubate the mixture at 35℃-37℃ and 450rpm for 2-4 hours.
[0069] Step 6: After the rolling circle amplification reaction is completed, the product is centrifuged and purified to obtain engineered bacterial outer membrane vesicles.
[0070] Specifically, the obtained product is purified by centrifugation at 12,000 rpm to remove unreacted dNTPs, enzymes and other small molecule impurities, thus obtaining the final engineered OMV (OMV@Apt).
[0071] Another specific embodiment of the present invention provides the application of engineered bacterial outer membrane vesicles in immune regulation and anti-tumor therapy.
[0072] The present invention will be further described in detail below with reference to specific embodiments.
[0073] Example 1
[0074] Method for preparing circular DNA templates containing A2 aptamers:
[0075] The sequences of ssDNA-1, ssDNA-2, primers, A2 aptamer, and GN6 aptamer modified with phosphorylation at the 5' end are shown in Table 1:
[0076] Table 1: Deoxynucleotide sequences
[0077]
[0078] Preparation of circular DNA template 1:
[0079] a. Design and synthesize 5' phosphorylated modified ssDNA-1 with 110 bases. Design primers for ssDNA-1 with 106 bases. The 5' and 3' ends of ssDNA-1 are complementary to the 3' and 5' ends of the primers, respectively.
[0080] The nucleotide sequence of ssDNA-1 is shown in SEQ ID NO.1, as shown in Table 1.
[0081] The nucleotide sequences of the primers are shown in SEQ ID NO.3, as shown in Table 1.
[0082] The sequence of the A2 aptamer is shown in SEQ ID NO.4, as shown in Table 1.
[0083] The sequence of the GN6 aptamer is shown in SEQ ID NO.5, as shown in Table 1.
[0084] b. Mix 5' phosphorylated ssDNA-1 and primers in a 1:1 molar ratio, with 100 μmol of ssDNA-1 and 100 μmol of primers. Add NaCl to a final concentration of 80 mmol / L and bring the total volume to 20 μL with sterile water. Synthesize the nicked circular DNA-1 according to the following heating and annealing procedure.
[0085] Annealing process: Between steps 3 and 4, the temperature decreases by 0.5°C every 30 seconds, and the cycle is repeated 80 times.
[0086] Step 1: 95℃ for 2 min;
[0087] Step 2: 65℃ for 2 min;
[0088] Step 3: 60℃ for 5 min 30 s;
[0089] Step 4: 20℃ for 30 seconds;
[0090] Step 5: Store at 10℃.
[0091] c. Add 8 μL of 10 × T4 DNA ligase buffer and 7 μL of T4 DNA ligase solution to the product from step b. Finally, bring the volume to 80 μL with deionized water and react at 16°C for 12 hours. A circular DNA template containing the A2 aptamer is obtained.
[0092] Example 2
[0093] Method for preparing circular DNA templates containing A2 aptamers:
[0094] The sequences of ssDNA-1, ssDNA-2, and primers with 5' phosphorylation modification are shown in Table 2:
[0095] Table 2: Deoxynucleotide sequences
[0096]
[0097] Preparation of circular DNA template 1:
[0098] a. Design and synthesize 5' phosphorylated modified ssDNA-1 with 80 bases. Design primers for ssDNA-1 with 108 bases. The 5' and 3' ends of ssDNA-1 are complementary to the 3' and 5' ends of the primers, respectively.
[0099] The nucleotide sequence of ssDNA-1 is shown in SEQ ID NO.6, as shown in Table 2.
[0100] The nucleotide sequences of the primers are shown in SEQ ID NO.8, as shown in Table 2.
[0101] b. Mix 5' phosphorylated ssDNA-1 and primers in a 1:1 molar ratio, with 100 μmol of ssDNA-1 and 100 μmol of primers. Add NaCl to a final concentration of 80 mmol / L and bring the total volume to 20 μL with sterile water. Synthesize the nicked circular DNA-1 according to the following heating and annealing procedure.
[0102] Annealing process: Between steps 3 and 4, the temperature decreases by 0.5°C every 30 seconds, and the cycle is repeated 80 times.
