An electrochemiluminescence sensor based on quantum dot-DNA nanostructures and its detection of Cd 2+ application
By constructing an electrochemiluminescent aptamer sensor based on quantum dot-DNA nanostructures and hybridization chain reactions, the problem of insufficient sensitivity in cadmium ion detection has been solved, achieving high sensitivity and rapid detection, which is suitable for environmental monitoring and clinical diagnosis.
Patent Information
- Application Number
- CN202311010141.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-11
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2043-08-11
AI Technical Summary
Existing methods for detecting cadmium ions (Cd2+) lack sufficient sensitivity, making it difficult to achieve efficient and rapid environmental monitoring and clinical diagnosis, especially in the detection of heavy metal ions where effective means are lacking.
An electrochemiluminescence aptamer sensor based on quantum dot-DNA nanostructures and hybridization chain reaction was constructed. By binding biotin-avidin and Cd2+ specific aptamers, the signal was amplified using quantum dot-DNA nanostructures to achieve high-sensitivity detection.
It achieves ultrasensitive detection of cadmium ions, with rapid detection capabilities, low detection limits, and wide dynamic range, making it suitable for environmental monitoring and clinical diagnosis.
Smart Images

Figure CN117074492B_ABST
Abstract
Description
Technical fields:
[0001] This invention relates to a novel electrochemiluminescence aptamer sensor based on quantum dot-DNA nanostructure amplification; and a method for fabricating the sensor and its ability to detect Cd. 2+ Analysis applications. Background technology:
[0002] Cadmium ions are a highly toxic heavy metal widely used in military and metallurgical industries, causing irreversible environmental pollution and bioaccumulation in the food chain. This, in turn, can severely damage the human kidneys, bones, and cardiovascular system, and may even lead to cancer and developmental problems [Huang, P.; Li, S.; Gao, N. Sci. Technol. 2013, 7313]. Currently, the detection of Cd in the environment... 2+ Methods for determining concentration include spectrophotometry, electrochemical methods, and atomic absorption spectrometry. Electrochemiluminescence (ECL) combines the advantages of electrochemistry and spectroscopy. ECL features fast analysis speed, low detection limits, and a wide dynamic range, making it a popular technology in clinical diagnostics, environmental monitoring, and video security applications. In particular, ECL is effective in detecting heavy metal ions (such as Pb) in environmental samples. 2+ It has shown great promise in this area [Zhao, Y.; Zhang, Y, Q.; Jie, G, F. Sensor. Actuat B: Chem., 2021, 326, 128985].
[0003] This study constructed an ECL aptamer sensor based on quantum dot-DNA nanostructures and hybridization chain reaction (HCR), and applied it to Cd. 2+ Ultra-sensitive detection.
[0004] The purpose of this invention is to construct quantum dot-DNA nanostructures to amplify signals through a hybridization chain reaction, and further utilize biotin-avidin and Cd... 2+ To detect Cd, an electrochemiluminescence aptamer sensor was developed based on the specific binding of the aptamer. 2+ .
[0005] Specifically, the following steps are included:
[0006] Step 1. Hybridization chain reaction: First, thoroughly mix 50 μL of biotin-modified 10 μM H1 and H2 of equal concentration in a TE buffer. Then, place the mixture in a 95°C water bath and anneal for 5 min. Subsequently, slowly cool to 37°C and maintain at 37°C for 30 min to form the desired [H1 + H2]. n Tandem hybridization sequence.
[0007] H1: ATAAAAACCAACACGTCAACTGCACAACCAAAAATA-Biotin
[0008] H2: TGACGTGTGGTTTTTATTATTTTTGGTTGTGCAGT-Biotin
[0009] Step 2. Synthesis of CdS QDs: First, 250 μL of mercaptopropionic acid and 50 mL of 0.01 M CdCl2 were added to a three-necked flask, and N2 was bubbled through for 35 min to remove oxygen. Then, 1.0 M NaOH was slowly added to adjust the pH of the solution to 11, and 5.0 mL of 0.1 M Na2S was quickly added to the above solution. The mixture was heated to boiling and refluxed for at least 4 h. The successfully prepared CdS QDs were stored at 4 °C in the dark. Before use, centrifugation purification was required. Specifically, CdS QDs were mixed with an equal volume of ethanol, centrifuged at high speed, and the supernatant was removed. The resulting precipitate was dissolved in an equal volume of deionized water for later use.
