Construction and application of escherichia coli for producing 2 '-fucosyllactose

Abstract

The invention discloses construction and application of escherichia coli for producing 2 '-fucosyllactose, and belongs to the technical field of biological genetic engineering. According to the invention, the genome of probiotic Escherichia coli Nissle1917 (EcN) is modified to construct an engineering bacterium capable of synthesizing 2 '-fucosyllactose (2'-FL), and the maximum yield of 2 '-FL through shake flask fermentation reaches 5.48 g / L. According to the engineering bacteria constructed by using the method, the use of exogenous plasmids is reduced, the defect that pollution is possibly caused by adding antibiotics and inducers in the fermentation process in the prior art is overcome, the safety of products is improved, the production cost is reduced, the engineering bacteria have remarkable environmental protection value and economic benefits, and technical support is provided for industrial production of 2 '-FL.

Description

Technical Field

[0001] This invention relates to a method for constructing and applying a constitutive integrative strain for producing 2'-fucosylated lactose (2'-FL), belonging to the field of bioengineering technology. Background Technology

[0002] Human milk oligosaccharides (HMOs) are vital biological components in human breast milk. 2'-Fucosyllactose (2'-FL) is a major component of HMOs; it is not digested or absorbed by the upper digestive tract and can directly reach the intestines to exert its effects, exhibiting high safety and bioactivity. 2'-Fucosyllactose possesses various physiological functions, including regulating gut microbiota and influencing brain development. It selectively enhances the growth of beneficial bacteria such as Bifidobacteria, inhibits the adhesion of harmful bacteria to the intestinal mucosa, and maintains gut microecological balance. Furthermore, it can influence neural development through the gut-brain axis, promoting nerve cell proliferation and differentiation, and improving cognitive function-related indicators. It holds broad promise for applications in infant formula, dietary supplements, pharmaceuticals, and novel foods. Therefore, the efficient synthesis of 2'-fucosyllactose and the promotion of its industrial production and commercial application are inevitable trends.

[0003] Currently, the main methods for producing 2'-fucosylated lactose include chemical methods, enzymatic methods, and biosynthesis. With the development of genetic engineering technology, biosynthesis has gained increasing attention due to its scalability and lower cost. Engineered bacterial strains that synthesize 2'-fucosylated lactose often use plasmid-borne gene overexpression, which means antibiotics are required during fermentation. Furthermore, these engineered strains often use inducible promoters, necessitating the use of inducers during fermentation. The use of antibiotics and inducers reduces the safety of target product purification during industrial production. In addition, the extensive replication of plasmids during fermentation gradually increases the growth burden on the cells, and plasmids are easily lost during subculturing, limiting the industrial application and development of 2'-fucosylated lactose. In recent years, the advantages of genome-modified strains have received increasing attention. These strains do not require inducers, antibiotics, or plasmids, offering advantages such as no induction, continuous gene expression, and reduced production costs in fermentation production. Therefore, it is essential to construct a genome-engineered bacterium as an industrial production strain of 2'-fucosylated lactose to improve the safety of the production process and the use of the target product. Summary of the Invention

[0004] To overcome the problem of reduced safety of the production process and target product due to the addition of antibiotics and inducers in the existing process of producing 2'-fucosylated lactose using common E. coli as an engineered bacterium, this invention provides a recombinant probiotic Escherichia coli for the production of 2'-fucosylated lactose, enabling efficient fermentation synthesis of 2'-fucosylated lactose without the addition of antibiotics and inducers. The specific technical solution is as follows:

[0005] In one aspect, the present invention provides a method for preparing recombinant probiotic Escherichia coli that produces 2'-fucosylated lactose (2'-FL), the method comprising modifying the genome of probiotic Escherichia coli EcNc ΔattB(lacUV5-T7)ΔendAΔompT, the modification comprising knocking out key enzyme genes of the 2'-FL bypass catabolism pathway and knocking in key enzyme genes of the 2'-FL synthesis pathway.

[0006] In this invention, the preparation method of probiotic Escherichia coli EcNc ΔattB(lacUV5-T7)ΔendAΔompT can refer to the method disclosed in CN202310516515.6.

[0007] In one embodiment, the key enzyme gene of the 2'-FL synthesis pathway is expressed by a constitutive promoter and RBS of varying strengths, and the knock-in site and copy number of the key enzyme gene are the same or different.

[0008] In one embodiment, the key enzyme gene of the 2'-FL synthesis pathway is expressed by an inducible promoter and RBS of varying strengths, and the knock-in site and copy number of the key enzyme gene are the same or different.

[0009] In one embodiment, the genomic modification of the probiotic *E. coli* EcNc ΔattB(lacUV5-T7)ΔendAΔompT includes: knocking out the glucose-1-undecylphosphate phosphotransferase gene wcaJ and the β-galactosidase gene lacZ; knocking in the α-1,2-fucosyltransferase gene wcfB and the β-galactosidase permease gene lacY; knocking in the phosmannosylase gene manB and the phosguanine transferase gene manC; and knocking in the GDP-mannose-4,6-dehydratase gene gmd and the GDP-fucose synthase gene WcaG. That is, wcfB, lacY, manB, manC, gmd, and WcaG are integrated into the genome and overexpressed in the recombinant bacterial genome.

[0010] In this invention, the knockout of the lacZ and wcaJ genes in probiotic E. coli EcNc ΔattB(lacUV5-T7)ΔendAΔompT can be performed using the method disclosed in CN202311431659.8.

[0011] In one embodiment, the lacY, wcfB, manB, manC, gmd, and WcaG genes are overexpressed on the genome via expression cassettes formed by constitutive promoters and RBS.