[0103] Step 1: 95℃ for 2 min;
[0104] Step 2: 65℃ for 2 min;
[0105] Step 3: 60℃ for 5 min 30 s;
[0106] Step 4: 20℃ for 30 seconds;
[0107] Step 5: Store at 10℃.
[0108] c. Add 8 μL of 10× T4 DNA ligase buffer and 7 μL of T4 DNA ligase solution to the product from step b. Finally, bring the volume to 80 μL with deionized water and react at 16°C for 12 hours. A circular DNA template containing the A2 aptamer is obtained.
[0109] Example 3
[0110] Method for preparing circular DNA templates containing A2 aptamers:
[0111] The sequences of ssDNA-1, ssDNA-2, and primers modified with phosphorylation at the 5' end are shown in Table 3:
[0112] Table 3: Deoxynucleotide sequences
[0113]
[0114] Preparation of circular DNA template 1:
[0115] a. Design and synthesize 5' phosphorylated modified ssDNA-1 with 107 bases. Design primers for ssDNA-1 with 102 bases. The 5' and 3' ends of ssDNA-1 are complementary to the 3' and 5' ends of the primers, respectively.
[0116] The nucleotide sequence of ssDNA-1 is shown in SEQ ID NO.9, as shown in Table 3.
[0117] The nucleotide sequences of the primers are shown in SEQ ID NO.11, as shown in Table 3.
[0118] b. Mix 5' phosphorylated ssDNA-1 and primers in a 1:1 molar ratio, with 100 μmol of ssDNA-1 and 100 μmol of primers. Add NaCl to a final concentration of 80 mmol / L and bring the total volume to 20 μL with sterile water. Synthesize the nicked circular DNA-1 according to the following heating and annealing procedure.
[0119] Annealing process: Between steps 3 and 4, the temperature decreases by 0.5°C every 30 seconds, and the cycle is repeated 80 times.
[0120] Step 1: 95℃ for 2 min;
[0121] Step 2: 65℃ for 2 min;
[0122] Step 3: 60℃ for 5 min 30 s;
[0123] Step 4: 20℃ for 30 seconds;
[0124] Step 5: Store at 10℃.
[0125] c. Add 8 μL of 10 × T4 DNA ligase buffer and 7 μL of T4 DNA ligase solution to the product from step b. Finally, bring the volume to 80 μL with deionized water and react at 16°C for 12 hours. A circular DNA template containing the A2 aptamer is obtained.
[0126] Example 4
[0127] Method for preparing circular DNA templates without A2 aptamers:
[0128] a. Design and synthesize 5' phosphorylated modified ssDNA-2 with 110 bases and primers with 106 bases. The 5' and 3' ends of ssDNA-2 are complementary to the 3' and 5' ends of the primers, respectively.
[0129] The nucleotide sequence of ssDNA-2 is shown in SEQ ID NO.2, as shown in Table 1.
[0130] The nucleotide sequences of the primers are shown in SEQ ID NO.3, as shown in Table 1.
[0131] b. Mix 5' phosphorylated ssDNA-2 and primers in a 1:1 molar ratio, with 100 μmol of ssDNA-2 and 100 μmol of primers. Add NaCl to a final concentration of 80 mmol / L and bring the total volume to 20 μL with sterile water. Synthesize the nicked circular DNA-2 according to the following heating and annealing procedure.
[0132] Annealing process: Between steps 3 and 4, the temperature decreases by 0.5°C every 30 seconds, and the cycle is repeated 80 times.
[0133] Step 1: 95℃ for 2 min;
[0134] Step 2: 65℃ for 2 min;
[0135] Step 3: 60℃ for 5 min 30 s;
[0136] Step 4: 20℃ for 30 seconds;
[0137] Step 5: Store at 10℃.
[0138] c. Add 8 μL of 10× T4 DNA ligase buffer and 7 μL of T4 DNA ligase solution to the product from step b. Finally, bring the volume to 80 μL with deionized water and react at 16°C for 12 hours. This yields a circular DNA template without the A2 aptamer.
