Molecular marker for major QTL (Quantitative Trait Loci) of row number of corn ears and application of molecular marker

Abstract

The invention discloses a molecular marker of major QTL (Quantitative Trait Loci) of the row number of corn ears and application of the molecular marker, the molecular marker is named as qKRN10, and the molecular marker is anchored in an interval of 84.15 Mb to 85.74 Mb on the 10 # chromosome of corn. The molecular marker qKRN10 of the major QTL is finely positioned to an interval of 1.59 Mb by constructing an advanced backcross group taking Y1648 and Y2328 as a recurrent parent and a donor parent respectively, and candidate gene association analysis finds that the area is significantly related to the ear row number. LD analysis finds that a 360Kb linkage region exists in the interval and comprises six genes, and non-synonymous mutation exists in three of the six genes. And further through annotation information and expression mode analysis, the GRMZM2G005126 is determined as a candidate gene for regulating and controlling the KRN. The invention provides a molecular target and a gene resource for improvement of corn yield traits.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology for crops, specifically relating to a molecular marker for a major QTL of maize ear row number and its application. Background Technology

[0002] Maize is one of my country's major food crops, playing a vital role in ensuring national food security and alleviating the energy crisis. Ear row number is an important component trait of maize yield. Understanding the genetic basis of ear row number and identifying candidate genes is crucial for improving maize yield using molecular breeding methods.

[0003] Currently, numerous quantitative trait loci controlling ear row number (KRN) have been identified across the entire maize genome using various genetic populations. For example, qKRN5.04 ​​is located on chromosome 5, within the range of 136.3 Mb to 140.0 Mb. qKRN8 is located on chromosome 8, and qKRN10 is located on chromosome 10, explaining 25.8% of the phenotypic variation and serving as the major QTL. However, the number of cloned QTLs is currently limited. KRN1 corresponds to an existing gene (ids1 / Ts6) encoding an AP2 domain protein, a homologous product of the key wheat domestication gene Q. KRN4 regulates maize KRNs by cis-regulating UB3 expression.

[0004] Therefore, a molecular marker for the major effect of maize ear row number QTL and its application are urgently needed. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a molecular marker for a major QTL related to the number of rows in a maize ear and its application.

[0006] To solve the above-mentioned technical problems, the present invention provides the following technical solution:

[0007] The first objective of this invention is to provide a molecular marker for a major QTL of maize ear row number, the molecular marker being named qKRN10, which is anchored in the interval of 84.15 Mb to 85.74 Mb on maize chromosome 10.

[0008] The second objective of this invention is to provide a specific primer pair for obtaining a molecular marker for the major-effect QTL of maize ear row number, the nucleotide sequence of which is as follows:

[0009] Mark p84.15:

[0010] The forward primer sequence is shown in SEQ ID NO. 7: AAGAACAGTACAGGCGGTGA;

[0011] The reverse primer sequence is shown in SEQ ID NO. 8: ACACGAGAAGCAGGCATAGG;

[0012] Mark p85:

[0013] The forward primer sequence is shown in SEQ ID NO. 9: TTCCCGAACGAAGAAATTAGCC;

[0014] The reverse primer sequence is shown in SEQ ID NO. 10: TTATGCTGTTGGGAGGTCGTTA.

[0015] The third objective of this invention is to provide a molecular marker for a major QTL on the number of rows in maize ears for use in the localization of genes regulating the number of rows in maize ears.

[0016] Preferably, the gene regulating the number of rows in a maize ear is gene GRMZM2G005126.

[0017] The fourth objective of this invention is to provide a molecular marker for the major effect of maize ear row number QTLs in the screening and identification of maize ear row number germplasm resources.

[0018] Preferably, the molecular markers are used in assisted breeding.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] This invention constructs a high-generation backcross population with Y1648 and Y2328 as the recurrent and donor parents, respectively, and finely maps the major-effect QTL marker qKRN10 to a 1.59 Mb region. Candidate gene association analysis revealed that this region is significantly correlated with the number of ear rows. LD analysis found a 360 Kb linkage region within this region, containing six genes, three of which have non-synonymous mutations. Further analysis of annotation information and expression patterns identified GRMZM2G005126 as a candidate gene regulating KRN. This invention provides molecular targets and gene resources for improving maize yield traits. Attached Figure Description

[0021] Figure 1 A represents the linkage analysis results of the Pop1730 population in this invention;

[0022] Figure 1 B is a schematic diagram of the qKRN10 of the present invention positioned between markers umc1712 and umc2348;

[0023] Figure 1 C is a schematic diagram of the fine positioning of the qKRN10 of the present invention between p84.15 and p85;

[0024] Figure 2 A in the diagram is the Manhattan plot of the qKRN10 candidate gene association analysis of this invention;

[0025] Figure 2 B is a schematic diagram of the chain imbalance between the peak SNPs and the surrounding SNPs in this invention.