[0012] In one embodiment, the lacY, wcfB, manB, manC, gmd, and WcaG genes are overexpressed on the genome via expression cassettes formed by inducible promoters and RBS.

[0013] In one embodiment, the constitutive promoter and RBS are composed of P 119 Composed of RBS1~RBS6, the inducible promoter and RBS are composed of P T7 It consists of RBS1~RBS6; among which, promoter P 119 The sequence is shown in SEQ ID NO.16, promoter P T7 The sequence is shown in SEQ ID NO.17, and the sequences of RBS1 to RBS6 are shown in SEQ ID NO.18 to SEQ ID NO.23, respectively.

[0014] In one embodiment, the constitutive promoter and RBS include P 119-RBS1 P 119-RBS2 P 119-RBS3 P 119-RBS4 P 119-RBS5 and P 119-RBS6 One or more of them.

[0015] In one embodiment, the inducible promoter and RBS include P T7-RBS1 P T7-RBS2 P T7-RBS3 P T7-RBS4 P T7-RBS5 and P T7-RBS6 One or more of them.

[0016] Preferably, the wcfB gene and lacY gene are represented by P. 119-RBS1 and P 119-RBS3 Overexpression.

[0017] Preferably, the manB gene and manC gene are represented by P. 119-RBS1 Overexpression.

[0018] Preferably, the gmd gene and WcaG gene are used with P 119-RBS6 Overexpression.

[0019] In one embodiment, one or more of the nudD, mtlD, mdfA, poxB, ompT, and pfkA genes on the strain genome, lacY and / or wcfB, are knocked in. That is, lacY and wcfB genes can be knocked in simultaneously at the same gene locus, or only one of the lacY and wcfB genes can be knocked in.

[0020] Preferably, the lacY gene and the wcfB gene are knocked into the nudD, mtlD and mdfA gene loci on the strain genome.

[0021] Preferably, the wcfB gene is knocked into the poxB, ompT and pfkA gene loci on the strain genome.

[0022] Preferably, the lacY gene is knocked into the pfkA and mdfA gene loci on the strain genome.

[0023] Preferably, the copy number and ratio of knock-in to the strain genome and overexpression using plasmids are different.

[0024] In one embodiment, no more than two lacY genes are knocked in; further, two or one lacY genes are knocked in.

[0025] In one embodiment, no more than 6 wcfB genes are knocked in; further, the number of knocked-in wcfB genes may be 6, 5, 4, 3, 2, or 1.

[0026] In one embodiment, the ratio of the knock-in lacY gene to the wcfB gene is 1~2:1~6; preferably, the ratio of the knock-in lacY gene to the wcfB gene is 1:1, 2:2, 3:3, 3:2, 2:3, 2:4, or 2:5; more preferably, the ratio of the knock-in lacY gene to the wcfB gene is 2:4.

[0027] In this invention, the nucleotide sequence of the gene encoding manB is shown in SEQ ID NO.1; the nucleotide sequence of the gene encoding manC is shown in SEQ ID NO.2; the nucleotide sequence of the gene encoding gmd is shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding wcaG is shown in SEQ ID NO.4; the nucleotide sequence of the gene encoding lacY is shown in SEQ ID NO.5; the nucleotide sequence of the gene encoding wcfB is shown in SEQ ID NO.6; the nucleotide sequence of the gene encoding nudD is shown in SEQ ID NO.7; the nucleotide sequence of the gene encoding mtlD is shown in SEQ ID NO.8; the nucleotide sequence of the gene encoding mdfA is shown in SEQ ID NO.9; the nucleotide sequence of the gene encoding PoxB is shown in SEQ ID NO.10; the nucleotide sequence of the gene encoding OmpT is shown in SEQ ID NO.11; and the nucleotide sequence of the gene encoding pfkA is shown in SEQ ID NO.12.

[0028] In one aspect, the present invention discloses a recombinant probiotic Escherichia coli, which is prepared by any of the methods described above.

[0029] In one aspect, the present invention discloses the application of recombinant probiotic Escherichia coli in the production of 2'-fucosylated lactose (2'-FL), wherein the recombinant probiotic Escherichia coli is prepared by any of the methods described above in the present invention.

[0030] In one aspect, the present invention discloses a 2'-fucosylated lactose (2'-FL), which is produced by recombinant Escherichia coli prepared by any of the methods described above.

[0031] Beneficial effects

[0032] Compared with existing technologies, the present invention has at least the following beneficial effects: Based on the construction of engineered bacteria for producing 2'-fucosylated lactose, the present invention further constructs integrated strains, designs novel genetic modification strategies, and utilizes promoter and RBS combination to control gene co-expression, achieving efficient production of 2'-fucosylated lactose while avoiding the use of antibiotics and inducers, improving product safety, reducing production costs, and achieving a shake-flask yield of 5.48 g / L of 2'-fucosylated lactose. This provides a new method and new ideas for the efficient, low-cost, and safe industrial production of 2'-fucosylated lactose. Attached Figure Description

[0033] Figure 1 : gmd-WcaG gene inducible promoter P T7and constitutive promoter P 119 A schematic diagram of the expression box construction, where (A) uses the inductive promoter P. T7 (a) Schematic diagram of the expression box; (b) Using the constitutive promoter P 119 A schematic diagram of the expression box.

[0034] Figure 2 : manB-manC gene inducible promoter P T7 and constitutive promoter P 119 A schematic diagram of the expression box construction, where (A) uses the inductive promoter P. T7 (a) Schematic diagram of the expression box; (b) Using the constitutive promoter P 119 A schematic diagram of the expression box.

[0035] Figure 3 Schematic diagram of Example 1, wherein (A) constitutive promoter P 119 (A) Schematic diagram of the expression cassette; (B) Schematic diagram of plasmid construction for screening the promoters of the key enzymes lacY and wcfB genes.