[0139] Example 5
[0140] Method for preparing circular DNA templates without A2 aptamers:
[0141] a. Design and synthesize ssDNA-2 with 5' phosphorylation modification. The number of bases in ssDNA-2 is 80, and the number of bases in the primer is 108. The 5' and 3' ends of ssDNA-2 are complementary to the 3' and 5' ends of the primer, respectively.
[0142] The nucleotide sequence of ssDNA-2 is shown in SEQ ID NO.7, as shown in Table 2.
[0143] The nucleotide sequences of the primers are shown in SEQ ID NO.8, as shown in Table 2.
[0144] b. Mix 5' phosphorylated ssDNA-2 and primers in a 1:1 molar ratio, with 100 μmol of ssDNA-2 and 100 μmol of primers. Add NaCl to a final concentration of 80 mmol / L and bring the total volume to 20 μL with sterile water. Synthesize the nicked circular DNA-2 according to the following heating and annealing procedure.
[0145] Annealing process: Between steps 3 and 4, the temperature decreases by 0.5°C every 30 seconds, and the cycle is repeated 80 times.
[0146] Step 1: 95℃ for 2 min;
[0147] Step 2: 65℃ for 2 min;
[0148] Step 3: 60℃ for 5 min 30 s;
[0149] Step 4: 20℃ for 30 seconds;
[0150] Step 5: Store at 10℃.
[0151] c. Add 8 μL of 10× T4 DNA ligase buffer and 7 μL of T4 DNA ligase solution to the product from step b. Finally, bring the volume to 80 μL with deionized water and react at 16°C for 12 hours. This yields a circular DNA template without the A2 aptamer.
[0152] Example 6
[0153] Method for preparing circular DNA templates without A2 aptamers:
[0154] a. Design and synthesize 5' phosphorylated modified ssDNA-2 with 108 bases and primers with 102 bases. The 5' and 3' ends of ssDNA-2 are complementary to the 3' and 5' ends of the primers, respectively.
[0155] The nucleotide sequence of ssDNA-2 is shown in SEQ ID NO.10, as shown in Table 3.
[0156] The nucleotide sequences of the primers are shown in SEQ ID NO.11, as shown in Table 3.
[0157] b. Mix 5' phosphorylated ssDNA-2 and primers in a 1:1 molar ratio, with 100 μmol of ssDNA-2 and 100 μmol of primers. Add NaCl to a final concentration of 80 mmol / L and bring the total volume to 20 μL with sterile water. Synthesize the nicked circular DNA-2 according to the following heating and annealing procedure.
[0158] Annealing process: Between steps 3 and 4, the temperature decreases by 0.5°C every 30 seconds, and the cycle is repeated 80 times.
[0159] Step 1: 95℃ for 2 min;
[0160] Step 2: 65℃ for 2 min;
[0161] Step 3: 60℃ for 5 min 30 s;
[0162] Step 4: 20℃ for 30 seconds;
[0163] Step 5: Store at 10℃.
[0164] c. Add 8 μL of 10× T4 DNA ligase buffer and 7 μL of T4 DNA ligase solution to the product from step b. Finally, bring the volume to 80 μL with deionized water and react at 16°C for 12 hours. This yields a circular DNA template without the A2 aptamer.
[0165] Example 7
[0166] A method for preparing bacterial outer membrane vesicles (OMV) includes the following steps:
[0167] E. coli BL21 competent cells were seeded into 150 mL of sterile LB medium and cultured at 37°C for 8 h. The OD600 value was measured using a spectrophotometer, and the culture was stopped when the value was 1.
[0168] b. Centrifuge the bacterial culture at 6000 ×g at 4℃ for 10 minutes to obtain a clear yellow liquid and bacterial cells. Discard the bacterial cells, and pass the supernatant through a 0.45 μm filter membrane to obtain the first filtrate.
[0169] c. The first filtrate was centrifuged at 5000 × g and 4 °C using an ultrafiltration tube (30,000 Mw) for 3 minutes. The collected supernatant was filtered through a 0.22 μm filter membrane to obtain the second filtrate.