[0010] Step 3. Preparation of the CdS QDs-SA complex: 100 μL of purified CdS QDs were added to 10 μL of 0.1 M EDC and 10 μL of 0.025 M NHS, and reacted at 37 °C for 1 h to activate the carboxyl groups. Then, 20 μL of amino-containing 1 mg / mL streptavidin SA was added, and the mixture was ligated at 37 °C for 6 h to prepare the CdS QDs-SA complex. The precipitate obtained by centrifugation was redispersed in 50 μL of ultrapure water.
[0011] Step 4. Electrodeposition of AuNPs on the glassy carbon electrode (GCE): First, the polished electrode was thoroughly cleaned with ethanol and ultrapure water, respectively. Cyclic voltammetry (CV) scans were performed using 5.0 mM K3[Fe(CN)6] and 1.0 M KCl solutions. A redox peak separation difference (ΔEp) of less than 90 mV indicated that the electrode pretreatment was complete. The electrode was rinsed again with ultrapure water and dried with N2, ready for Au NP deposition. Deposition was performed for 30 s in a 10 mg / mL HAuCl4 solution at a stable voltage of 0.2 V to obtain the AuNP-modified electrode.
[0012] Step 5. Sensor Construction: First, 8 μL of 5 μM amino-modified cpDNA was dropped onto the electrodeposited AuNPs on the GCE and incubated overnight. Ligation was then performed via a gold-nitrogen bond, followed by blocking with 1 mM mercaptohexanol (MCH) for 2 hours. Next, 8 μL of 5 μM Cd... 2+The aptamer DNA was ligated and incubated for 2 hours, followed by the addition of 8 μL of HCR product modified with a high concentration of biotin and incubation for 2 hours. Then, 8 μL of the prepared CdS QDs-SA complex was incubated on the electrode for 1 hour. Finally, the constructed biosensor was immersed in 30 μL of CdS at different concentrations. 2+ The sample was incubated in the solution for 45 minutes, and the ECL signal response induced by the target was measured.
[0013] cpDNA: ATACCACAACAGTTTTT-NH2
[0014] Cd 2+ Aptamer DNA:ACTGTTGTGGTATTATTTTTGGTTGTGCAGT
[0015] ECL signal measurements were performed in a three-electrode system containing phosphate buffer solutions of K2S2O8 (0.05M) and KCl (0.1M), using an MPI-E analyzer with a voltage setting range of 0 to -1.5V, a scan rate of 100mV / s, and a photomultiplier tube (PMT) of 800V. Attached image description:
[0016] Figure 1 Electrochemiluminescence sensor based on quantum dot-DNA nanostructures for the detection of Cd 2+ Schematic diagram.
[0017] Figure 2 TEM image of CdS QDs (A), HRTEM image of CdS QDs (B), size distribution map of CdS QDs (C), and fluorescence spectrum of CdS QDs (D).
[0018] Figure 3 (a) UV-Vis absorption spectra of SA, (b) CdS QDs-SA, and (c) CdS QDs.
[0019] Figure 4 Analysis of polyacrylamide gel electrophoresis (PAGE): (m) scale bar, (a) cpDNA, (b) Cd 2+ aptamer DNA, (c)H1, (d)H2, (e)Cd 2+ aptamer DNA and cpDNA complex, (f) HCR product, (g) cpDNA, Cd 2+ Hybrids of aptamer DNA and HCR.
[0020] Figure 5 (A)CdS QDs / HCR / Cd 2+ Aptamer DNA / cpDNA / AuNPs and (B)Cd 2+ / CdS QDs / HCR / Cd 2+ SEM image of the sensing interface of Aptamer DNA / cpDNA / AuNPs.
[0021] Figure 6 In 0.1M PBS containing 5mM [Fe(CN)6], GCE(a), AuNPs / GCE(b), HCR / Cd 2+ AptamerDNA / cpDNA / AuNPs / GCE(c),CdS QDs / HCR / Cd 2+ Aptamer DNA / cpDNA / AuNPs / GCE(d),Cd 2+ / CdSQDs / HCR / Cd 2+ CV(A) and EIS(B) curves for Aptamer DNA / cpDNA / AuNPs / GCE(e). The corresponding circuitry for Faraday electrochemical impedance spectroscopy is shown in the inset.