[0036] Figure 4 HPLC results of 2'-FL standard and sample: (A) Figure shows the liquid phase peaks of the mixed standard of glucose, lactose and 2'-FL. The peak times of the mixed standard of glucose, lactose and 2'-FL are 5.925 min, 8.833 min and 10.640 min, respectively; (B) Figure shows the liquid phase peaks of the 2'-FL fermentation broth. The peak time of the product 2'-FL in the fermentation broth sample is consistent with the peak time of the standard. Detailed Implementation

[0037] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific conditions are not specified in the examples, they should be performed under conventional conditions, manufacturer's recommended conditions, or relevant operating instructions. The molecular biology and bioinformatics methods involved in the examples can be found in relevant textbooks, reference books, and teaching websites, including but not limited to "Molecular Biology," "Genetic Engineering," "Molecular Cloning: A Laboratory Manual," and "A Concise Guide to Molecular Biology Experiments." Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0038] Example 1 Construction of chassis strain

[0039] 1. Preparation of the chassis of probiotic Escherichia coli EcNc ΔattB(lacUV5-T7) ΔendAΔOmpTΔlacZΔwcaJ

[0040] In the original probiotic Escherichia coli Nissle1917, an optimized T7 RNAP expression cassette (nucleotide sequence shown in SEQ ID NO. 13) was inserted into the Nissle 1917 genome using CRISPR / Cas9 gene editing technology. The insertion site was the attB site on the genome. Subsequently, the endA and ompT genes were knocked out to prepare EcNc ΔattB(lacUV5-T7)ΔendAΔompT. The relevant method is described in CN202310516515.6. The knockout process of the lacZ and wcaJ genes can be found in CN202311431659.8. The prepared EcNc ΔattB(lacUV5-T7)ΔendAΔompTΔlacZΔwcaJ is abbreviated as EcNc01.

[0041] 2. Screening of promoters for co-expression of gmd-WcaG gene in the de novo 2'-fucosylated lactose synthesis pathway

[0042] 2.1 Construction of plasmids

[0043] The α-1,2-fucosyltransferase gene wcfB (Bacteroides fragilis) was artificially synthesized and codon-optimized by Suzhou Hongxun Biotechnology Co., Ltd. Using the genome of *E. coli* K-12 MG1655 as a template, the gene fragment of the β-galactosidase gene lacY was cloned using LacY-F / LacY-R primers (nucleotide sequences shown in SEQ ID NO.1514 and SEQ ID NO.15). The lacY gene fragment was then recovered. Based on overlap extension PCR technology, homologous arms at upstream and downstream sites of the lacY and wcfB genes were designed to overlap, allowing for tandem expression of lacY-wcfB. The lacY-wcfB gene fragment was then ligated into the vector pCDFDuet using a homologous recombination seamless cloning kit to construct the plasmid pCDFDuet-lacY-wcfB.

[0044] 2.2 Construction of engineered bacteria

[0045] The plasmid pCDFDuet-lacY-wcfB constructed in the above steps was transformed into strain EcNc01 to obtain a strain that produces 2'-fucosylated lactose, abbreviated as EcNc02.

[0046] 2.3 Promoter Selection

[0047] The intracellular fructose-6-phosphate to GDP-L-fucose synthesis pathway of the engineered bacterium EcNc02 was enhanced, and promoter combinations were screened. The GDP-mannose-4,6-dehydrase gmd gene and the GDP-fucose synthase WcaG gene were co-expressed. Promoter screening was performed: constitutive promoter P was selected. 119 and the inductive promoter P T7 (The nucleotide sequences are shown in SEQ ID NO.16 and SEQ ID NO.17, respectively), and a series of RBS sequences, including: RBS1, RBS2, RBS3, RBS4, RBS5, and RBS6 (nucleotide sequences are shown in SEQ ID NO.18 to SEQ ID NO.23, see Table 1 for details), to construct a series of expression promoter RBS combinations, wherein the promoter RBS combinations include: P 119 - RBS1 P 119 - RBS2 P 119-RBS3 P 119 - RBS4 P 119 - RBS5 P 119-RBS6 P T7-RBS1 P T7-RBS2 P T7 - RBS3 P T7 - RBS4 P T7-RBS5 P T7 - RBS6 Based on the sequence of strain EcNc01, upstream and downstream homologous arms (nucleotide sequences shown in SEQ ID NO.24, see Table 1) of the integration sites of the pre-promoter sites of the gmd and WcaG genes were designed. The pre-promoter sites of the gmd and WcaG genes were then replaced with the aforementioned promoter RBS combination. (See [reference needed]). Figure 1 The promoter expression cassette consists of four parts: promoter + RBS + gmd-WcaG + terminator. Constitutive integrative strains EcNc03, EcNc04, EcNc05, EcNc06, EcNc07, EcNc08, EcNc09, EcNc010, EcNc011, EcNc012, EcNc013, and EcNc014 were obtained to produce 2'-fucosylated lactose.

[0048] Table 1. Nucleotide sequences of primers, promoters, RBS, and homologous arms.