[0170] d. The second filtrate was centrifuged at 120,000 × g at 4°C for 2 hours, and a white precipitate was obtained at the bottom of the centrifuge tube. The supernatant was carefully discarded, and the white precipitate was resuspended in PBS to obtain the OMV solution.
[0171] Example 8
[0172] A method for preparing engineered bacterial outer membrane vesicles includes the following steps:
[0173] a. Using a pipette, pipette 35 μL of deionized water, 20 μL of DNA circular template (prepared in Example 2), and 10 μL of 10×NH4Cl buffer into a 1.5 mL centrifuge tube and mix them thoroughly.
[0174] b. Add 20 μg OMV (prepared in Example 7), mix well, and incubate at 37°C and 450 rpm for 20 minutes.
[0175] c. Next, add 8 μL of 1.25 mM CaCl2 and 10 μL of dNTPs solution to the reaction system from step b as the reaction substrate.
[0176] d. After mixing, pipette 2 μL of phi 29 DNA polymerase into the above reaction system, mix gently, and continue the reaction at 37℃ and 450 rpm for 2 hours to finally obtain engineered OMV containing A2 aptamer, denoted as OMV@Apt.
[0177] Example 9
[0178] A method for preparing engineered bacterial outer membrane vesicles includes the following steps:
[0179] a. Using a pipette, pipette 35 μL of deionized water, 20 μL of DNA circular template (prepared in Example 5), and 10 μL of 10×NH4Cl buffer into a centrifuge tube and mix them thoroughly.
[0180] b. Add 20 μg OMV (prepared in Example 7), mix well, and incubate at 37°C and 450 rpm for 20 minutes.
[0181] c. Next, add 8 μL of 1.25 mM CaCl2 and 10 μL of dNTPs solution to the reaction system from step b as the reaction substrate.
[0182] d. After mixing, pipette 2 μL of phi 29 DNA polymerase into the above reaction system, mix gently, and continue the reaction at 37℃ and 450 rpm for 2 hours to finally obtain engineered OMV without A2 aptamer, denoted as OMV@NC.
[0183] Example 10
[0184] The morphological characterization of OMV@Apt includes the following steps:
[0185] a. Take an appropriate amount of the product after the rolling circle amplification reaction, centrifuge at 12,000 rpm for 10 minutes, discard the supernatant, and collect the white precipitate at the bottom of the tube.
[0186] b. Add 100 μL of PBS to the precipitate and resuspend it thoroughly by repeated blowing and aspiration.
[0187] c. Repeat the centrifugation steps described above once to further remove any residual reaction reagents. After carefully discarding the supernatant again, add 20 μL of 1% ammonia solution to the precipitate and resuspend the precipitate in a homogeneous OMV@Apt solution.
[0188] d. Place the resuspended sample in a 4°C water bath and sonicate for 30 minutes.
[0189] e. Use a pipette to draw 20 μL of the OMV@Apt solution obtained in the above steps and slowly and evenly drop it onto the surface of the copper grid.
[0190] f. Place the petri dish in a fume hood and let it stand at room temperature for 24 hours to allow the moisture in the sample to evaporate completely naturally.
[0191] g. After the sample is completely dry, observe the morphology of the sample on the copper grid using a scanning transmission electron microscope under a suitable accelerating voltage, and acquire images.
[0192] The experimental results are shown in Figure 1 The results showed a distinct vesicular structure with a DNA-inorganic complex shell formed on the surface through biomineralization.
[0193] Example 11
[0194] The method for verifying the acid-responsive degradation characteristics of OMV@Apt includes the following steps:
[0195] a. Take an appropriate amount of the product after the rolling circle amplification (RCA) reaction, centrifuge at 12,000 rpm for 10 minutes, discard the supernatant, and collect the white precipitate at the bottom of the tube.
[0196] b. Add 100 μL of PBS to the precipitate and resuspend it thoroughly by repeated pipetting. Repeat centrifugation and washing twice.
