Nucleus pulposus cell separation and culture method
By employing a stepwise enzymatic digestion and specialized culture medium, the efficiency and stability issues in the isolation and culture of nucleus pulposus cells have been resolved. This enables efficient and safe large-scale expansion and long-term maintenance of the biological characteristics of nucleus pulposus cells, providing a stable cell source for the treatment and research of intervertebral disc diseases.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-29
- Publication Date
- 2026-03-31
AI Technical Summary
Existing technologies are difficult to efficiently isolate and culture nucleus pulposus cells, resulting in low cell yield, significant cell damage, and severe dedifferentiation. Furthermore, traditional three-dimensional culture techniques are complex and costly, making it impossible to achieve large-scale expansion and long-term maintenance of the biological characteristics of nucleus pulposus cells.
A stepwise enzymatic digestion method combined with a special culture medium, including NB6 collagenase and a complex enzyme solution, was used for digestion. Tie2+CD90+ nucleus pulposus cells were then obtained by flow cytometry and expanded in Matrigel or type II collagen-coated culture dishes. The cells were cultured in a nucleus pulposus cell expansion medium containing specific factors and microenvironment modifiers.
This method enables efficient isolation and large-scale expansion of nucleus pulposus cells, maintains cell viability and phenotypic stability, avoids dedifferentiation, and provides a safe and controllable cell source, offering stable seed cells for the treatment and research of intervertebral disc diseases.
Smart Images

Figure CN121759397A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of cell culture technology, specifically relating to a method for isolating and culturing nucleus pulposus cells. Background Technology
[0002] Intervertebral disc degeneration is a major cause of lower back and neck pain. The degenerative process is gradual and irreversible, severely impacting patients' quality of life and imposing a heavy socioeconomic burden. The nucleus pulposus, located in the center of the intervertebral disc, with its healthy cell population and abundant extracellular matrix, particularly type II collagen and proteoglycans, is crucial for maintaining the disc's mechanical function and internal environmental stability. Therefore, nucleus pulposus cells, as the core unit for maintaining the physiological function of the intervertebral disc, have become key seed cells for cell therapy and tissue engineering to repair degenerated intervertebral discs.
[0003] Nucleus pulposus cells are typically isolated from nucleus pulposus tissue and obtained through large-scale in vitro culture. However, in vitro research and clinical application of nucleus pulposus cells face several technical bottlenecks, primarily including: In the cell separation process, conventional enzymatic digestion methods typically employ a single collagenase or a simple combination of enzymes. This method often fails to completely dissociate tissue structures, resulting in low cell yields. Furthermore, the harsh digestion conditions damage key functional proteins on the cell membrane surface, affecting subsequent cell adhesion and proliferation. Achieving efficient yet gentle cell separation remains one of the unresolved problems in current technologies.
[0004] During in vitro culture, primary nucleus pulposus cells are highly susceptible to dedifferentiation in traditional monolayer culture systems. This means they rapidly lose their typical chondrocyte-like phenotype during passage, manifested by a significant downregulation of key markers (such as acanthogonal proteoglycans (ACAN) and type II collagen) and an upregulation of fibrosis markers, leading to functional loss. While some existing techniques explore adding specific anti-aging components or growth factor combinations to the culture medium to delay cell senescence or promote specific morphogenesis, these methods cannot systematically prevent the dedifferentiation process and are difficult to maintain the biological characteristics of nucleus pulposus cells during long-term expansion. Some institutions have attempted to construct immortalized nucleus pulposus cell lines by introducing exogenous genes. This method can provide a stable cell source, but genetic modification alters the cells' biological behavior. While suitable for biological research, it introduces potential biosafety issues in pharmaceutical applications, significantly limiting its direct clinical use.
[0005] On the other hand, the development of some three-dimensional culture or organoid construction technologies provides 3D models for mechanism research, but these technologies are highly complex and expensive, and mainly focus on the directed differentiation of stem cells rather than the direct and large-scale expansion of primary nucleus pulposus cells, thus limiting their practicality.
[0006] In summary, there is a need in this field for an innovative technical solution that can systematically integrate efficient isolation and stable culture without the need for genetic modification. Summary of the Invention
[0007] 1. Purpose of the invention The purpose of this invention is to provide a method for isolating and culturing nucleus pulposus cells. First, an optimized and gentle digestion process maximizes the acquisition of highly active primary nucleus pulposus cells. Second, unique culture conditions are provided to support large-scale, long-term passage expansion of cells without inducing senescence or dedifferentiation. Finally, throughout the expansion process, the expression of specific biomarkers and normal biological functions of nucleus pulposus cells are continuously and stably maintained, enabling large-scale in vitro expansion and long-term passage culture. The application of this method is of crucial significance for promoting cell therapy and related biomedical research in intervertebral disc degenerative diseases.
[0008] 2. Technical Solution To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows: In a first aspect, the present invention provides a method for isolating nucleus pulposus cells, the method comprising the following steps: S1, cleaning, cutting, and centrifugation of the nucleus pulposus tissue, specifically includes: Harvest nucleus pulposus tissue, clean it, and cut it into (1-10) mm pieces. 3 Centrifuge at 300-800 g for 3-5 min, discard the supernatant, and enrich the tissue precipitate; S2, digestion and collection of nucleus pulposus cells, specifically includes: The enriched tissue precipitate was initially digested for 1-4 h using an NB6 collagenase solution with a final concentration of 0.1-0.3 PZU. After digestion was stopped, the mixture was filtered through a 70-100 μm filter sieve to obtain the first solid and the first liquid. The first solid was digested with a compound enzyme solution for 30-60 min, which included trypsin and hyaluronidase. After digestion was stopped, the second liquid was obtained by filtration through a 70-100 μm filter sieve. After combining the second liquid with the first liquid, centrifuge at 300-500 g for 3-5 min, discard the supernatant, and harvest primary nucleus pulposus cells; or combine the cells obtained by centrifuging the first liquid and the second liquid separately at 300-500 g for 3-5 min, and harvest primary nucleus pulposus cells.