[0049] name nucleotide sequence LacY-F (SEQ ID NO.14) taagtataagaaggagatatacatatgatgtactatttaaaaaacacaaacttttgg LacY-R (SEQ ID NO.15) gcagcggtttctttaccagactcgagttaagcgacttcattcacctg <![CDATA[P 119 (SEQ ID NO.16)]]> TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC <![CDATA[P T7 (SEQ ID NO.17)]]> TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCC RBS1 (SEQ ID NO.18) GCTAACAGGAGGAATTAA RBS2 (SEQ ID NO.19) GTGATCAGACCTTTGTTTAACTTTAAAGGAGGTGATAAAA RBS3 (SEQ ID NO.20) GTGATCAGACCTTTGTTTAACTTTAAAGGAGGTGATAAAA RBS4 (SEQ ID NO.21) tctagagaaagaggagCCatactaa RBS5 (SEQ ID NO.22) tctagagattaaagaggagaaatactag RBS6 (SEQ ID NO.23) tctagagaaagaggagaaatactaa GWG (upstream and downstream homologous arms of the gmd and WcaG gene prepromoter integration sites, SEQ ID NO. 24) Ggttggaggtatcactcaggtcgccataatgcagatggaatttcgggttgcaggtgtgcggatcctgataaatgtgatccacgcgctcggtgttgaatgacgatgcacgacgcttaataccatgcacctcgtaa cctttttccagcagaaactctgccaggtaagaaccgtcttgtccggttacaccggtgatgagagcgacttttgacatttagtatttctcctctttctctagagctagcattatacctaggactgagctagctgt caAgtcttattcctctgtattttttgaatttattcagtttcaacgcgtttgcgtatcaccactgcTgggttcccccggcaaaccacatttgccggaagcgatttaaaaacactgcttcgcgcacccacgacggt gccgtcgccgatcgtgacgccaggggcaacaaagacatcggttgccagccagcatttctcgccaatcacaataggcgtggcgttaatggtgaaatgttgacttgcatggtcgtggctcccggtgcataaataac

[0050] 2.4 Verification of integrated strains through shake-flask fermentation

[0051] Single clones of the integrated strain were selected and inoculated into 2 mL of culture medium. The culture was carried out overnight at 37°C and 250 rpm for approximately 15 h to prepare a seed culture. 1 mL of the overnight seed culture was transferred to 50 mL of fermentation medium (with a final glucose concentration of 20 g / L) and cultured at 37°C and 250 rpm for approximately 8 h (OD of bacterial culture...). 600 Approximately 0.8%. Lactose was added to a final concentration of 12 g / L, and fermentation was continued at 28°C and 250 rpm for 72 h. After fermentation, the supernatant was collected by centrifugation. The supernatant was boiled at 100°C for 10 min, centrifuged again, diluted appropriately with purified water, and filtered through a 0.22 μm filter membrane. The content of 2'-fucosylated lactose was determined by liquid chromatography.

[0052] The seed culture medium was LB medium: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride. The shake flask fermentation medium consisted of: 20 g / L glucose, 5 g / L tryptone, 13.5 g / L KH2PO4, 4 g / L (NH4)2HPO4, 1.7 g / L citric acid, 0.3 g / L MgSO4·7H2O, 0.01 g / L CaCl2·H2O, and 0.01 g / L FeSO4·7H2O.

[0053] 2'-FL HPLC detection conditions: Agilent 1200 Series HPLC equipped with a refractive index detector (RID); column: BEH Amide 1.7 μm 100×2.1 mm; mobile phase: 70% acetonitrile aqueous solution; isocratic elution; flow rate: 1 mL / min; column temperature: 30℃.

[0054] 2.5 Results

[0055] See Table 2. Strain EcNc08 (EcNc02 contains promoter P) 119-RBS6 The highest 2'-FL yield was achieved with the constitutive promoter RBS combination P (-gmd-WcaG), reaching 0.95 g / L. 119-RBS6 The GDP-mannose-4,6-dehydrase gmd gene and the GDP-fucose synthase WcaG gene are co-expressed.

[0056] Table 2. 2'-FL production of the integrative strains

[0057] strain promoter Yield (g / L) EcNc01 / 0 EcNc02 / 0.11 EcNc03 <![CDATA[EcNc02 contains promoter P 119-RBS1- gmd-WcaG]]> 0.31 EcNc04 <![CDATA[EcNc02 contains promoter P 119-RBS2 -gmd-WcaG]]> 0.32 EcNc05 <![CDATA[EcNc02 contains promoter P 119-RBS3 -gmd-WcaG]]> 0.41 EcNc06 <![CDATA[EcNc02 contains promoter P 119-RBS4 -gmd-WcaG]]> 0.54 EcNc07 <![CDATA[EcNc02 contains promoter P 119-RBS5 -gmd-WcaG]]> 0.72 EcNc08 <![CDATA[EcNc02 contains promoter P 119-RBS6 -gmd-WcaG]]> 0.95 EcNc09 <![CDATA[EcNc02 contains promoter P T7-RBS1 -gmd-WcaG]]> 0.21 EcNc010 <![CDATA[EcNc02 contains promoter P T7-RBS2 -gmd-WcaG]]> 0.22 EcNc011 <![CDATA[EcNc02 contains promoter P T7-RBS3 -gmd-WcaG]]> 0.21 EcNc012 <![CDATA[EcNc02 contains promoter P T7-RBS4 -gmd-WcaG]]> 0.34 EcNc013 <![CDATA[EcNc02 contains promoter P T7-RBS5 -gmd-WcaG]]> 0.22 EcNc014 <![CDATA[EcNc02 contains promoter P T7-RBS6 -gmd-WcaG]]> 0.55

[0058] 3. Screening of promoters for co-expression of manB-manC genes in the de novo 2'-fucosylated lactose synthesis pathway

[0059] To enhance the intracellular fructose-6-phosphate to GDP-L-fucose synthesis pathway in strain EcNc08, promoter combinations co-expressing the phosphogmannase gene manB and the phosphogguanine transferase gene manC were screened.