[0197] c. After washing, discard the supernatant and resuspend the precipitate in an appropriate amount of citrate-sodium citrate buffer using a pipette. Repeat this operation and bring the volume to a final volume to obtain 1 mL of homogeneous OMV@Apt acidic buffer suspension.
[0198] d. Place 1 mL of the above OMV@Apt suspension in a 37°C incubator for incubation. Take samples at 0, 1, and 2 hours.
[0199] e. Use a dynamic light scattering analyzer to measure the particle size of each sample.
[0200] The experimental results are shown in Figure 2 As the incubation time in an acidic environment increased, the average particle size of OMV@Apt gradually decreased. Under acidic conditions, the DNA-pyrophosphate mineralization layer on the surface of OMV@Apt disintegrated and dissolved, leading to a reduction in its size. This verifies that the engineered OMV constructed in this invention possesses excellent acid-responsive degradation characteristics, providing crucial evidence for its intelligent release of contents from intracellular lysosomes.
[0201] Example 12
[0202] The method for cellular uptake and targeting validation of OMV@Apt includes the following steps:
[0203] a. Macrophage and B16 cell suspensions were co-incubated with Hoechst 33342 nuclear dye for 15 minutes, washed by centrifugation, and resuspended. Cells were then cultured at 1 × 10⁻⁶ cells per well. 8 Cells were seeded at a density of 1000 cells per well plate and incubated at 37°C for 24 hours.
[0204] b. OMV@Apt and control OMV@NC were stained with SYBR Green I at 37℃ and 450 rpm for 20 minutes to ensure a final concentration of 1.0 μg / μL. After centrifugation to remove free dye, the samples were washed twice with PBS, resuspended in culture medium, and then dispersed by sonication to obtain fluorescently labeled OMV@Apt and OMV@NC solutions.
[0205] c. Add the corresponding OMV sample to macrophages and B16 cells respectively, and continue culturing for 24 hours.
[0206] d. Discard the culture medium and wash the cells with PBS.
[0207] The results of observing the cell uptake of fluorescently labeled OMV under a fluorescence microscope are shown in the figure. Figure 3 The experimental results showed that the intensity of green fluorescence increased with the extension of co-incubation time, indicating that the uptake of OMV@Apt / NC by macrophages increased with the extension of uptake time. Under the same uptake time conditions, the intensity of green fluorescence in the OMV@Apt group was higher than that in the OMV@NC group, indicating that the A2 aptamer promotes the uptake of OMV@Apt by macrophages.
[0208] Example 13
[0209] The method for lysosomal colocalization analysis of OMV@Apt in macrophages includes the following steps:
[0210] a. Seed the macrophage suspension into confocal culture dishes, ensuring a cell density of 1 × 10⁸ cells per dish. Incubate the dishes at 37°C for 24 hours to allow the cells to adhere fully.
[0211] b. After cell adhesion, carefully aspirate the culture supernatant. Wash cells twice with PBS. Add 1 mL of OMV@Apt working solution (1.0 μg / μL). Return to the incubator and continue incubation for 4–6 hours to allow sufficient time for cells to take up OMV@Apt.
[0212] c. After the incubation is complete, add 1 mL of lysosomal probe working solution (1:50 dilution), place in a constant temperature incubator and continue incubation for 2 hours to specifically fluorescently label the lysosomes in the cells.
[0213] b. After lysosomal labeling, carefully aspirate the probe working solution. After washing with PBS, add culture medium containing Hoechst 33342 nucleic acid dye, stain in the dark for 15 minutes, and wash again to completely remove unbound nuclear dye.
[0214] e. Add 1 mL of fresh culture medium to each confocal dish and observe immediately under a confocal microscope. See below for results. Figure 4 .
[0215] Experimental results showed that after OMV@Apt was taken up by macrophages, its intracellular localization exhibited obvious temporal changes: from 0 to 2 hours, a small amount of OMV@Apt entered lysosomes; from 2 to 4 hours, the colocalization signal of the two was significantly enhanced, indicating that a large amount of OMV@Apt was enriched in lysosomes; from 4 to 6 hours, the colocalization signal began to weaken; and by 6 to 8 hours, the fluorescence signal was basically separated, indicating that OMV@Apt successfully escaped from lysosomes.