[0009] Furthermore, the above-mentioned NB6 collagenase solution was diluted with physiological saline.
[0010] Furthermore, the final concentration of the above NB6 collagenase solution is 0.2 PZU.
[0011] Furthermore, the conditions for the preliminary digestion were: 37°C, shaker, and digestion for 3 hours.
[0012] Furthermore, the above-mentioned cessation of digestion includes: adding 5%-15% by volume of FBS or hPL in DMEM / F12 medium to the digestion solution to stop digestion.
[0013] Furthermore, the above-mentioned cessation of digestion includes: adding DMEM / F12 medium with 10% FBS by volume to the digestion solution to stop digestion.
[0014] Furthermore, the aforementioned filter screen is a 70 μm filter screen.
[0015] Furthermore, the digestion conditions for the above-mentioned complex enzyme solution are: 37°C, shaker, digestion for 30 min.
[0016] Furthermore, the mass ratio of trypsin to hyaluronidase in the above-mentioned compound enzyme solution is (1.25-0.25):0.15.
[0017] Furthermore, the concentration of hyaluronidase in the above-mentioned compound enzyme solution is 0.025%-0.075% (w / v).
[0018] Furthermore, the above-mentioned method for isolating nucleus pulposus cells also includes: performing flow cytometry sorting on primary nucleus pulposus cells to obtain Tie2 cells. + CD90 + Nucleus pulposus cells.
[0019] Furthermore, the above-mentioned flow cytometry sorting includes using flow cytometry antibodies to perform antibody staining, labeling the surface markers Tie2 and CD90 positive cell subsets of nucleus pulposus cells, performing flow cytometry sorting to obtain nucleus pulposus cells for subsequent culture.
[0020] Secondly, the present invention provides a method for culturing nucleus pulposus cells, the method comprising: In a matrix-coated culture dish, the isolated nucleus pulposus cells were seeded into nucleus pulposus cell expansion medium for expansion culture. Once the cells reached an adherent state and a confluence of 80%-95%, they were passaged. The substrate-coated culture vessels are: Culture vessels coated with Matrigel and type II collagen, or culture vessels coated with Matrigel, type II collagen and fibronectin; as a further explanation of this application, culture vessels coated with Matrigel, type II collagen and fibronectin are culture vessels that are difficult to adhere to, such as glass. The nucleus pulposus cell expansion culture medium includes the following components: A basal medium consisting of a mixture of DMEM high-glucose basal medium, Ham's F12 basal medium, and IMDM combined medium; hPL or serum alternatives (such as KnockOut™); Added factors: bFGF, EGF, Y27632, CHIR99021, PD0325901, noggin, TGF-β, BMP-2; Microenvironment modifiers: GlutaMAX, NEAA, GlutaMAX, NEAA, L-Ascorbic acid 2-phosphate, beta-mercaptoethanol; as a further explanation of this application, the addition of microenvironment modifiers can better meet the nutritional needs of nucleus pulposus cells.
[0021] Furthermore, the preparation method of the above-mentioned substrate-coated culture vessel includes: Freeze the culture dishes at low temperature; cover with a substrate consisting of Matrigel and type II collagen; every 10 cm² 2 Spread with approximately 1 mL of matrix solution, which consists of a Matrigel solution with a final concentration of 50-100 μg / mL and a type II collagen solution with a volume ratio of 1-2 μg / mL (3:1); incubate overnight at 4°C or at least 1-2 hours at 37°C.
[0022] Furthermore, the preparation method of the above-mentioned substrate-coated culture vessel includes: Freeze the culture dish at low temperature; cover with a substrate consisting of Matrigel, type II collagen, and fibronectin; per 10 cm² 2 Spread with approximately 1 mL of matrix solution, which consists of a final concentration of 50-100 μg / mL Matrigel solution, 1-2 μg / mL type II collagen solution, and 0.1-0.5 µg / mL fibronectin solution (volume ratio 7:2:1); incubate overnight at 4°C or at least 1-2 hours at 37°C.
[0023] Furthermore, the above-mentioned nucleus pulposus cell expansion culture medium includes the following components: A basal medium consisting of a mixture of DMEM high-glucose basal medium, Ham's F12 basal medium and IMDM combined medium in a volume ratio of (7-9):(7-9):(1-2); 5%-10% hPL or serum substitutes (such as KnockOut™); Added factors: 5-15 ng / mL bFGF, 2-10 ng / mL EGF, 5 μM Y27632+3-15 μM CHIR99021+0.1-0.5 nM PD0325901, 50-200 ng / mL noggin, 2-10 ng / mL TGF-β, 30-90 ng / mL BMP-2; Microenvironment modifiers: 0.5%-2% GlutaMAX, 0.5%-2% NEAA, 0.5%-2% GlutaMAX, 0.5%-2% NEAA, 1-10 μg / mL L-Ascorbic acid 2-phosphate, 0.05-0.2 mM beta-mercaptoethanol.
[0024] Furthermore, the above-mentioned nucleus pulposus cell expansion culture medium includes the following components: A basal medium consisting of a mixture of DMEM high-glucose basal medium, Ham's F12 basal medium and IMDM combined medium in a volume ratio of 9:9:2. 5% hPL; Added factors: 5 ng / mL bFGF, 5 ng / mL EGF, 5 μM Y27632, 10 μM CHIR99021, 0.2 nMPD0325901, 100 ng / mL noggin, 5 ng / mL TGF-β, 30 ng / mL BMP-2; Microenvironment modifiers: 1% GlutaMAX, 1% NEAA, 1% GlutaMAX, 1% NEAA, 5 μg / mL L-Ascorbic acid 2-phosphate, 0.1 mM beta-mercaptoethanol.