[0060] 3.1 Screening of different promoters

[0061] Select a constitutive promoter P 119 and the inductive promoter P T7 and a series of RBS sequences, including P 119 - RBS1 P 119 - RBS2 P 119-RBS3 P 119 - RBS4 P 119 - RBS5 P 119-RBS6 P T7-RBS1 P T7-RBS2 P T7 - RBS3 P T7 - RBS4 P T7-RBS5 P T7 - RBS6 Design upstream and downstream fragments (nucleotide sequences shown in SEQ ID NO. 25, see Table 3) of the integration sites of the prepromoter sites of the manB and manC genes, construct homologous arms containing the upstream and downstream promoter combinations, and replace the promoters of the manB and manC genes with the aforementioned promoter RBS combinations. See [link to documentation]. Figure 2 The promoter expression cassette consists of four parts: promoter + RBS + manB-manC + terminator. Constitutive integrative strains EcNc015, EcNc016, EcNc017, EcNc018, EcNc019, EcNc020, EcNc021, EcNc022, EcNc023, EcNc024, EcNc025, and EcNc026 were obtained to produce 2'-fucosylated lactose. 2'-FL was detected by shake-flask fermentation; the fermentation process and detection methods were the same as before.

[0062] Table 3. Nucleotide sequences of upstream and downstream fragments at the integration site of the manB and manC gene pre-promoter.

[0063] name nucleotide sequence Sequences of upstream and downstream segments of the integration sites of the pre-promoter sites of the manB and manC genes (SEQ ID NO. 25) gcgacaataaagcggtgctgctcattgcaaatcaccaccgggctttcgcactccacgccgttcaggcggcagatggtggtttgcagcatggtgagatcgcctttcaggcataaaaactgcttggggtaaagtacgcgggaaagcggccataagcggctaccggagccacctgccatcacaactggatagagtttcgactgcgccatttagtaTTAATTCCTCCTGTTAGCctctagagctagcattatacctaggactgagctagctgtcaAaattatccccgaatatcatttataaattgacgtaacacgttctctttatcgagcgtgcgttcTgcatattcacgtgccaccgtgttgtgtttgggcagcaggaacgcctgacgaatccccgccaccagcgcctcgaccgattccggttccacgcaaaccgcaatgcccggaaaggtttcgcaaagctgccccagttctgtgtgggcttctgcggtaatcaccgcgttaccgcctaccgccagaatattggtcagtttcgacggc

[0064] 3.2 Results

[0065] See Table 4. Strain EcNc015 (EcNc08 contains promoter P) 119 - RBS1The highest yield was achieved with 2'-manB-manC), reaching 2.73 g / L, therefore the constitutive promoter RBS combination P was selected. 119 - RBS1 The gene manB, a phosphoromannase, and the gene manC, a phosphoroguanine transferase, are co-expressed.

[0066] Table 4. 2'-FL production of the integrative strain

[0067] Strain Promoter Yield (g / L) EcNc015 <![CDATA[EcNc08 contains the promoter P 119-RBS1 -manB-manC]]> 2.73 EcNc016 <![CDATA[EcNc08 contains the promoter P 119-RBS2 -manB-manC]]> 1.42 EcNc017 <![CDATA[EcNc08 contains the promoter P 119-RBS3 -manB-manC]]> 1.54 EcNc018 <![CDATA[EcNc08 contains the promoter P 119-RBS4 -manB-manC]]> 1.75 EcNc019 <![CDATA[EcNc08 contains the promoter P 119-RBS5 -manB-manC]]> 1.87 EcNc020 <![CDATA[EcNc08 contains the promoter P 119-RBS6 -manB-manC]]> 1.21 EcNc021 <![CDATA[EcNc08 contains the promoter P T7-RBS1 -manB-manC]]> 2.22 EcNc022 <![CDATA[EcNc08 contains the promoter P T7-RBS2 -manB-manC]]> 2.21 EcNc023 <![CDATA[EcNc08 contains promoter P T7-RBS3 -manB-manC]]> 2.34 [[ID= <![CDATA[EcNc08 contains the promoter P T7-RBS4 -manB-manC]]> 2.22 ​ <![CDATA[EcNc08 contains promoter P T7-RBS5 -manB-manC]]> 2.55 ​ <![CDATA[EcNc08 contains the promoter P T7-RBS6 -manB-manC]]> 2.03

[0068] 4. Screening of promoters for lacY and wcfB genes, key enzymes in 2'-fucosylated lactose synthesis.

[0069] To enhance the accumulation of 2'-fucosylated lactose in the EcNc015 strain and increase the expression of the lacY and wcfB genes, the plasmid pCDFDuet-lacY-wcfB was boosted with a promoter.

[0070] 4.1 Promoter selection

[0071] Select a constitutive promoter P 119 Combining with RBS sequences, including P 119 - RBS1 P 119-RBS2 P 119-RBS3 P 119-RBS4 P 119-RBS5 P 119-RBS6 Based on the selected P 119-RBS6 -gmd-WcaG and P 119 - RBS1 -manB-manC, construct constitutive integrative strains, see [link to promoter expression cassette] for details. ​ As shown in the diagram in Figure A: The expression box consists of 8 parts: P 119+RBS6 +gmd-WcaG+Terminator+P 119+RBS1 +manB-manC+ terminator.

[0072] Based on the upstream and downstream fragments of the prepromoter integration sites of the lacY and wcfB genes in plasmid pCDFDuet-lacY-wcfB, homologous arms containing upstream and downstream promoter combinations were designed. The promoters of the lacY and wcfB genes in the plasmid were then replaced with the aforementioned promoter RBS combination. See [link to relevant documentation]. ​ As shown in the schematic diagram of B: the plasmid consists of 6 parts: pRSF-P 119 +RBS+lacY -P 119+RBS+wcfB. Constitutive integrative strains EcNc027, EcNc028, EcNc029, EcNc030, EcNc031, EcNc032, EcNc033, EcNc034, EcNc035, EcNc036, EcNc037, EcNc038, EcNc039, EcNc040, EcNc041, EcNc042, and EcNc0 were obtained for the production of 2'-fucosylated lactose. 43, EcNc044, EcNc045, EcNc046, EcNc047, EcNc048, EcNc049, EcNc050, EcNc051, EcNc052, EcNc053, EcNc054, EcNc055, EcNc056, EcNc057, EcNc058, EcNc059, EcNc060, EcNc061 and EcNc062. Shake-flask fermentation was used to verify the yield of 2'-FL. The fermentation process and detection methods were the same as before.