[0216] Example 14
[0217] A method for evaluating the immunostimulatory effect of OMV@Apt includes the following steps:
[0218] a. All standards, capture antibodies, detection antibodies, and horseradish peroxidase (HRP) were diluted using the specified diluent according to the kit instructions. The capture antibody was diluted to the working concentration with PBS, and then 100 μL was added to each well of a 96-well plate. The plate was incubated overnight (24 hours) at 4°C.
[0219] b. After incubation, aspirate the liquid from the wells. Add 250 μL of wash buffer to each well and wash three times. Dilute the blocking buffer to 1× working concentration with deionized water. Add 200 μL to each well and incubate on a shaker at room temperature for 1 hour.
[0220] c. Discard the blocking buffer and wash each well once with 250 μL of wash buffer. Plot the standard curve: Add 200 μL of the highest concentration of standard to the first row of wells. For the following seven rows of wells, add 100 μL of wash buffer to each well, then serially dilute each well with 100 μL of standard from the first row to create a concentration gradient.
[0221] d. Sample loading: Add 100 μL of the sample to be tested, appropriately diluted with Diluent A, to the remaining wells. After loading, place the plate on a shaker and incubate at room temperature for 2 hours.
[0222] e. After incubation, aspirate the liquid and wash three times with wash buffer. Add 100 μL of the detection antibody working solution diluted according to the instructions to each well. Place the plate on a shaker and incubate at room temperature in the dark for 1 hour.
[0223] f. After incubation, aspirate the liquid and wash three times with washing buffer. Add 100 μL of HRP working solution diluted according to the instructions to each well. Place the plate on a shaker and incubate at room temperature in the dark for 30 minutes. Under dark conditions, add 100 μL of TMB chromogenic substrate solution to each well. Place the plate on a shaker and incubate at room temperature in the dark for 15 minutes.
[0224] g. Using a microplate reader, measure the absorbance of each well at 450 nm, and calibrate using 570 nm as a reference wavelength. Plot a standard curve based on the concentrations of the standards and their corresponding absorbance values, and use this curve to calculate the specific concentrations of cytokines in each sample. Immediately after incubation, add 100 μL of 1 mmol / L sulfuric acid solution to each well to terminate the reaction. Detect the absorbance at wavelengths of 450–570 nm using a microplate reader.
[0225] See results Figure 5 The experimental results showed that OMV@Apt stimulation increased the secretion level of inflammatory cytokines in macrophages. Their expression levels were significantly higher than those in the OMV@NC group, demonstrating that the A2 aptamer promotes macrophage polarization towards the M1 phenotype by enhancing macrophage uptake; and there was no significant difference compared to the OMV group, indicating that the engineered modification did not impair its original immune activation function.
[0226] Example 15
[0227] OMV@Apt is used to evaluate the efficacy of melanoma immunotherapy, including the following steps:
[0228] a. Five-week-old female mice (C57 / BL6) were randomly divided into four groups: PBS group, OMV group, OMV@NC group, and OMV@Apt group, with eight mice in each group. The PBS group served as a negative control, the OMV group as a positive control, the OMV@NC group as a control group, and the OMV@Apt group as an experimental group.
[0229]
[0230] b. Intratumoral injection was chosen, administered on days 0, 3, 6, 9, and 12, ensuring a concentration of 100 μg OMV protein per dose; the tumor was sacrificed on day 14. Tumor tissue was collected and measured, and the results are shown below. Figure 6 .
[0231] The experimental results showed that, compared with the PBS group, some tumors were cured in the OMV group and the OMV@Apt group, and the tumor volume in the OMV@Apt group was smaller than that in the OMV@NC group, demonstrating excellent tumor suppression effect.
