BbATP4 gene and application thereof in regulation and control of pathogenic performance of beauveria bassiana

Abstract

The invention discloses a BbATP4 gene and application thereof in regulation and control of pathogenic performance of beauveria bassiana. A nucleotide sequence of the BbATP4 gene is shown as SEQ ID NO.1. The invention belongs to the technical field of biological control and fungal molecular genetic engineering. The insecticidal performance of the beauveria bassiana is directionally improved by regulating the overexpression of the BbATP4 gene in the beauveria bassiana. Compared with wild type beauveria bassiana, the recombinant beauveria bassiana strain obtained through transformation has the advantages that the fatality rate of monochamus alternatus larvae is remarkably increased, the biocontrol application effect of the beauveria bassiana is effectively improved, the biocontrol application value and industrial popularization potential of the beauveria bassiana are greatly improved, and the recombinant beauveria bassiana strain has wide application prospects in the field of biological prevention and control of agricultural and forestry pests.

Description

Technical Field

[0001] This invention belongs to the field of biological control and fungal molecular genetic engineering technology, specifically involving BbATP4 Genes and their application in regulating the pathogenicity of Beauveria bassiana. Background Technology

[0002] Green control of agricultural pests is one of the core requirements for ensuring the quality and safety of agricultural products and maintaining the stability of farmland ecosystems. The long-term excessive use of chemical pesticides can easily lead to a series of problems such as the outbreak of pesticide resistance in pests, excessive pesticide residues in agricultural products, and suppression of the survival of non-target organisms. Therefore, environmentally friendly biological control methods have become the focus of current research and application in agricultural pest management.

[0003] Beauveria bassiana is an insect pathogenic fungus widely used for agricultural pest control, but its wild-type strains have low pest infestation efficiency under natural conditions, a deficiency that significantly limits its stable effectiveness in the field. Studies have shown that... ATP ATP synthase subunit genes play a crucial role in fungal energy metabolism, host growth, and virulence regulation. Therefore, there is an urgent need to discover novel ATP synthase subunit genes and, through the regulation of their expression, enhance the pathogenicity of *Beauveria bassiana* to address the technical challenge of unstable infection efficiency in wild-type strains. Summary of the Invention

[0004] The purpose of this invention is to provide BbATP4 Genes and their application in regulating the pathogenicity of Beauveria bassiana.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of the present invention provides BbATP4 The application of genes in improving the pathogenicity of Beauveria bassiana, the aforementioned BbATP4 The nucleotide sequence of the gene is shown in SEQ ID NO. 1, overexpression BbATP4 Genes enhance the insecticidal properties of Beauveria bassiana against pests.

[0006] Furthermore, the pest in question is the pine sawyer beetle.

[0007] A second aspect of the present invention provides a method for improving the pathogenicity of Beauveria bassiana, specifically by overexpressing [a specific substance] in Beauveria bassiana. BbATP4 Genes enhance the insecticidal properties of Beauveria bassiana. BbATP4 The nucleotide sequence of the gene is shown in SEQ ID NO. 1, and the pathogenicity is to enhance the lethality against the pine sawyer beetle.

[0008] A third aspect of the present invention provides an overexpression BbATP4 Genetically modified Beauveria bassiana, the aforementioned BbATP4The nucleotide sequence of the gene is shown in SEQ ID NO. 1. The modified Beauveria bassiana is an overexpression of Beauveria bassiana. BbATP4 Obtained through genes.

[0009] The fourth aspect of this invention provides a method for constructing the above-mentioned modified Beauveria bassiana, the specific steps of which are: to... BbATP4 The gene was ligated into the pK2 vector to obtain the pK2- vector. BbATP4 Then, by transforming Beauveria bassiana using the Agrobacterium-mediated transformation method, the improved strain of Beauveria bassiana was obtained.

[0010] A fifth aspect of the present invention provides an insecticide containing the above-described modified Beauveria bassiana.

[0011] The sixth aspect of this invention provides the application of the above-mentioned modified Beauveria bassiana or the above-mentioned insecticide in the control of pests.

[0012] Furthermore, the pest in question is the pine sawyer beetle.