[0025] Thirdly, the present invention provides nucleus pulposus cells obtained by culturing the above-mentioned nucleus pulposus cells, which have immortalization characteristics.
[0026] Fourthly, the present invention provides the application of the above-mentioned nucleus pulposus cells in the preparation of drugs for treating intervertebral disc degenerative diseases or in the construction of spinal disease research models.
[0027] Fifthly, the present invention provides a nucleus pulposus cell expansion culture medium, comprising the following components: A basal medium consisting of a mixture of DMEM high-glucose basal medium, Ham's F12 basal medium, and IMDM combined medium; hPL or serum alternatives (such as KnockOut™); Added factors: bFGF, EGF, Y27632, CHIR99021, PD0325901, noggin, TGF-β, BMP-2; Microenvironment modifiers: GlutaMAX, NEAA, GlutaMAX, NEAA, L-Ascorbic acid 2-phosphate, beta-mercaptoethanol.
[0028] Furthermore, the above-mentioned nucleus pulposus cell expansion culture medium includes the following components: A basal medium consisting of a mixture of DMEM high-glucose basal medium, Ham's F12 basal medium and IMDM combined medium in a volume ratio of (7-9):(7-9):(1-2); 5%-10% hPL or serum substitutes (such as KnockOut™); Added factors: 5-15 ng / mL bFGF, 2-10 ng / mL EGF, 5μM Y27632+3-15μM CHIR99021+0.1-0.5 nM PD0325901, 50-200 ng / mL noggin, 2-10 ng / mL TGF-β, 30-90 ng / mL BMP-2; Microenvironment modifiers: 0.5%-2% GlutaMAX, 0.5%-2% NEAA, 0.5%-2% GlutaMAX, 0.5%-2% NEAA, 1-10 μg / mL L-Ascorbic acid 2-phosphate, 0.05-0.2 mM beta-mercaptoethanol.
[0029] Furthermore, the above-mentioned nucleus pulposus cell expansion culture medium includes the following components: A basal medium consisting of a mixture of DMEM high-glucose basal medium, Ham's F12 basal medium and IMDM combined medium in a volume ratio of 9:9:2. 5% hPL; Added factors: 5 ng / mL bFGF, 5 ng / mL EGF, 5 μM Y27632, 10 μM CHIR99021, 0.2 nMPD0325901, 100 ng / mL noggin, 5 ng / mL TGF-β, 30 ng / mL BMP-2; Microenvironment modifiers: 1% GlutaMAX, 1% NEAA, 1% GlutaMAX, 1% NEAA, 5 μg / mL L-Ascorbic acid 2-phosphate, 0.1 mM beta-mercaptoethanol.
[0030] 3. Technical Effects Compared with the prior art, the advantages of this invention are as follows: (1) The method for isolating and culturing nucleus pulposus cells provided by this invention achieves efficient and highly active primary cell isolation: This invention adopts a stepwise enzyme digestion strategy of "NB6 collagenase first, followed by a complex enzyme," which is optimized for the complex structure of nucleus pulposus tissue. NB6 collagenase can efficiently dissociate the robust collagen fiber network first, creating a large working surface area for the subsequent complex digestion by trypsin and hyaluronidase, which can precisely target and dissociate intercellular connections and components such as hyaluronic acid. This synergistic effect overcomes the defects of low digestion efficiency and large cell damage caused by single enzymes or simple mixed enzymes, thereby significantly improving the quantity and activity of primary nucleus pulposus cells obtained, laying a high-quality cellular foundation for subsequent large-scale expansion.
[0031] (2) The method for isolating and culturing nucleus pulposus cells provided by this invention successfully resolves the contradiction between in vitro expansion and phenotypic maintenance: The biggest breakthrough of this invention is that it achieves long-term, stable passage and large-scale expansion of difficult-to-culture nucleus pulposus cells without introducing any immortalized genes or viral transfection. Healthy initial cells obtained through stepwise digestion, combined with a dedicated culture system, can effectively suppress the "dedifferentiation" phenomenon that inevitably occurs in traditional two-dimensional culture. The cultured cells can sustainably express nucleus pulposus cell-specific markers (such as proteoglycan ACAN and type II collagen COL2A1) and maintain their ability to synthesize functional extracellular matrix, solving the core technical problem of "expansion leading to loss of function" that has long plagued the field.
[0032] (3) The method for isolating and culturing nucleus pulposus cells provided by this invention offers a safe and controllable cell source and technical platform: compared to the potential biosafety risks, ethical controversies, and differences in biological behavior between immortalized cell lines and natural cells, the cell source obtained by this invention is completely natural, without exogenous gene integration, and has higher safety for clinical application. This provides a stable, reliable, and compliant source of seed cells for developing cell therapy products for treating intervertebral disc degenerative diseases. At the same time, this technology can also establish a stable in vitro model for pathological research, drug screening, and toxicity evaluation of spinal-related diseases, and has broad prospects for industrial application. Attached Figure Description
[0033] Figure 1 This is a flowchart of the method for isolating and culturing nucleus pulposus cells.
[0034] Figure 2 It is the result of flow cytometry sorting of primary nucleus pulposus cells.
[0035] Figure 3Images of nucleus pulposus cells cultured in nucleus pulposus cell expansion medium and in conventional DMEM / F12+10%FBS medium.
[0036] Figure 4 The total theoretical cell yield, population doubling time, and PDL curve are calculated for nucleus pulposus cells cultured in nucleus pulposus cell expansion medium and those cultured in conventional DMEM / F12+10%FBS medium.