[0073] 4.2 Results

[0074] See Table 5, strain EcNc029 (EcNc01P) 119-RBS6 -gmd-WcaGP 119+RBS1 The +manB-manCz plasmid contains P 119 - RBS1 -lacY and P 119 - RBS3 The highest yield was achieved with 2'-FL (-wcfB), reaching 5.03 g / L, therefore the RBS promoter combination P was chosen. 119-RBS1 Overexpression of the β-galactosidase lacY gene, promoter RBS combination P 119-RBS3 Overexpression of the α-1,2-fucosyltransferase wcfB gene.

[0075] Table 5. 2'-FL production of the integrative strains

[0076] ​ ​ ​ ​ <![CDATA[Promoter P 119-RBS1 -lacY and P 119-RBS1- wcfB]]> 3.78 ​ <![CDATA[Promoter P 119-RBS1 -lacY and P 119-RBS2 -wcfB]]> 3.42 ​ <![CDATA[Promoter P 119-RBS1 -lacY and P 119-RBS3 -wcfB]]> 5.03 ​ <![CDATA[Promoter P 119-RBS1 -lacY and P 119-RBS4 -wcfB]]> 4.42 ​ <![CDATA[Promoter P 119-RBS1 -lacY and P 119-RBS5 -wcfB]]> 4.54 ​ <![CDATA[Promoter P 119-RBS1 -lacY and P 119-RBS6 -wcfB]]> 4.75 ​ <![CDATA[Promoter P 119-RBS2 -lacY and P 119-RBS1 -wcfB]]> 4.87 ​ <![CDATA[Promoter P 119-RBS2 -lacY and P 119-RBS2 -wcfB]]> 4.21 ​ <![CDATA[Promoter P 119-RBS2 -lacY and P 119 - RBS3 -wcfB]]> 3.22 ​ <![CDATA[Promoter P 119-RBS2 -lacY and P 119-RBS4 -wcfB]]> 3.21 ​ <![CDATA[Promoter P 119-RBS2 -lacY and P 119-RBS5 -wcfB]]> 3.34 ​ <![CDATA[Promoter P 119-RBS2 -lacY and P 119-RBS6 -wcfB]]> 3.22 ​ <![CDATA[Promoter P 119 - RBS3 -lacY and P 119-RBS1 -wcfB]]> 4.21 ​ <![CDATA[Promoter P 119 - RBS3 -lacY and P 119-RBS2 -wcfB]]> 2.22 ​ <![CDATA[Promoter P 119 - RBS3 -lacY and P 119-RBS3 -wcfB]]> 3.21 ​ <![CDATA[Promoter P 119 - RBS3 -lacY and P 119-RBS4 -wcfB]]> 4.98 ​ <![CDATA[Promoter P 119 - RBS3 -lacY and P 119-RBS5 -wcfB]]> 4.47 ​ <![CDATA[Promoter P 119 - RBS3 -lacY and P 119-RBS6 -wcfB]]> 3.22 ​ <![CDATA[Promoter P 119-RBS4 -lacY and P 119-RBS1 -wcfB]]> 4.24 ​ <![CDATA[Promoter P 119-RBS4 -lacY and P 119-RBS2 -wcfB]]> 2.92 ​ <![CDATA[Promoter P 119-RBS4 -lacY and P 119-RBS3 -wcfB]]> 3.51 ​ <![CDATA[Promoter P 119-RBS4 -lacY and P 119-RBS4 -wcfB]]> 4.98 ​ <![CDATA[Promoter P 119-RBS4 -lacY and P 119-RBS5 -wcfB]]> 4.47 ​ <![CDATA[Promoter P 119-RBS4 -lacY and P 119-RBS6 -wcfB]]> 3.12 ​ <![CDATA[Promoter P 119-RBS5 -lacY and P 119-RBS1 -wcfB]]> 4.25 ​ <![CDATA[Promoter P 119-RBS5 -lacY and P 119-RBS2 -wcfB]]> 3.22 ​ <![CDATA[Promoter P 119-RBS5 -lacY and P 119-RBS3 -wcfB]]> 4.21 ​ <![CDATA[Promoter P 119-RBS5 -lacY and P 119-RBS4 -wcfB]]> 2.22 ​ <![CDATA[Promoter P 119-RBS5 -lacY and P 119-RBS5 -wcfB]]> 3.21 ​ <![CDATA[Promoter P 119-RBS5 -lacY and P 119-RBS6 -wcfB]]> 4.95 ​ <![CDATA[Promoter P 119-RBS6 -lacY and P 119-RBS1 -wcfB]]> 4.07 ​ <![CDATA[Promoter P 119-RBS6 -lacY and P 119-RBS2 -wcfB]]> 3.02 ​ <![CDATA[Promoter P 119-RBS6 -lacY and P 119-RBS3 -wcfB]]> 4.21 ​ <![CDATA[Promoter P 119-RBS6 -lacY and P 119 - RBS4 -wcfB]]> 2.22 ​ <![CDATA[Promoter P 119-RBS6 -lacY and P 119-RBS5 -wcfB]]> 3.21 ​ <![CDATA[Promoter P 119-RBS6 -lacY and P 119-RBS6 -wcfB]]> 4.37

[0077] Example 2: Screening and construction of integration sites in 2'-fucosylation-lactose genome-forming engineered bacteria

[0078] In the original strain *Escherichia coli* EcNc ΔattB(lacUV5-T7)ΔendAΔompTΔlacZΔwcaJ, based on CRISPR / Cas9 gene editing technology, the Cas9 fragment was ligated with the NcoI / XhoI double-digested fragment of the pKD46 plasmid using a homologous recombination kit (Pro Ligation-Free Cloning Kit, abm, catalog number E086) to construct the pKD-Cas9 plasmid.