[0013] The advantages of this invention are: To address the low infection efficiency of wild-type Beauveria bassiana in biocontrol applications, this invention utilizes genetic engineering technology to construct... BbATP4 Gene expression vectors were used to direct the introduction of gene expression into wild-type Beauveria bassiana and achieve [the desired results]. BbATP4 Overexpression. Experimental results show that overexpression... BbATP4 Genes can significantly enhance the pathogenicity of Beauveria bassiana and increase the mortality rate of pine sawyer beetle larvae, thus significantly improving the biocontrol application value and industrialization potential of Beauveria bassiana. Attached Figure Description

[0014] Figure 1 Bubble chart showing KEGG enrichment analysis of differentially expressed genes in the transcriptome of Beauveria bassiana infection at 48h and 24h.

[0015] Figure 2 : BbATP4 Gel electrophoresis results of PCR amplification products of the gene.

[0016] Figure 3 Beauveria bassiana expression vector pK2- BbATP4 Schematic diagram.

[0017] Figure 4 Western Blot Detection BbATP4 The expression level of BbATP4 protein in Beauveria bassiana was overexpressed.

[0018] Figure 5 Wild-type Beauveria bassiana and BbATP4 The mortality rate of *Beauveria bassiana* larvae 48 hours after overexpression of *Beauveria bassiana* was determined. Detailed Implementation

[0019] To make the content of this invention easier to understand, the technical solution of this invention will be further described below with reference to specific embodiments, but this invention is not limited thereto.

[0020] Unless otherwise specified, the methods used in the following embodiments are all conventional methods in the art.

[0021] Example 1: BbATP4 Gene cloning Beauveria bassiana strain BbFZ-51 was obtained from the Fujian Academy of Forestry Sciences and was isolated and preserved by personnel from the Institute of Forest Protection of the Academy.

[0022] First, we analyzed the KEGG enrichment bubble diagram of differentially expressed genes in the transcriptome of Beauveria bassiana infection at 48 hours and 24 hours ( ). Figure 1 These pathways primarily reflect several key intracellular biological processes and metabolic activities, involving energy metabolism, signal transduction, organelle degradation and recycling, and cellular stress responses. BbATP4 Differential genes are involved in almost all of the above-mentioned biological processes and metabolic activities.

[0023] Beauveria bassiana BbFZ-51 was cultured for 14 days at 25 ± 1°C, 50% humidity, and a 12-hour light-12-hour dark light cycle. After culture, the bacterial cells were collected, and total RNA was extracted. The RNA was then incubated at 42°C for 30 minutes using the TransScriptOne-Step gDNA Removal and cDNA Synthesis SuperMix kit (Cat No. AT311-03, Beijing TransGen Biotech Co., Ltd.). cDNA was obtained by reverse transcription. Using the synthesized cDNA as a template, PCR amplification was performed using specific primers (F: TTTTAATCAATAACAAGGCCTATGCATCACCTTCGCACCT; R: TCGTCTTTGTAGTCAGGCCTAGCCATGCTAGAATTTTTGGC). The full-length 3012 bp RNA was obtained using the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (Cat No. R045A, Shanghai Biosun Biotechnology Co., Ltd.). BbATP4 The gene, whose nucleotide sequence is shown in SEQ ID NO.1, was used. The PCR amplification products were loaded onto the wells of a 1% agarose gel for electrophoresis. After analyzing the results using an agarose gel imaging system, the target fragments on the agarose gel were cut with a clean blade and placed into 1.5 mL centrifuge tubes. DNA purification was performed using an agarose gel DNA recovery kit (Cas No. D2111-03, Beijing Chuangyoumei Biotechnology Co., Ltd.) for subsequent use. Figure 2).