[0232] Example 16
[0233] A method for evaluating the immunostimulatory effects of OMV@Apt in vivo includes the following steps:
[0234] a. Tumor tissue was dissected from mice, accurately weighed, and a small piece (approximately 50–100 mg) was randomly cut off. The tissue piece was placed in 1 mL of 1 mg / mL collagenase IV solution and thoroughly minced using sterile surgical scissors or a mechanical grinder. The mixture was placed in a constant-temperature shaker and digested at 160 rpm for 1 hour. After digestion, the cell suspension was filtered through a 70 μm cell sieve to remove undigested tissue pieces. The filtrate was collected, centrifuged at 3000 rpm for 5 minutes, and the supernatant was discarded.
[0235] b. Resuspend the cell pellet in 100 μL PBS to obtain a single-cell suspension. Add 0.5 μL of blocking protein antibody to the suspension and incubate at 4°C for 20 minutes to block non-specific binding. Then, add the fluorescent antibody targeting the phenotype directly, mix gently, and incubate at 4°C in the dark for 30 minutes. After incubation, add 500 μL PBS, mix well, centrifuge at 3000 rpm for 5 minutes, and discard the supernatant to wash away unbound antibody.
[0236] c. Since the CD206 protein is located inside macrophages, staining with staining antibodies requires prior membrane disruption. Resuspend the cell suspension in 100 μL PBS, add 100 μL of cell membrane permeability enhancer, mix well, and disrupt the membrane at room temperature for 15 min. After disruption, add 500 μL of Wash Buffer, mix well, and centrifuge at 3000 rpm for 5 min, discarding the supernatant. To further remove residual permeability enhancer, add 500 μL of Wash Buffer, incubate at room temperature for 10 min, then centrifuge again and discard the supernatant. Resuspend the cell pellet in 100 μL PBS to complete membrane disruption. After membrane disruption, proceed with the above staining steps.
[0237] d. Data were collected and analyzed using flow cytometry; results are shown in [see table below]. Figure 7 .
[0238] Experimental results showed that after stimulation with OMV@Apt, the expression levels of surface markers CD80 and CD86 on M1 macrophages were significantly upregulated, while the expression level of CD206, a marker on M2 macrophages, was significantly downregulated. This demonstrates that OMV@Apt can efficiently induce macrophage polarization towards the anti-tumor M1 phenotype.
[0239] Example 17
[0240] The in vivo antitumor and immune activation effects of OMV@Apt were evaluated, including the following steps:
[0241] a. Five-week-old female mice (C57 / BL6) were randomly divided into three groups: PBS group, OMV group, and OMV@Apt group, with eight mice in each group. The PBS group served as a negative control, and the OMV group served as a positive control.
[0242]
[0243] b. On day 0, tumor cells were injected into the root of the mouse's right leg for the first time, and this was recorded as a primary tumor. On day 3, tumor cells were injected into the root of the mouse's left leg for the second time, and the number of cells was halved, and this was recorded as a distal tumor.
[0244] c. Oral administration was chosen, with drugs administered on days 0, 3, 6, 9, and 12, ensuring a concentration of 100 μg OMV protein per dose. Only the primary tumor was treated; mice were sacrificed on day 14. Tumor tissue from both sides was collected and measured, as shown in the following figures. Figure 8 .
[0245] Experimental results showed that the PBS group had the largest tumor volume, while the OMV@Apt group had the smallest tumor volume among primary tumors, demonstrating that OMV@Apt has a good anti-tumor effect. In distal tumors, tumor growth was significantly inhibited in both the OMV and OMV@Apt groups, and their tumor volume was significantly smaller than that in the PBS group. This proves that OMV@Apt, like natural OMV, can effectively activate the body's systemic anti-tumor immune response.
[0246] In summary, this invention differs from existing techniques that employ genetic engineering attenuation or polymeric material coating. It is the first to utilize rolling circle amplification (RoBA) technology, using circular DNA anchored to the surface of macrophages as a template, to synthesize a DNA-pyrophosphate mineralization layer in situ on the OMV surface, forming an organic-inorganic hybrid intelligent coating. This method fully leverages the editability of DNA sequences, designing templates containing A2 aptamers to enable the constructed mineralized outer layer to precisely target the CD14 protein on the macrophage surface, thereby driving macrophages to polarize towards the M1 phenotype. This achieves highly efficient tumor immunotherapy while possessing significant advantages such as simplicity, high efficiency, and high biocompatibility.