[0037] Figure 5 This is an image of a section of nucleus pulposus cell cluster cultured in Example 4, stained with Alcian blue.
[0038] Figure 6 This is the result of an ELISA test for the secretion of matrix (COL2A1) in the supernatant.
[0039] Figure 7 Nucleus pulposus cells cultured in DMEM / F12+10% FBS at passages P0 and P8 (NP-FBS) and nucleus pulposus cells cultured in nucleus pulposus cell expansion medium (NP-NPM) were detected by qPCR. COL1A1 , COL2A1 and ACAN Results of gene expression levels.
[0040] Figure 8 These are the flow cytometry results of nucleus pulposus cells cultured in P15 passage nucleus pulposus cell expansion medium.
[0041] Figure 9 A schematic diagram of an anteroposterior X-ray of the lumbar spine taken before modeling experimental animals.
[0042] Figure 10 The results of a section of the caudal vertebrae at D98 in the experimental animal.
[0043] Figure 11 The results of DHI statistics for the caudal vertebrae position in experimental animals at D0, D14, and D98 are presented. Detailed Implementation
[0044] The present invention will be further described below with reference to specific embodiments.
[0045] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains; the term “and / or” as used herein includes any and all combinations of one or more of the associated listed items.
[0046] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0047] As used herein, the term “about” is used to provide for the flexibility and imprecision associated with a given term, measure, or value. Those skilled in the art can readily determine the degree of flexibility for a particular variable. As used herein, the term “at least one of…” is intended to be synonymous with “one or more of…”. For example, “at least one of A, B, and C” explicitly includes only A, only B, only C, and combinations thereof.
[0048] Concentration, amount, and other numerical data may be presented in range format herein. It should be understood that such range format is used solely for convenience and brevity and should be flexibly interpreted to include not only the values explicitly stated as the limits of the range, but also all individual values or subranges encompassed within the range, as if each value and subrange were explicitly stated. For example, a range of values from about 1 to about 4.5 should be interpreted to include not only the explicitly stated limits of 1 to 4.5, but also individual numbers (such as 2, 3, 4) and subranges (such as 1 to 3, 2 to 4, etc.). The same principle applies to ranges that describe only a single value, such as "less than about 4.5," which should be interpreted to include all the values and ranges described above. Furthermore, this interpretation should apply regardless of the breadth of the range or characteristic described.
[0049] Declaration of the nature and legality of the origin of the organization: The nucleus pulposus tissue involved in this study was extracted from the central nucleus pulposus portion of the intervertebral disc. Anatomically, this tissue is an elastic, gelatinous connective tissue, mainly composed of nucleus pulposus cells, a large amount of proteoglycan-like matrix, and a crisscrossing fibrous network. The nucleus pulposus plays a crucial role in buffering pressure, balancing stress, and maintaining spinal biomechanics within the intervertebral disc. The nucleus pulposus tissue involved in this statement originated from intervertebral disc tissue surgically removed for clinical treatment (such as scoliosis correction surgery, discectomy for herniated discs, etc.), and was medical waste generated during the surgical procedure. Before tissue collection, each donor or their legal guardian was fully informed of the purpose of the tissue for scientific research, potential risks, and rights protection measures in strict accordance with prescribed procedures, and signed a written informed consent form. The donor's right to know and right to make their own decisions are fully respected.
[0050] Some of the reagents used in this invention are as follows: DMEM high-glucose basal medium, source culture, L110KJ; Ham's F12 basal medium, source culture, L410KJ; IMDM composite culture medium, Gibco, 12440053; hPL, SEXTON, PL-NH-500; bFGF, nearshore, C046; EGF, nearshore, C029; Y27632, MCE, HY-10071; CHIR99021, MCE, HY-10182; PD0325901, MCE, HY-10254; noggin, MCE, HY-P70785; TGF-β, nearshore, C16X; BMP-2, nearshore, C012; NEAA, Yuanpei, S220JV; GlutaMAX, gibco, 35050061; L-Ascorbic acid 2-phosphate, MCE, HY-103701; beta-mercaptoethanol, Sigma, M6250.
[0051] Example 1 This embodiment provides a method for isolating primary nucleus pulposus cells.
[0052] In this embodiment, primary nucleus pulposus cells are isolated from the nucleus pulposus tissue, and the procedure is as follows: Figure 1 As shown, it specifically includes: (1) Cleaning, cutting and centrifugation of nucleus pulposus tissue Take the nucleus pulposus tissue and soak it in physiological saline to wash away the blood; wash several times depending on the degree of blood contamination, until there is no obvious blood color in the solution. The nucleus pulposus tissue generally does not need to be disinfected with alcohol or other disinfectants. If there are concerns about contamination, (1-2)× antibiotics or gentamicin can be added to the solution to prevent contamination.
[0053] After cleaning, the nucleus pulposus tissue is cut and separated into small pieces or fragments, approximately (1-10) mm in size. 3 Separate the tissues by size as much as possible, transfer the tissue precipitate to a centrifuge tube with physiological saline, centrifuge at 500 g for 5 min, discard the supernatant, enrich the tissue precipitate and remove impurities, and wait for digestion.