[0026] Figure 2 C is a schematic diagram illustrating the selection of Gene2-GRMZM2G005126 as a candidate gene based on gene location and gene annotation in this invention.

[0027] Figure 3 A is a schematic diagram comparing the KRN of NIL3_Y1648 and NIL3_Y2348 in this invention;

[0028] Figure 3 In the middle B, the number of genes upregulated (blue) and genes downregulated (orange) between NIL3_Y1648 and NIL3_Y2348 in this invention is represented.

[0029] Figure 3 C is a schematic diagram of the distribution of differentially expressed genes on chromosomes in this invention;

[0030] Figure 4 A in the diagram represents the Manhattan plot and LD heatmap of the candidate gene association analysis in this invention.

[0031] Figure 4 B represents the base arrangement of the four haplotypes in this invention;

[0032] Figure 4 C is a schematic diagram comparing the KRN differences of the four haplotypes in this invention. Detailed Implementation

[0033] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the preferred embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0034] Example 1: Population construction and trait survey.

[0035] Y2348 and Y1648 are inbred lines that have significant differences in the number of panicle rows (KRN), with KRNs of 22-24 rows and 10-12 rows, respectively.

[0036] The BC5F1 population served as the starting material for fine mapping. First, heterozygous F1 plants were obtained by crossing Y1648 with Y2348. Then, five consecutive backcrosses (BC1 to BC5) were performed using F1 as the male parent and the recurrent parent Y1648 as the female parent. During each backcross, strict dual marker-assisted selection was implemented: ① Foreground selection: using the two wing markers B5 and umc1077 determined during the initial mapping to ensure that the target region (qKRN10) controlling the number of ear rows remained heterozygous; ② Background selection: using SSR markers covering the entire genome for scanning, the single plants with the highest genome background recovery rate (usually >85%) from the recurrent parent were preferentially selected for the next backcross. After five rounds of directional selection, BC5F1 single plants with heterozygous target regions and a genome-wide background recovery rate exceeding 95% were finally obtained, minimizing interference from non-target genetic backgrounds.

[0037] The BC5F2 population was obtained by self-pollinating the ideal BC5F1 individuals selected above. In this population, chromosome segments within the target region undergo segregation and recombination. Genotyping of the entire population was performed using the B5 and umc1077 markers to screen for individuals that remained heterozygous within the target region. These individuals will continue to segregate within the target region in their self-pollinated progeny, forming the basis for subsequent capture of key recombination events.

[0038] BC5F 2:3 The population was constructed by self-pollinating heterozygous individuals selected from the target interval in BC5F2 to create a BC5F3 population of 182 families. Each family was planted in a single row, and the phenotypic value of the family was obtained by measuring the number of ear rows (KRN) of five uniformly identical individuals and taking the average value. The intervals were further narrowed using bnlg1712 and umc2348.

[0039] The BC5F4 population was developed by screening existing BC5F3 materials and their derivative populations using markers P84.15 and P85 to identify seven new recombinant plants exhibiting crossover within a new interval. These BC5F3 recombinant plants were then self-pollinated to obtain their BC5F4 populations. 3:4 The family lineage is collectively referred to as BC5F4 generation material.

[0040] Example 2: Chain analysis and fine positioning.

[0041] First, the initial positioning of qKRN10.

[0042] BC5F constructed using Y2348 and Y1648 2:3The population was analyzed using SSR and Indel markers as genotypic data. First, linkage analysis of the SSR markers was performed using the MAP function in IciMapping V4.1 software. Then, the BIP function was used for initial localization of qKRN10, with all parameters set to default values. Based on linkage analysis, the major-effect QTL qKRN10 was located between the B5 and umc2348 markers. The LOD value, phenotypic variance explained (PVE), and additive effect (ADD) of qKRN10 were 13.13%, 28.90%, and 0.59%, respectively. Figure 1 A).

[0043] Second, the precise positioning of qKRN10.