[0247] It will be apparent to those skilled in the art that this disclosure is not limited to the details of the exemplary embodiments described above, and that this disclosure can be implemented in other specific forms without departing from the spirit or essential characteristics of this disclosure. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of this disclosure is defined by the appended claims rather than the foregoing description. Thus, it is intended that all variations falling within the meaning and scope of equivalents of the claims be included within this disclosure.
[0248] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.
Claims
1. An engineered bacterial outer membrane vesicle, characterized in that, The engineered bacterial outer membrane vesicles include bacterial outer membrane vesicles and a DNA-pyrophosphate mineralization layer covering the surface of the bacterial outer membrane vesicles; The DNA in the DNA-pyrophosphate mineralization layer contains the A2 aptamer.
2. The engineered bacterial outer membrane vesicles according to claim 1, characterized in that, The A2 aptamer sequence is shown in SEQ ID NO.
4.
3. The engineered bacterial outer membrane vesicles according to claim 1, characterized in that, The pyrophosphate in the DNA-pyrophosphate mineralization layer is calcium pyrophosphate.
4. A method for preparing engineered bacterial outer membrane vesicles as described in claim 1, characterized in that, The preparation method includes the following steps: Mix deionized water, circular DNA template containing A2 aptamers, and buffer solution to obtain a mixture; Add bacterial outer membrane vesicles to the mixture, mix well, and incubate. After incubation, add calcium chloride solution and mix well; The mixture with added calcium chloride solution was subjected to rolling ring amplification reaction; After the rolling circle amplification reaction was completed, the product was purified by centrifugation to obtain engineered bacterial outer membrane vesicles.
5. The method for preparing engineered bacterial outer membrane vesicles according to claim 4, characterized in that, The preparation of the circular DNA template containing the A2 aptamer is as follows: Design and synthesize ssDNA-1 modified with 5' end phosphorylation, wherein the ssDNA-1 contains an A2 aptamer antisense sequence; Design primers for ssDNA-1 containing the GN6 aptamer, wherein the 5' and 3' ends of ssDNA-1 are complementary to the 3' and 5' ends of the primers, respectively. Mix ssDNA-1 and primers, add NaCl, and use sterile water to bring the volume to a suitable level. Then, use a heating annealing process to synthesize circular DNA-1 with a notch at the end. Circular DNA-1, T4 DNA ligase, and buffer were mixed and reacted at 4℃-16℃ for 6-12 hours to obtain a circular DNA template containing the A2 aptamer.
6. The method for preparing engineered bacterial outer membrane vesicles according to claim 5, characterized in that, The molar ratio of ssDNA-1 to primers is 1:1 to 1:
2. Add NaCl to a final concentration of 60 mmol / L to 80 mmol / L, and bring the volume to 20 μL with sterile water.
7. The method for preparing engineered bacterial outer membrane vesicles according to claim 5, characterized in that, The heating and annealing process is as follows: Step 1: Hold at 95℃ for 2 minutes; Step 2, maintain at 65℃ for 2 minutes; Step 3, maintain at 60℃ for 5 minutes and 30 seconds; Step 4: Hold at 20℃ for 30 seconds; Step 5, store at 10℃; In steps 3 and 4, the temperature decreases by 0.5°C every 30 seconds, and the cycle is repeated 80 times.
8. The method for preparing engineered bacterial outer membrane vesicles according to claim 4, characterized in that, The incubation conditions for adding bacterial outer membrane vesicles to the mixture are: temperature 35℃-37℃, time 20min-40min.
9. The method for preparing engineered bacterial outer membrane vesicles according to claim 4, characterized in that, The rolling circle amplification reaction is performed as follows: dNTPs and phi 29 DNA polymerase are added to the mixture, mixed well, and incubated at 35℃-37℃ for 2h-4h.
10. The application of the engineered bacterial outer membrane vesicles as described in claim 1 in immunomodulation and antitumor therapy.