[0054] (2) Digest and collect primary nucleus pulposus cells In this embodiment, the digestion process employs a stepwise enzymatic digestion method, namely: First, dilute NB6 collagenase (Nordmark, N0002880) with physiological saline to prepare a collagenase solution with a final concentration of 0.2 PZU. At 37°C and under shaking conditions, collagenase solution was used for initial digestion for 3 h; after digestion, digestion was stopped using DMEM / F12 medium (gibco, 11320033) supplemented with 10% (v / v) FBS (gibco, 10091148); The first solid and the first liquid were obtained by filtration using a 70 μm filter sieve. The first solid mainly consisted of nucleus pulposus fragments or refractory degenerated nucleus pulposus. The first solid was digested at 37°C on a shaker for 30 min using a compound enzyme solution, which consisted of 0.25% (w / v) trypsin (gibco, 25200072) and 0.15% (w / v) hyaluronidase (Sigma, H6254-500MG) in a volume ratio of 5:1. After digestion, the digestion was stopped using DMEM / F12 medium supplemented with 10% (v / v) FBS. The second liquid was obtained by filtration through a 70 μm filter sieve. The second liquid was combined with the first liquid, centrifuged at 400 g for 4 min, the supernatant was discarded, and the primary nucleus pulposus cells were harvested. In this example, the first and second liquids could also be centrifuged separately, and the centrifuged cells could be combined to harvest the primary nucleus pulposus cells.
[0055] Comparative Example 1 This comparative example provides a method for isolating primary nucleus pulposus cells obtained by digestion with a single collagenase.
[0056] In this comparative example, 1.5 mg / mL type II collagenase (MCE, HY-E70005B) was used as the single digestive enzyme, and the isolation method included: (1) Cleaning, cutting and centrifugation of nucleus pulposus tissue Take the nucleus pulposus tissue and soak it in physiological saline to wash away the blood; wash several times depending on the degree of blood contamination, until there is no obvious blood color in the solution. The nucleus pulposus tissue generally does not need to be disinfected with alcohol or other disinfectants. If there are concerns about contamination, (1-2)× antibiotics or gentamicin can be added to the solution to prevent contamination.
[0057] After cleaning, the nucleus pulposus tissue is cut and separated into small pieces or fragments, approximately (1-10) mm in size. 3 Separate the tissues by size as much as possible, transfer the tissue precipitate to a centrifuge tube with physiological saline, centrifuge at 500 g for 5 min, discard the supernatant, enrich the tissue precipitate and remove impurities, and wait for digestion.
[0058] (2) Digest and collect primary nucleus pulposus cells The cells were digested with type II collagenase solution at 37°C on a shaker for 2 h. After digestion, the cells were stopped by adding 10% (v / v) FBS to DMEM / F12 medium. The cells were filtered through a 70 μm filter and centrifuged at 400 g for 4 min. The supernatant was discarded and the primary nucleus pulposus cells were harvested.
[0059] The cell yields of the separation methods in Example 1 and Comparative Example 1 were compared, and the results are shown in Table 1. The results show that the yield of live nucleus pulposus cells of intervertebral disc pathological tissue was higher under the same weight when separated by compound digestive enzymes, which provides a good premise and foundation for subsequent sorting and amplification.
[0060] Table 1
[0061] Example 2 This embodiment provides a method for isolating nucleus pulposus cells for culture.
[0062] In this embodiment, primary nucleus pulposus cells were sorted by flow cytometry to obtain Tie2 cells. + CD90 + Nucleus pulposus cells, used for culture. Specifically including: The primary nucleus pulposus cell pellet collected in Example 1 was resuspended in PBS to a concentration of 1.0E+07 / mL. Flow cytometry was used to stain the nucleus pulposus cells with antibodies (Invitrogen, 14-5987-82; BD Pharmingen, 561971) to label the surface markers Tie2 and CD90-positive cell subsets. The cells were then sorted by flow cytometry to obtain Tie2 cells. + CD90 + Nucleus pulposus cell subsets, used for subsequent culture.
[0063] The results of flow cytometry sorting of primary nucleus pulposus cells are as follows: Figure 2 As shown, Tie2 cells were obtained after primary cell sorting. + CD90 + Nucleus pulposus cells (Pr generation).
[0064] Example 3 This embodiment provides a method for culturing nucleus pulposus cells.
[0065] In this embodiment, the initial cells used for culture are the Tie2 cells prepared in Example 2. + CD90 + Nucleus pulposus cells (Pr generation).
[0066] In this embodiment, the culture vessel used for adherent nucleus pulposus cells is a substrate-coated culture vessel, the preparation method of which includes: freezing the culture vessel at low temperature; coating with a substrate, the substrate including Matrigel and type II collagen; and coating every 10 cm².2 Spread with approximately 1 mL of matrix solution, which consists of a final concentration of 50 μg / mL Matrigel solution and 1 μg / mL type II collagen solution (volume ratio 3:1); incubate overnight at 4°C.
[0067] In this embodiment, the nucleus pulposus cell expansion culture medium for nucleus pulposus cell culture includes the following components: A basal medium consisting of a mixture of DMEM high-glucose basal medium, Ham's F12 basal medium and IMDM combined medium in a volume ratio of 9:9:2. 5% hPL; Added factors: 5 ng / mL bFGF, 5 ng / mL EGF, 5 μM Y27632, 10 μM CHIR99021, 0.2 nMPD0325901, 100 ng / mL noggin, 5 ng / mL TGF-β, 30 ng / mL BMP-2; Microenvironment modifiers: 1% GlutaMAX, 1% NEAA, 1% GlutaMAX, 1% NEAA, 5 μg / mL L-Ascorbic acid 2-phosphate, 0.1 mM beta-mercaptoethanol.
[0068] Nucleus pulposus cell culture methods include: Using the substrate-coated culture dish of this embodiment, Tie2 + CD90 + Nucleus pulposus cells (Pr passage) were seeded in the nucleus pulposus cell expansion medium of this embodiment and expanded at 37°C with 5% CO2. In the nucleus pulposus cell expansion medium, when the cells reached an adherent state and a confluence of 80%-95%, they were passaged, and the passage number was incremented by 1 (Pr passage reaching 80%-95% is P0 passage). When the number of passages is ≥3, culture in a substrate-free culture dish can be used.
