Human neutralizing monoclonal antibodies against pseudomonas aeruginosa

Abstract

The present disclosure relates to antibodies against Pseudomonas aeruginosa or antigen-binding fragments thereof, pharmaceutical compositions comprising such antibodies or antigen-binding fragments thereof, kits comprising such antibodies or antigen-binding fragments thereof, and antibodies or antigen-binding fragments thereof, pharmaceutical compositions and kits for use as medicaments and for the treatment or prevention of diseases caused by Pseudomonas aeruginosa. The disclosure also relates to methods of treating, preventing or reducing the severity of Pseudomonas aeruginosa infection, and to nucleic acids encoding such antibodies or antigen-binding fragments thereof, expression vectors comprising such nucleic acids, host cells comprising such nucleic acids or expression vectors, and methods of producing such antibodies or antigen-binding fragments thereof.

Description

Technical Field

[0001] This invention relates to Pseudomonas aeruginosa ( Pseudomonas aeruginosa The invention relates to antibodies or antigen-binding fragments thereof, pharmaceutical compositions comprising such antibodies or antigen-binding fragments thereof, kits comprising such antibodies or antigen-binding fragments thereof, and antibodies or antigen-binding fragments thereof, pharmaceutical compositions, and kits for use as medicines and for treating or preventing diseases caused by *Pseudomonas aeruginosa*. The invention also relates to methods for treating, preventing, or reducing the severity of *Pseudomonas aeruginosa* infections, and to nucleic acids encoding such antibodies or antigen-binding fragments thereof, expression vectors comprising such nucleic acids, host cells comprising such nucleic acids or expression vectors, and methods for producing such antibodies or antigen-binding fragments thereof. Technical Background Antimicrobial resistance is becoming a global threat, leading to a continuous rise in morbidity and mortality worldwide. A gap in innovation and discovery exacerbates this situation, resulting in a severe shortage of antimicrobial active substances. To meet the global demand for therapeutic activity against drug-resistant bacteria, alternative solutions are urgently needed, such as antibody- or phage-based therapies, as well as antiviral or host-guided drugs.

[0003] Over the past two decades, numerous studies have confirmed the therapeutic potential of neutralizing antibodies against viral infections. Among these, broad-spectrum neutralizing antibodies (bNAbs) have been primarily identified through comprehensive evaluation of antigen-reactive B cells derived from infected, recovered, or vaccinated individuals. However, despite the development of numerous antibodies targeting viral pathogens, antibody-mediated therapies against bacterial pathogens have been largely unsuccessful, with only a limited number of antibodies identified as effectively neutralizing bacterial pathogens.

[0004] Pseudomonas aeruginosa (hereinafter also referred to as) P. aeruginosa Pseudomonas aeruginosa (or P. aeruginosa) is a Gram-negative pathogen that commonly causes serious nosocomial infections, including pneumonia and sepsis. Due to its extensive intrinsic and extrinsic resistance mechanisms, P. aeruginosa is classified as a major public health threat by both the U.S. Centers for Disease Control and Prevention (CDC) and the World Health Organization (WHO). In addition to acute infections, P. aeruginosa can also cause chronic infections, such as in patients with structural lung diseases like chronic obstructive pulmonary disease (COPD) or cystic fibrosis (CF), a monocausative disease determined by mutations in the cystic fibrosis transmembrane conduction regulator (CFTR). In this disease, decreased mucociliary clearance in the bronchial system and the production of nutrient-rich, highly viscous airway mucus provide ideal growth conditions for opportunistic pathogens such as P. aeruginosa.

[0005] The key virulence factor of *Pseudomonas aeruginosa* is the type III secretion system (T3SS), a syringe-like multiprotein structure that injects effector toxins such as ExoS and ExoU into the host cell cytoplasm, leading to cell lysis and tissue damage. T3SS is associated with bacterial persistence, higher relapse rates, and increased mortality in infected patients. The pentamer structural protein PcrV constitutes the T3SS needle tip complex, which is required for the proper assembly of the PopB / D translocation complex and its insertion into the host cell membrane. Given that the immunogenicity of PcrV has been known for decades, several studies have focused on inhibiting *P. aeruginosa* virulence through antibody-mediated PcrV functional abolition, such as US 2005 / 0063985 A1, US 2013 / 0108627 A1, and the study by DiGiandomenico (DiGiandomenico et al., 2014).