[0022] Figure 7 (A) Sensor for different concentrations of Cd 2+ (B) Measurement of Cd ECL signal 2+ Standard curve (10 fg / mL) -1 -10ng mL -1 (PMT = 800V). Detailed implementation method:
[0023] Example 1. Detection of Cd by an electrochemiluminescence sensor based on quantum dot-DNA nanostructures 2+
[0024] First, 8 μL of 5 μM amino-modified cpDNA was drop-cast onto electrodeposited AuNPs-modified GCE and incubated overnight. Ligation was then performed via a gold-nitrogen bond, followed by blocking with 1 mM mercaptohexanol (MCH) for 2 h. Next, 8 μL of 5 μM Cd... 2+ The aptamer DNA was ligated and incubated for 2 hours. Then, 8 μL of HCR product modified with a high concentration of biotin was added and incubated for 2 hours. Next, 8 μL of the previously prepared CdS QDs-SA complex was incubated on an electrode for 1 hour to construct an "on" signal biosensor. Finally, the constructed biosensor was immersed in 30 μL of CdS solution of different concentrations. 2+ The sample was incubated in the solution for 45 minutes, and the ECL signal response induced by the target was measured.
[0025] ECL signal measurements were performed in a three-electrode system containing phosphate buffer solutions of K2S2O8 (0.05M) and KCl (0.1M), which included a voltage setting range of 0 to -1.5V, a scan rate of 100mV / s, and an 800V photomultiplier tube (PMT) voltage range for the MPI-E analyzer.
[0026] Example 2. Detection of Cd by an electrochemiluminescence sensor based on quantum dot-DNA nanostructures 2+
[0027] First, 8 μL of 5 μM amino-modified cpDNA was drop-cast onto electrodeposited AuNPs-modified GCE and incubated overnight. Ligation was then performed via a gold-nitrogen bond, followed by blocking with 1 mM mercaptohexanol (MCH) for 2 h. Next, 8 μL of 5 μM Cd... 2+ The aptamer DNA was ligated and incubated for 2 hours. Then, 8 μL of HCR product modified with a high concentration of biotin was added and incubated for 2 hours. Next, 8 μL of the previously prepared CdS QDs-SA complex was incubated on an electrode for 1 hour to construct an "on" signal biosensor. Finally, the constructed biosensor was immersed in 30 μL of CdS solution of different concentrations. 2+ The sample was incubated in the solution for 45 minutes, and the ECL signal response induced by the target was measured.
[0028] ECL signal measurements were performed in a three-electrode system containing phosphate buffer solutions of K2S2O8 (0.05M) and KCl (0.1M), which included a voltage setting range of 0 to -1.5V, a scan rate of 100mV / s, and an 800V photomultiplier tube (PMT) voltage range for the MPI-E analyzer.
[0029] Example 3. Detection of Cd by an electrochemiluminescence sensor based on quantum dot-DNA nanostructures 2+
[0030] First, 8 μL of 5 μM amino-modified cpDNA was drop-cast onto electrodeposited AuNPs-modified GCE and incubated overnight. Ligation was then performed via a gold-nitrogen bond, followed by blocking with 1 mM mercaptohexanol (MCH) for 3 h. Next, 8 μL of 5 μM Cd... 2+ The aptamer DNA was ligated and incubated for 2 hours. Then, 8 μL of HCR product modified with a high concentration of biotin was added and incubated for 3 hours. Next, 8 μL of the previously prepared CdS QDs-SA complex was incubated on an electrode for 1 hour to construct an "on" signal biosensor. Finally, the constructed biosensor was immersed in 30 μL of CdS at different concentrations. 2+ The sample was incubated in the solution for 45 minutes, and the ECL signal response induced by the target was measured.
[0031] ECL signal measurements were performed in a three-electrode system containing phosphate buffer solutions of K2S2O8 (0.05M) and KCl (0.1M), which included a voltage setting range of 0 to -1.5V, a scan rate of 100mV / s, and an 800V photomultiplier tube (PMT) voltage range for the MPI-E analyzer.