[0079] Genes nudD, mtlD, mdfA, poxB, ompT, and pfkA were designed. The sgRNA nucleotide sequence of nudD is shown in SEQ ID NO.26, the sgRNA nucleotide sequence of mtlD is shown in SEQ ID NO.27, the sgRNA nucleotide sequence of mdfA is shown in SEQ ID NO.28, the sgRNA nucleotide sequence of poxB is shown in SEQ ID NO.29, the nucleotide sequence of ompT is shown in SEQ ID NO.30, and the nucleotide sequence of pfkA is shown in SEQ ID NO.31. The above nucleotide sequences are detailed in Table 6. The Donor sequence was cloned into the gene editing vector Donor plasmid.

[0080] Table 6 sgRNA nucleotide sequence

[0081] ​ ​ ​ ​ ​ ggcgcgctgccgaacatcccagg mdfA - sgRNA (SEQ ID NO.28) GTGGCGGGGGCGCTGGCGCT PoxB - sgRNA (SEQ ID NO.29) tgaataattttggcatcggtcgg ompT - sgRNA (SEQ ID NO.30) GTAGATATAGGAACCCCCTC pfkA - sgRNA (SEQ ID NO.31) ACGGCCCATCACTTCCACCA

[0082] 1. Specific experimental procedure

[0083] A) Preparation of electrocompetent cells of strain EcNc ΔattB(lacUV5-T7)ΔendAΔompTΔlacZΔwcaJ.

[0084] B) Transform the pKD-Cas9 plasmid into EcNc ΔattB(lacUV5-T7)ΔendAΔompTΔlacZΔwcaJ cells, spread the bacterial culture onto kanamycin-resistant plates, and incubate at 30°C.

[0085] C) The next day, single clones were selected for PCR verification, and positive clones were used to prepare electrocompetent cells, named EcN-Cas9.

[0086] D) Design P 119 - RBS1 -lacY-P 119 - RBS3 The upstream and downstream homologous arms of the -wcfB gene overlap with the upstream and downstream homologous arms of the nudD gene. Using PCR recombination technology, pUC-sgRNA-nudD and the site ΔnudD::P were recombinated. 119 - RBS1 -lacY-P 119 - RBS3 The -wcfB upstream and downstream homologous arm fragments were transformed into EcN-Cas9 cells, and the bacterial culture was plated onto Kan+Spec resistant plates and incubated at 30°C.

[0087] E) The next day, single clones were selected for expansion culture, and the target gene fragments were amplified using primers, and identified by agarose gel electrophoresis and sequencing.

[0088] F) Using the same strategy described above, construct pUC-sgRNA-ΔmtlD::P 119-RBS1 -lacY-P 119 - RBS3 -wcfB、pUC-sgRNA-mdfA::P 119 - RBS1 -lacY-P 119 - RBS3 -wcfB、pUC-sgRNA-poxB::P 119 - RBS1 -lacY、pUC-sgRNA-poxB::P 119 - RBS3 -wcfB、pUC-sgRNA-ompT::P 119 - RBS3 -wcfB and pUC-sgRNA-pfkA::P 119 - RBS3 Enter the -wcfB fragment.

[0089] G) Using positive clones as templates, primers nudD-F / R, mtlD-F / R, mdfA-F / R, poxB-F / R, ompT-F / R, and pfkA-F / R (nucleotide sequences shown in SEQ ID NO.32 to SEQ ID NO.44, see Table 7) were used to amplify the upstream and downstream sequences of the gene knockout sites nudD, mtlD, mdfA, poxB, ompT, and pfkA. Correct bands were recovered by agarose gel electrophoresis and sequenced to verify that the knockout fragment sequence was consistent with the Donor fragment.

[0090] Table 7 Primer nucleotide sequences

[0091] Name Nucleotide sequence nudD - F (SEQ ID NO.32) agtaacagctcatcttccgct nudD - R (SEQ ID NO.33) gcgttgactgcactatccga mtlD - F (SEQ ID NO.34) gtcgtgttctgccagtacccgga mtlD - R (SEQ ID NO.35) ctctacctgtttcggacgataaagct mdfA - F (SEQ ID NO.36) cgacaaagggtcggtcgt mdfA - R (SEQ ID NO.37) taatttccgcgaattatgcagcc PoxB - F (SEQ ID NO.38) gatgagtggcgtaactatccgg PoxB - R (SEQ ID NO.39) cagactgagtaatttggtgcggg ompT - F (SEQ ID NO.40) gtggctccgtatagagttccatc ompT - R (SEQ ID NO.41) tgctaaacaattcatcttgccagg [[ID=No.31]]pfkA - F (SEQ ID NO.42) ggcggtgcgggctgatat pfkA - R (SEQ ID NO.43) gcattcagcgcccactgg

[0092] To increase 2'-FL production, the effect of target fragment copy number on 2'-FL production in constitutively integrated strains was investigated. On chassis strains, the target fragment P was sequentially knocked into the nudD, mtlD, mdfA, poxB, ompT, and pfkA sites. 119 - RBS1 -lacY-P 119 - RBS3 -wcfB、P 119 - RBS1 -lacY and / or P 119 - RBS3 -wcfB, and attempt to knock in different proportions of the target fragment. That is, knock in P at multiple sites on the strain genome. 119 - RBS1 -lacY-P119 - RBS3 -wcfB,P 119 - RBS1 -lacY and / or P 119 - RBS3 -wcfB controls P 119 - RBS1 -lacY-P 119 - RBS3 -wcfB,P 119 - RBS1 -lacY and / or P 119 - RBS3 The proportion of -wcfB was used to obtain constitutive integrative strains EcNc063, EcNc064, EcNc065, EcNc066, EcNc067, EcNc068, and EcNc069 for the production of 2'-fucosylated lactose. Fermentation and detection of 2'-FL content were performed using the same fermentation process and detection methods as in Example 1.