[0044] Following the QTL fine mapping method, recombinant individuals were first screened in the BC5F1 population using B5 and umc1077 markers. Then, new SSR markers were designed to confirm genotypes. In each generation, the recombinant individuals were self-crossed to produce homozygous recombinant individuals. The donor and recurrent parent fragments carried by the recombinant individuals were compared, and significant differences in KRN levels among different individuals were also compared to narrow down the candidate regions based on significance tests. The primer (marker) information used in this embodiment is as follows:

[0045] Marker B6 (physical location 74478086):

[0046] The forward primer sequence is: TACTGTGGTTCACAGCACGC (as shown in SEQ ID NO. 1);

[0047] The reverse primer sequence is: GAAAGAAGCTGGACGAAACG (sequence shown in SEQ ID NO. 2);

[0048] Marker B5 (physical location 81714218):

[0049] The forward primer sequence is: GGGTTCTGTTATGTGTTATGGGT (as shown in SEQ ID NO. 3);

[0050] The reverse primer sequence is: ACACGGAAACAGAAAGCGA (sequence shown in SEQ ID NO. 4);

[0051] Marker umc1712 (physical location 83547624):

[0052] The forward primer sequence is: GTTACACTCCCCTGCCAAAA (as shown in SEQ ID NO. 5);

[0053] The reverse primer sequence is: CTCAGGCTTCACGTGGGTTT (sequence shown in SEQ ID NO. 6);

[0054] Mark p84.15 (physical location 84159760):

[0055] The forward primer sequence is: AAGAACAGTACAGGCGGTGA (sequence shown in SEQ ID NO. 7);

[0056] The reverse primer sequence is: ACACGAGAAGCAGGCATAGG (sequence shown in SEQ ID NO. 8);

[0057] Mark p85 (physical location 85744790):

[0058] The forward primer sequence is: TTCCCGAACGAAGAAATTAGCC (as shown in SEQ ID NO. 9);

[0059] The reverse primer sequence is: TTATGCTGTTGGGAGGTCGTTA (sequence shown in SEQ ID NO. 10);

[0060] Mark p89 (physical location 89419635):

[0061] The forward primer sequence is: TACTGCTGCCGCACTACTATTCT (as shown in SEQ ID NO. 11);

[0062] The reverse primer sequence is: TCGAGGCCCTCTGGACTCT (sequence shown in SEQ ID NO. 12);

[0063] Marker umc2348 (physical location 93268054):

[0064] The forward primer sequence is: AGTCAGACCGACGCACTCACTAA (as shown in SEQ ID NO. 13);

[0065] The reverse primer sequence is: TAACATCATCATCAGCGACGATTT (as shown in SEQ ID NO. 14);

[0066] Marker SSR1430 (physical location 95345501):

[0067] The forward primer sequence is: ATGGATGTTAGCGCAATAAA (as shown in SEQ ID NO. 15);

[0068] The reverse primer sequence is: TACTGTTGCTGCTAGGCTTC (as shown in SEQ ID NO. 16);

[0069] Marker umc1077 (physical location 102687610):

[0070] The forward primer sequence is: CAGAGACTCTCCATTATCCCTCCA (as shown in SEQ ID NO. 17);

[0071] The reverse primer sequence is: CAGCCACAGTGAGGCACATC (sequence shown in SEQ ID NO. 18);

[0072] Marker C1 (location: 126885747):

[0073] The forward primer sequence is: CCTGACAGACCTGCAGATAGGGT (as shown in SEQ ID NO. 19).

[0074] The reverse primer sequence is: ATCGAGGGGCTAATCAGCAAG (sequence shown in SEQ ID NO. 20).

[0075] In the BC5F2 population, exchangeable individuals were selected using end markers B6 and C1. These exchanged individuals were then used to self-pollinate the resulting BC5F2 population. 2:3 To achieve fine-grained positioning, the QTL range was narrowed down to umc1712-umc2348. Figure 1 B). By analyzing BC5F 2:3 The segregation of the population was analyzed using homozygous exchange single plants to narrow down the QTLs to between umc1712 and p85. Finally, by developing the molecular marker p84.15, qKRN10 was located between p84.15 and p85. Figure 1 C), the length of this interval is 1.59 Mb.

[0076] Example 3: Candidate gene association analysis.

[0077] Association analysis was performed on the candidate interval qKRN10 using a population of 368 maize inbred lines. All SNPs located within the qKRN10 interval were screened from 560,000 SNP markers covering the entire maize genome. The best linear unbiased prediction (BLUP) of the population's KRNs was used to perform candidate gene association analysis using the General Linear Model (GLM) in Tassel 5.0 software (results are shown in Table 1).

[0078] A total of 80 SNPs fell within the qKRN10 interval. Based on the phenotypic data of KRN in the associated population, 11 significant SNPs were identified (P < 10). -4 () Figure 2 A), furthermore, LD analysis showed linkage disequilibrium between the peak SNP and surrounding SNPs (R² > 0.2). This LD region was 360 Kb and contained 6 genes: GRMZM2G005024, GRMZM2G005126, GRMZM2G170291, GRMZM2G133529, GRMZM2G022793, and GRMZM5G845163. Figure 2 B).

[0079] Table 1: Candidate gene association analysis.