[0069] In this embodiment, a substrate-free culture dish was used to culture Tie2. + CD90 + Nucleus pulposus cells (Pr passage) were seeded in DMEM / F12+10% (v / v) FBS medium for expansion, serving as a control.
[0070] During the culture of nucleus pulposus cells, cell morphology was observed and the number of cells harvested and the expansion time were recorded.
[0071] Results analysis: Nucleus pulposus cells cultured in DMEM / F12 + 10% (v / v) FBS medium, such as Figure 3As shown on the left side, nucleus pulposus cells cultured using the culture method of this embodiment are as follows. Figure 3 As shown on the right, nucleus pulposus cells cultured in DMEM / F12+10% (v / v) FBS medium could not maintain a good state and began to show fibrosis at the P6 generation.
[0072] The total theoretical cell yield, population doubling time, and PDL curve for nucleus pulposus cells cultured using DMEM / F12 + 10% (v / v) FBS medium and the culture method described in this example are as follows: Figure 4 As shown, the number of passages and the number of nucleus pulposus cells cultured using DMEM / F12+10% (v / v) FBS medium are far lower than those cultured using the method in this embodiment. Furthermore, the nucleus pulposus cells cultured using the method in this embodiment can be stably passaged for ≥20 generations and maintain the nucleus pulposus cell phenotype, meeting the needs of mass production.
[0073] Example 4 This embodiment provides an assessment of the biological characteristics of the nucleus pulposus cells cultured in Example 3.
[0074] Nucleus pulposus cells cultured to passage P5 in Example 3 were seeded into matrix-coated cell culture plates. Once the growth density reached over 50%, the cells were digested or scraped off using a cell scraper. After centrifugation, the cell pellet was collected and resuspended in nucleocellular expansion medium. The pellet was then seeded into low-adhesion cell culture plates for suspension culture. 3 mL of nucleus pulposus expansion medium was added to promote cell aggregation. After culturing at 37°C and 5% CO2 for 24 h, cell clumps were visibly formed, and the cells spontaneously formed 3D structures. The cells were then transferred to a constant-temperature shaker at 50 rpm / min for continued suspension culture to promote further growth of the suspended cell clumps. The supernatant was collected for ELISA detection, and the function of the nucleus pulposus cell granules was studied by histochemical staining.
[0075] (1) Staining with Alcian blue solution Staining was performed using an Alcian Blue staining kit (Solarbio, G1560), including: Dewaxing to water (paraffin sections only): Immerse the sections in xylene I and xylene II sequentially for 10 minutes each to completely dewax them. Then pass them sequentially through a gradient of 100%, 95%, 80%, and 70% alcohol for 5 minutes each, and finally hydrate them in distilled water.
[0076] Alcian Blue Staining: Immerse the slides in Alcian Blue staining solution (pH 2.5) and stain for 30 minutes at room temperature. Rinsing: Discard the staining solution and gently rinse the slides with running distilled water for 1-2 minutes to remove excess non-specifically adsorbed staining solution. Nuclear Counterstaining: Immerse the slides in nuclear solid red staining solution to counterstain the cell nuclei for 3-5 minutes. Second Rinse and Dehydration: Rinse rapidly with distilled water to remove excess nuclear solid red. Quickly dehydrate the slides sequentially through a gradient of 70%, 80%, 95%, and 100% ethanol, approximately 30 seconds for each level. Clearing and Mounting: Clear the slides twice in xylene, 2 minutes each time. Remove the slides from the xylene, add an appropriate amount of neutral resin, and mount with a coverslip.
[0077] Figure 5 These are images of sections of nucleus pulposus cell clusters cultured in this embodiment, stained with Alcian blue. This demonstrates that the culture method in Example 3 can stably maintain a good state of the nucleus pulposus cells, such as... Figure 5 Even after forming its 3D structure, it can still express ACAN and COL2A1 normally, showing abundant extracellular matrix expression. Sections show ACAN expression and a typical cartilage-like structure.
[0078] (2) Detection of COL2A1 expression level in supernatant The expression level of COL2A1 in the supernatant was detected using the Huamei Biotechnology (CSB-E08087h) ELISA kit.
[0079] Standards and samples were added to antibody-coated ELISA plates, incubated, washed, and then biotinylated detection antibodies were added. The plates were incubated and washed again, and horseradish peroxidase-labeled streptavidin was added. Finally, the substrate TMB was added for color development. Immediately after terminating the reaction, the absorbance at 450 nm was measured using an ELISA reader. The concentration of the test matrix in the supernatant was calculated using a standard curve.
[0080] Figure 6 The results of the ELISA test on the secretion of matrix (COL2A1) in the supernatant show that when the expression of COL2A1 is not lower than the 2D plane, it can be used for pathological evaluation and in vitro model construction.
[0081] Example 5 This embodiment provides an assessment of the status of the nucleus pulposus cells cultured in Example 3.
[0082] In this embodiment, the status of cultured nucleus pulposus cells is assessed using gene expression and protein biomarkers. Specifically, this includes: Cells cultured in the culture system of Example 3 with ≥3 passages were collected, and mRNA was extracted using an RNA extraction kit (FastPure Universal Plant Total RNA Isolation Kit, RC411-01). The collected mRNA was then reverse transcribed into cDNA using reverse transcriptase. A reaction mixture was prepared using the cDNA template, specific primers, SYBR Green (Beyotime, D7405), and qPCR premix. The mixture was aliquoted into qPCR-specific 8-tube or 96-well plates. The plates were placed in a real-time quantitative PCR instrument, and the amplification program was set: typically pre-denaturation (95°C, 30 seconds), followed by 40 cycles of denaturation (95°C, 5 seconds) and annealing / extension (60°C, 30 seconds). The instrument monitored and recorded the fluorescence signal for each cycle in real time. After the reaction, the target gene was relatively quantified according to a standard curve or the ΔΔCt method.