[0093] 2. Results

[0094] See Table 8. Figure 4 It was found that in constitutively integrated strains, knocking in the target fragment P... 119 - RBS1 -lacY-P 119 - RBS3 When the -wcfB ratio is controlled at 2 copies, the 2'-FL yield is high, reaching 5.05 g / L, and the target fragment P... 119 - RBS1 Further increases in the lacY copy number will suppress the accumulation of 2'-FL, while the target fragment P 119 - RBS3 Increased -wcfB copy number contributes to increased 2'-FL production. That is, for constitutively integrated strains, strain EcNc068 (EcNc01 P) 119-RBS6 -gmd-WcaG::P 119-RBS1 -manB-manCΔnudD::P 119-RBS1 -lacY-P 119-RBS3 -wcfBΔmtlD::P 119-RBS1 -lacY-P 119-RBS3 -wcfB:ΔpoxB::P 119-RBS3 -wcfBΔompT::P 119-RBS3 When the ratio of knock-in lacY and wcfB genes was controlled at 2:4, the yield of 2'-FL was the highest, reaching 5.48 g / L in shake-flask fermentation.

[0095] Table 8. Knock-in sites and 2'-FL yield of integrative strains

[0096] Strain number EcNc063 EcNc064 EcNc065 EcNc066 EcNc067 EcNc068 EcNc069 <![CDATA[P 119-RBS1 -lacY]]> 1 2 3 3 2 2 2 <![CDATA[P 119-RBS3 -wcfB]]> 1 2 3 2 3 4 5 nudD △ △ △ △ △ △ △ mtlD △ △ △ △ △ △ mdfA △ poxB △ △ △ △ ompT △ △ pfkA △ Yield g / L 4.89 5.05 4.76 4.81 5.16 5.48 5.02

[0097] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A production method of a recombinant Escherichia coli for producing 2-fucosyllactose (2'-FL), characterized by, The method comprises modifying the genome of the probiotic E. coli EcNc ΔattB(lacUV5-T7) ΔendA ΔompT cell, which modification comprises knocking out key enzyme genes of the 2'-FL bypass catabolic pathway and knocking in key enzyme genes of the 2'-FL synthetic pathway.

2. The production method according to claim 1, characterized by, The genome modification of the probiotic E. coli EcNc ΔattB(lacUV5-T7) ΔendA ΔompT comprises knocking out the undecaprenyl-phosphate-1-phosphotransferase gene wcaJ and the beta-galactoside permease gene lacZ; and knocking in the alpha-1,2-fucosyltransferase gene wcfB, the beta-galactoside permease gene lacY, the phosphomannomutase gene manB, the phosphoguanosine transferase gene manC, the GDP-mannose-4,6-dehydratase gene gmd and the GDP-fucose synthase gene WcaG.

3. The production method according to claim 2, characterized by, The lacY, wcfB, manB, manC, gmd and WcaG genes are overexpressed in the expression cassettes formed by inducible or constitutive promoters and RBSs on the genome.

4. The production method according to claim 3, characterized by, The constitutive promoter and RBS are composed of P 119 Composed of RBS1~RBS6, the inducible promoter and RBS are composed of P T7 It consists of RBS1~RBS6; among which, promoter P 119 The sequence is shown in SEQ ID NO.16, promoter P T7 The sequence is shown in SEQ ID NO.17, and the sequences of RBS1 to RBS6 are shown in SEQ ID NO.18 to SEQ ID NO.23, respectively.

5. The preparation method according to claim 4, characterized in that, Preferably, the wcfB gene and the lacY gene are overexpressed with P 119-RBS3 and P 119-RBS1 , respectively. Preferably, the manB gene and the manC gene are overexpressed with P 119-RBS1 and P 119-RBS6 , respectively.

6. The preparation method according to claim 3, characterized in that, One or more of the nudD, mtlD, mdfA, poxB, ompT and pfkA genes on the genome are knocked in with the lacY and / or wcfB genes; preferably, the lacY gene and the wcfB gene are knocked in at the nudD, mtlD and mdfA gene sites on the genome; preferably, the wcfB gene is knocked in at the poxB, ompT and pfkA gene sites on the genome; preferably, the lacY gene is knocked in at the pfkA and mdfA gene sites on the genome; preferably, the copy number and ratio of the knocked-in lacY gene and wcfB gene are different on the genome.

7. The production method according to claim 6, wherein The number of knocked-in lacY genes is not more than 2, and the number of knocked-in wcfB genes is not more than 6.

8. The preparation method according to claim 6, characterized in that, The ratio of the knocked-in lacY gene and wcfB gene is 1-2:1-6; preferably, the ratio of the knocked-in lacY gene and wcfB gene is 2:

4.

9. A recombinant probiotic E. coli prepared by the method of any one of claims 1-8.

10. Use of the recombinant E. coli prepared by the method of any one of claims 1-8 in the production of 2'-fucosyllactose.

Images