[0032] Example 4. Detection of Cd by an electrochemiluminescence sensor based on quantum dot-DNA nanostructures 2+
[0033] First, 8 μL of 5 μM amino-modified cpDNA was drop-cast onto electrodeposited AuNPs-modified GCE and incubated overnight. Ligation was then performed via a gold-nitrogen bond, followed by blocking with 1 mM mercaptohexanol (MCH) for 2 h. Next, 8 μL of 5 μM Cd... 2+ The aptamer DNA was ligated and incubated for 2 hours. Then, 8 μL of HCR product modified with a high concentration of biotin was added and incubated for 2 hours. Next, 8 μL of the previously prepared CdS QDs-SA complex was incubated on an electrode for 1 hour to construct an "on" signal biosensor. Finally, the constructed biosensor was immersed in 30 μL of CdS solution of different concentrations. 2+ The sample was incubated in the solution for 1 hour, and the ECL signal response induced by the target was measured.
[0034] ECL signal measurements were performed in a three-electrode system containing phosphate buffer solutions of K2S2O8 (0.05M) and KCl (0.1M), which included a voltage setting range of 0 to -1.5V, a scan rate of 100mV / s, and an 800V photomultiplier tube (PMT) voltage range for the MPI-E analyzer.
Claims
1. A quantum dot-DNA nanostructure-based approach for Cd 2+ The electrochemiluminescence sensor for detection; the sensor is synthesized through the following steps: Step 1. Synthesis of CdS QDs: First, 250 μL of mercaptopropionic acid and 50 mL of 0.01 M CdCl2 were added to a three-necked flask, and N2 was bubbled through for 35 min to remove oxygen. Then, 1.0 M NaOH was slowly added to adjust the pH of the solution to 11, and 5.0 mL of 0.1 M Na2S was quickly added to the above solution. The mixture was heated to boiling and refluxed for at least 4 h. The successfully prepared CdS QDs were stored at 4 ℃ in the dark. Before use, they needed to be purified by centrifugation. Specifically, CdS QDs were mixed with an equal volume of ethanol and centrifuged at high speed to remove the supernatant. The resulting precipitate was dissolved in an equal volume of deionized water for later use. Step 2. Preparation of CdS QDs-SA complex: 100 μL of purified CdS QDs were added to 10 μL of 0.1 M EDC and 10 μL of 0.025 M NHS and reacted at 37 °C for 1 h to activate the carboxyl groups; then 20 μL of amino-containing 1 mg / mL streptavidin SA was added and reacted at 37 °C for 6 h to prepare the CdS QDs-SA complex; the precipitate obtained by centrifugation was redispersed in 50 μL of ultrapure water. Step 3. Hybridization chain reaction: First, thoroughly mix 50 μL of biotin-modified 10 μM H1 and H2 of equal concentration in a TE buffer. Then, place the mixture in a 95 °C water bath and anneal for 5 min. Subsequently, slowly cool to 37 °C and maintain at 37 °C for 30 min to form the desired [H1 + H2]. n Tandem hybridization sequence; Step 4. Electrodeposition of Au NPs on the glassy carbon electrode GCE surface: First, the polished electrode was thoroughly cleaned with ethanol and ultrapure water, respectively. Cyclic voltammetry was performed using 5.0 mM K3[Fe(CN)6] and 1.0 M KCl solutions. When the separation difference between the redox peaks was less than 90 mV, it indicated that the electrode pretreatment was complete. The electrode was rinsed again with ultrapure water and dried with N2. At a stable voltage of 0.2 V, deposition was performed in 10 mg / mL HAuCl4 solution for 30 s to obtain the AuNP-modified electrode. Step 5. Sensor Construction: First, 8 μL of 5 μM amino-modified capture DNA (cpDNA) was dropped onto the electrodeposited AuNPs on the GCE and incubated overnight. Ligation was then performed via a gold-nitrogen bond, followed by blocking with 1 mM mercaptohexanol (MCH) for 2 hours. Next, 8 μL of 5 μM Cd... 2+ The aptamer DNA was added and reacted for 2 h, followed by the addition of 8 μL of HCR product modified with a high concentration of biotin and incubated for 2 h; then, 8 μL of the prepared CdS QDs-SA complex was incubated on the electrode for 1 h to construct the biosensor; finally, the constructed biosensor was inserted into 30 μL of CdS at different concentrations. 2+ The sample was incubated in the solution for 45 min, and the ECL signal response induced by the target was measured. ECL signal measurements were performed in a three-electrode system containing 0.05 M K2S2O8 and 0.1 M KCl phosphate buffer solution using an MPI-E analyzer with a voltage setting range of 0 to -1.5 V, a scan rate of 100 mV / s, and a photomultiplier tube (PMT) of 800 V.