[0083] Primer sequences include: human-COL2A1-F:TGGTCTGAGGGGTCTTCC (SEQ ID NO.1), human-COL2A1-R: CTGGTCACCTGGGTTTTCC (SEQ ID NO. 2); human-ACAN-F: AAAACTTCTTTGGAGTGGGGGG (SEQ ID NO.3), human-ACAN-R: TGGGCTTTACGGTAAGGATCA (SEQ ID NO.4); human-COL1A1-F: CGGTGAACCTGGTGCTCCTG (SEQ ID NO.5), human-COL1A1-R:GCTCCTCGCTTTCCTTCCTCTC (SEQ ID NO.6); human-GAPDH-F:CCCACTCCTCCACCTTTGAC (SEQ ID NO.7), human-GAPDH-R:TCTTCCTCTTGTGCTCTTGC (SEQ ID NO. 8).
[0084] Simultaneously, other cell types were collected for flow cytometry marker detection. For surface marker staining, cells were resuspended in 100 μL of flow cytometry buffer. The corresponding flow cytometry antibody (Novus Biologicals, NB100-74350F; LSBio, LS-C783682-0.2; Rockland, 600-402-104) was added, and the cells were incubated for 1 h. After washing away the flow cytometry antibody, the cells were transferred to the flow cytometer for loading. For intracellular marker staining, cells were placed in 1 mL of PFA and fixed in the dark for 30 min. After centrifugation to remove the PFA, 1 mL of flow cytometry transmembrane buffer was added, and transmembrane was incubated for 30 min. After washing away the transmembrane buffer, the cells were blocked in blocking buffer containing 10% goat serum for 1 h. After centrifugation, the blocking buffer was discarded, and the cell pellet was collected. Finally, the cells were transferred to flow cytometry buffer and incubated with intracellular antibody for 1 h. After washing away the flow cytometry antibody, the cells were transferred to the flow cytometer for loading.
[0085] Figure 7 Nucleus pulposus cells cultured in DMEM / F12+10% FBS at passages P0 and P8 (NP-FBS) and nucleus pulposus cells cultured in nucleus pulposus cell expansion medium (NP-NPM) were detected by qPCR. COL1A1 , COL2A1 and ACAN The gene expression results showed that the nucleus pulposus cell expansion medium used in Example 3 could stably maintain a good state of nucleus pulposus cells. The qPCR results of detecting functional markers of nucleus pulposus cells at passage P8 showed that the functional markers of nucleus pulposus cells could be stably expressed, while the nucleus pulposus cells cultured in conventional DMEM / F12+10%FBS showed loss of functional marker expression and exhibited a fibrotic phenotype.
[0086] Figure 8 These are the flow cytometry results of nucleus pulposus cells cultured in P15 passage nucleus pulposus cell expansion medium. The results indicate that the nucleus pulposus cell expansion medium used in Example 3 can stably maintain good nucleus pulposus cells, which still express their functional markers COL2A1 and ACAN at passage P15, and do not express the fibrosis marker COL1A1.
[0087] Example 6 This embodiment provides the application of the nucleus pulposus cells (preparation) cultured in Example 3 in the treatment of intervertebral disc diseases.
[0088] P5 generation cells cultured and passaged in Example 3 were digested with cell digestive enzymes (gibco, 12563029), resuspended in physiological saline at 2.0E+07 / mL, and stored at 2-8℃ for 12 h as test substances.
[0089] Model establishment: All animals were acclimatized in the animal laboratory for one week. Rats were anesthetized, and lumbar spine X-rays were performed preoperatively. The tails were disinfected with iodine, and the intervertebral discs were exposed. A semi-transverse puncture was performed on the Co8 / 9 intervertebral disc of the rat caudal vertebra using a 20G micro-puncture device. In the control group, only the Co8 / 9 intervertebral disc of the rat caudal vertebra was exposed. The day of model establishment was recorded as D0. Penicillin was injected for three consecutive days postoperatively to prevent infection.
[0090] Drug administration: On day 14 after modeling, imaging examination was performed to confirm successful modeling. Then, the modeling group was divided into groups and administered the drug in situ (10 μL).
[0091] Tissue sample collection: After the D98 imaging examination, the animals were euthanized, and the caudal vertebral body and intervertebral disc specimens were separated and fixed in 4% PFA.
[0092] Intervertebral disc height index calculation: At D14 and D98, the height of the intervertebral discs and the upper and lower edges of the vertebral bodies on both sides and in the middle of each group was measured, and the intervertebral disc height index (DHI) was calculated.
[0093] Histopathological evaluation: Co8 / 9 “vertebral body-intervertebral disc-vertebral body” tissue fixed in 4% paraformaldehyde solution was decalcified and then paraffin sections were prepared (sectioning started from the ventral side of the spine and progressed to the dorsal side, and coronal sections were made) and histopathological sections were scanned by white light.
[0094] Figure 9 A schematic diagram of an anteroposterior X-ray of the lumbar spine taken before modeling experimental animals.
[0095] Figure 10 The results of a section of the caudal vertebrae at D98 in the experimental animal.
[0096] Figure 11 The results of DHI statistics for the caudal vertebrae position in experimental animals at D0, D14, and D98 are presented.
[0097] The results showed that the rat caudal intervertebral disc degeneration model was successfully established through acupuncture. In the group injected with the test substance, the height of the degenerated caudal vertebrae was significantly restored compared to the group injected with the solvent (physiological saline). Histological section results showed that the intervertebral space in the group injected with the test substance was restored compared to the solvent group, and the intervertebral structure remained intact. This demonstrates that the nucleus pulposus cells cultured in Example 3, when used for intervertebral disc injury, can significantly reverse further degeneration and damage, suggesting that the nucleus pulposus cells cultured in this invention can be used to treat intervertebral disc diseases such as intervertebral disc injury.