[0024] Example 2: Construction of overexpression strain Will BbATP4 After gene purification, the DNA gel recovery product was inserted into the fungal expression vector pK2 to construct the recombinant expression vector pK2- BbATP4 The cells were transformed into competent E. coli DH5α cells and cultured at 37°C for 12 hours on LB agar plates containing 50 µg / mL kanamycin. Single colonies were then picked and propagated. After PCR identification and DNA sequencing confirmed their accuracy, the following structure was constructed: Figure 3 The carrier pK2- shown BbATP4 The constructed vector pK2- BbATP4 Agrobacterium AGL0 electroporation was performed, followed by incubation at 28°C for at least 36 hours on LB agar plates containing 50 µg / mL kanamycin / rifampin. Single colonies of Agrobacterium were picked, propagated, and identified by PCR. Positive Agrobacterium and Beauveria bassiana were co-cultured on PDA plates for 48 hours. After co-culture, the spore-hyphae-bacterial mixture on the membrane was washed off with sterile 0.03% Tween-80 aqueous solution, vortexed, and filtered through double-layer lens paper to remove hyphal clumps, yielding a single-spore suspension. This single-spore suspension was then placed on PDA plates containing 300 µg / mL cefotaxime (which inhibits Agrobacterium) / 150 µg / mL hygromycin B (only transformants can grow). Single colonies were picked and cultured in PDA liquid medium containing the same antibiotics for 96 hours. Western blot results showed that Beauveria bassiana successfully overexpressed the BbATP4 protein (…). Figure 4 The resulting Beauveria bassiana is the overexpressed strain. BbATP4 Beauveria bassiana spores.

[0025] Example 3: Pathogenicity Detection Wild-type Beauveria bassiana BbFZ-51 spores were combined with overexpression BbATP4 Beauveria bassiana spores were cultured in PDA liquid medium on a shaker at 28°C for 96 hours, then centrifuged at 4000 rpm for 10 minutes at room temperature and resuspended in a 0.03% Tween-80 aqueous solution (sterilized at high temperature). The washing process was repeated three times. The final resuspended spore concentration was adjusted to 1×10⁻⁶. 8 Spores / mL. Set up Control group, Bb group, and Bb- ATP4 Group OX and Group Bb involved immersing cleaned pine sawyer beetle larvae (JPS) in a suspension of wild-type Beauveria bassiana BbFZ-51 spores for 15 seconds. ATP4 The OX group involved immersing cleaned pine sawyer beetle larvae in an overexpression group. BbATP4The larvae were treated with a suspension of Beauveria bassiana spores for 15 seconds. The control group consisted of pine sawyer beetle larvae immersed in an equal volume of 0.03% Tween-80 solution for 15 seconds. Each treatment group contained 30 larvae, and the mortality rate of the pine sawyer beetle larvae was recorded after 48 hours. The experimental results are as follows: Figure 5 As shown, Bb- ATP4 The mortality rate of pine sawyer beetle larvae in group OX was significantly higher than that in group Bb.

[0026] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.

Claims

1. BbATP4 The use of a gene to improve the pathogenicity of Beauveria bassiana, characterized in that: The BbATP4 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, overexpression BbATP4 The gene improves the insecticidal performance of Beauveria bassiana against pests.

2. Use according to claim 1, characterized in that: The pest is the pine wood nematode.

3. A method of improving the pathogenic performance of Beauveria bassiana, characterized by: Overexpression of a gene in beauveria bassiana BbATP4 The gene improves the pathogenic performance of the beauveria bassiana, and the pathogenic performance is to improve the killing power on monochamus alternatus. BbATP4 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the pathogenic performance is to improve the killing power on monochamus alternatus.

4. A modified Beauveria bassiana overexpressing BbATP4 a gene, characterized in that: The BbATP4 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the improved Beauveria bassiana is obtained by overexpressing BbATP4 The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the improved Beauveria bassiana is obtained by overexpressing 5. The method of constructing a modified Beauveria bassiana of claim 4, wherein: Will BbATP4 The gene was ligated into the pK2 vector to obtain the pK2- vector. BbATP4 Then, by transforming Beauveria bassiana using the Agrobacterium-mediated transformation method, the improved strain of Beauveria bassiana was obtained.

6. An insecticide, characterized by: The insecticide contains the improved Beauveria bassiana as claimed in claim 4.

7. The use of the improved Beauveria bassiana as claimed in claim 4 or the insecticide as claimed in claim 6 for controlling pests.

8. Use according to claim 7, characterized in that: The pest is the pine wood nematode.

Images