[0080]

[0081] Example 4: RNA sequencing and analysis.

[0082] In the BC5F4 population, recombinant lines heterozygous for the target region and with a genetic background of Y1648 were selected for self-pollination. Two near-isogenic lines homozygous for the target region were isolated from the self-pollination progeny. RNA was extracted from the female ear primordia of the two near-isogenic lines at the V9 stage and sequenced using the Illumina novaseq platform. All cleaned reads were mapped to the maize B73 AGP v3.27 reference genome using Tophat2 2.1.0. Transcriptome and gene expression level analyses were performed using Cufflinks and Cuffdiff software. Reads with a quality score below 50 were filtered out using SAMtools v0.2. The filtered reads were then used to calculate FPKM values ​​to assess gene expression levels using the R package DESeq2. Genes satisfying |Log2FoldChange| ≥ 2 and with FDR-corrected P < 0.01 were defined as differentially expressed genes (DEGs).

[0083] Example 5: Linkage disequilibrium analysis and haplotype analysis.

[0084] Based on genotypic data from associated populations, 80 SNPs were identified within the qKRN10 region. A linkage disequilibrium (LD) heatmap for this region was plotted using the R package snp.plotter. Significant SNP sites were identified through candidate gene association analysis, and haplotype analysis was performed using BLUP values ​​of KRNs from the associated populations. Tukey multiple comparisons were used to test for differences in KRNs between different haplotypes.

[0085] First, screening of candidate genes that regulate maize KRN.

[0086] To further identify candidate genes regulating maize KRN, transcriptome analysis was performed on the female ear primordia at the V9 stage of two near-isogenic lines, NIL3_Y1648 and NIL3_Y2348, which showed significant differences in KRN. Figure 3 A), identifying 735 differentially expressed genes (DEGs). Specifically, compared to NIL_Y2348, 87 upregulated genes and 648 downregulated genes were identified in NIL3_Y1648. Figure 3 B). These genes are distributed across 10 chromosomes, with the most significant differentially expressed genes on chromosome 10 ( Figure 3 (C) This indicates that after continuous backcrossing and self-crossing, the background gene expression differences between the two near-isogenic lines were greatly reduced, and the genetic differences mainly originated from the target region. Combined with the candidate gene association analysis results, we found significant SNPs in three genes, which led to missense mutations (Table 1). Among them, GRMZM2G005126 was highly expressed in the 1 mm female spike primordia, and its expression level began to decrease when the spikelet developed to 6-8 mm. Its expression pattern was closely related to KRN development. Therefore, GRMZM2G005126 was preliminarily identified as a candidate gene regulating KRN.

[0087] Second, candidate gene haplotype analysis.

[0088] Candidate gene association analysis showed that a total of 6 SNPs were significantly associated with KRN (P < 10). -3 Of these, three are located on the exon of GRMZM2G005126, one on the intron, and two on the promoter region. The SNP located on the exon is in linkage disequilibrium with the two upstream SNPs. Figure 4 A). Four haplotypes were identified using six SNPs (each haplotype contained at least 10 inbred lines). Figure 4 B). Comparing KRNs among different haplotypes, it was found that the Hap4 haplotype had the most KRNs ( Figure 4C) is an excellent haplotype. Maize inbred lines carrying this haplotype can provide germplasm resources for improving maize ear traits and further increasing maize yield.

[0089] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A molecular marker for a major QTL of ear row number, characterized in that, The molecular marker is named as qKRN10, which is anchored to the interval of 84.15 Mb to 85.74 Mb on chromosome 10 of maize.

2. A specific primer pair of a molecular marker for obtaining the ear row number major QTL according to claim 1, characterized in that, The nucleotide sequences of the specific primer pairs are as follows: Marker p84.15: The sequence of forward primer is shown in SEQ ID NO. 7: AAGAACAGTACAGGCGGTGA; The sequence of reverse primer is shown in SEQ ID NO. 8: ACACGAGAAGCAGGCATAGG; Marker p85: The sequence of forward primer is shown in SEQ ID NO. 9: TTCCCGAACGAAGAAATTAGCC; The sequence of reverse primer is shown in SEQ ID NO. 10: TTATGCTGTTGGGAGGTCGTTA.

3. The application of the molecular marker of the maize ear row number major QTL in claim 1 in the regulation of maize ear row number gene positioning.

4. Use according to claim 3, characterized in that, The regulation of maize ear row number gene is gene GRMZM2G005126.

5. The application of the molecular marker of the maize ear row number major QTL in claim 1 in screening and identifying maize ear row number germplasm resources.

6. Use according to claim 5, characterized in that, The application of the molecular marker in assisted breeding.

Images