Claims
1. A method for isolating nucleus pulposus cells, characterized in that, The method includes the following steps: S1, cleaning, cutting, and centrifugation of the nucleus pulposus tissue, specifically includes: Harvest nucleus pulposus tissue, clean it, and cut it into (1-10) mm pieces. 3 Centrifuge at 300-800 g for 3-5 min, discard the supernatant, and enrich the tissue precipitate; S2, digestion and collection of nucleus pulposus cells, specifically includes: The enriched tissue precipitate was initially digested for 1-4 h using an NB6 collagenase solution with a final concentration of 0.1-0.3 PZU. After digestion was stopped, the mixture was filtered through a 70-100 μm filter sieve to obtain the first solid and the first liquid. The first solid is digested with a compound enzyme solution for 30-60 minutes, which includes trypsin and hyaluronidase. After digestion, the second liquid is obtained by filtration through a 70-100 μm filter sieve. After combining the second liquid with the first liquid, centrifuge at 300-500 g for 3-5 min, discard the supernatant, and harvest primary nucleus pulposus cells; or combine the cells obtained by centrifuging the first liquid and the second liquid separately at 300-500 g for 3-5 min, and harvest primary nucleus pulposus cells.
2. The method for isolating nucleus pulposus cells according to claim 1, characterized in that, The mass ratio of trypsin to hyaluronidase in the compound enzyme solution is (1.25-0.25):0.
15.
3. The method for isolating nucleus pulposus cells according to claim 2, characterized in that, The concentration of trypsin and hyaluronidase in the compound enzyme solution is 0.025%-0.075% (w / v).
4. The method for isolating nucleus pulposus cells according to any one of claims 1-3, characterized in that, The method further includes: Primary nucleus pulposus cells were sorted by flow cytometry to obtain Tie2 cells. + CD90 + Nucleus pulposus cells.
5. A method for culturing nucleus pulposus cells, characterized in that, The method includes: In a matrix-coated culture dish, nucleus pulposus cells obtained by the isolation method according to any one of claims 1-4 are seeded into nucleus pulposus cell expansion medium for expansion culture. When the cells reach an adherent state and a confluence of 80%-95%, they are passaged, wherein: The substrate-coated culture vessels are: Culture vessels coated with Matrigel and type II collagen, or culture vessels coated with Matrigel, type II collagen and fibronectin; The nucleus pulposus cell expansion culture medium includes the following components: A basal medium consisting of a mixture of DMEM high-glucose basal medium, Ham's F12 basal medium, and IMDM combined medium; hPL or serum substitutes; Added factors: bFGF, EGF, Y27632, CHIR99021, PD0325901, noggin, TGF-β, BMP-2; Microenvironment modifiers: GlutaMAX, NEAA, GlutaMAX, NEAA, L-Ascorbic acid 2-phosphate, beta-mercaptoethanol.
6. The method for culturing nucleus pulposus cells according to claim 5, characterized in that, The nucleus pulposus cell expansion culture medium includes the following components: A basal medium consisting of a mixture of DMEM high-glucose basal medium, Ham's F12 basal medium and IMDM combined medium in a volume ratio of (7-9):(7-9):(1-2); 5%-10% hPL or serum substitutes; Added factors: 5-15 ng / mL bFGF, 2-10 ng / mL EGF, 5μM Y27632+3-15μM CHIR99021+ 0.1-0.5 nM PD0325901, 50-200 ng / mL noggin, 2-10 ng / mL TGF-β, 30-90 ng / mL BMP-2; Microenvironment modifiers: 0.5%-2% GlutaMAX, 0.5%-2% NEAA, 0.5%-2% GlutaMAX, 0.5%-2% NEAA, 1-10 μg / mL L-Ascorbic acid 2-phosphate, 0.05-0.2 mM beta-mercaptoethanol.
7. The method for culturing nucleus pulposus cells according to claim 5 or 6, characterized in that, The method for preparing the substrate-coated culture vessel includes: Freeze the culture dishes at low temperature; cover with a substrate consisting of Matrigel and type II collagen; every 10 cm² 2 Spread with approximately 1 mL of a matrix solution comprising a final concentration of 50-100 μg / mL Matrigel and 1-2 μg / mL type II collagen in a 3:1 volume ratio; incubate overnight at 4°C or at least 1-2 hours at 37°C; or Freeze the culture dish at low temperature; cover with a substrate consisting of Matrigel, type II collagen, and fibronectin; every 10 cm² 2 Spread with approximately 1 mL of matrix solution, which consists of Matrigel at a final concentration of 50-100 μg / mL and 1-2 μg / mL of 0.1-0.5 µg / mL fibronectin in a volume ratio of 7:2:1; incubate overnight at 4°C or at least 1-2 hours at 37°C.
8. Nucleus pulposus cells obtained by culturing the nucleus pulposus cells according to any one of claims 5-7.
9. The use of the nucleus pulposus cells as described in claim 8 in the preparation of drugs for treating intervertebral disc degenerative diseases or in the construction of research models for spinal diseases.
10. A culture medium for expanding nucleus pulposus cells, characterized in that, The nucleus pulposus cell expansion culture medium comprises the following components: A basal medium consisting of a mixture of DMEM high-glucose basal medium, Ham's F12 basal medium, and IMDM combined medium; hPL or serum substitutes; Added factors: bFGF, EGF, Y27632, CHIR99021, PD0325901, noggin, TGF-β, BMP-2; Microenvironment modifiers: GlutaMAX, NEAA, GlutaMAX, NEAA, L-Ascorbic acid 2-phosphate, beta-mercaptoethanol.