[0006] The safety, efficacy, and pharmacokinetics of the anti-PcrV monoclonal antibody developed by DiGiandomenico A et al. were evaluated in a clinical trial. The results showed that the anti-PcrV monoclonal antibody did not reduce the incidence of hospital-acquired pneumonia caused by P. aeruginosa in mechanically ventilated patients infected with P. aeruginosa. Previous work relied on mouse immunization to generate PcrV-specific antibody sequences, while in-depth research into the human B cell response to PcrV and subsequent development of patient-derived high- and neutralizing antibodies using B cell libraries remains a gap.

[0007] Since Pseudomonas aeruginosa can persist in the airways of people with CF (pwCF) for many years, it is speculated that repeated antigen exposure in these patients may promote a high-affinity maturation of adaptive immune responses, thereby enabling the development of antibodies that can effectively inhibit the virulence of Pseudomonas aeruginosa.

[0008] Therefore, there is an urgent need to develop fully human monoclonal antibodies that can strongly inhibit the cytotoxic effects of Pseudomonas aeruginosa in human patients, achieving effects comparable to or improved upon the antibiotic levofloxacin, and Pseudomonas aeruginosa has almost no natural resistance to it.

[0009] Therefore, the object of this invention is to provide a novel monoclonal antibody against Pseudomonas aeruginosa that does not exhibit self-reactivity and has excellent neutralizing efficacy against cyclically resistant Pseudomonas aeruginosa strains.

[0010] Another object of the present invention is to provide a novel monoclonal antibody against Pseudomonas aeruginosa, which can be used to treat or prevent diseases caused by Pseudomonas aeruginosa in human or animal subjects, and to prevent infection of human or animal subjects with Pseudomonas aeruginosa. Invention Overview The present invention solves these problems, as detailed below.

[0012] According to a first aspect of the invention, an antibody or antigen-binding fragment thereof against *Pseudomonas aeruginosa* is provided, wherein the antibody or antigen-binding fragment comprises a combination of heavy chain CDR1 to CDR3 and light chain CDR1 to CDR3 amino acid sequences of an antibody selected from the group consisting of: 30-D9 (having the CDR-H1 amino acid sequence of SEQ ID No. 21, the CDR-H2 amino acid sequence of SEQ ID No. 22, the CDR-H3 amino acid sequence of SEQ ID No. 23, the CDR-L1 amino acid sequence of SEQ ID No. 24, the CDR-L2 amino acid sequence of SEQ ID No. 25, and the CDR-L3 amino acid sequence of SEQ ID No. 26), 30-B8 (having the CDR-H1 amino acid sequence of SEQ ID No. 27, the CDR-H2 amino acid sequence of SEQ ID No. 28, the CDR-H3 amino acid sequence of SEQ ID No. 29, the CDR-L1 amino acid sequence of SEQ ID No. 30, and the CDR-H1 amino acid sequence of SEQ ID No. 26), SEQ ID No. 27, the CDR-H2 amino acid sequence of SEQ ID No. 28, the CDR-H3 amino acid sequence of SEQ ID No. 29, and the CDR-L1 amino acid sequence of SEQ ID No. 20, SEQ ID No. 26, and the CDR-L3 amino acid sequence of SEQ ID No. 27, SEQ ID No. 28, SEQ ID No. 29, and the CDR-L1 amino acid sequence of SEQ ID No. 29, SEQ ID No. 29, and the CDR-L3 amino acid sequence of SEQ ID No. 20, SEQ ID No. 29, SEQ ID No. 29, SEQ ID No. 29, SEQ ID No. 29, SEQ ID No. SEQ ID No. 31 (CDR-L2 amino acid sequence, SEQ ID No. 32 (CDR-L3 amino acid sequence)), 30-D7 (containing SEQ ID No. 33 (CDR-H1 amino acid sequence), SEQ ID No. 34 (CDR-H2 amino acid sequence), SEQ ID No. 35 (CDR-H3 amino acid sequence), SEQ ID No. 36 (CDR-L1 amino acid sequence), SEQ ID No. 37 (CDR-L2 amino acid sequence), SEQ ID No. 38 (CDR-L3 amino acid sequence), 11-A6 (containing SEQ ID No. 39 (CDR-H1 amino acid sequence), SEQ ID No. 40 (CDR-H2 amino acid sequence), SEQ ID No. 41 (CDR-H3 amino acid sequence), SEQ ID No. 42 (CDR-L1 amino acid sequence), SEQ ID No. 43 (CDR-L2 amino acid sequence), SEQ ID No. 44 (CDR-L3 amino acid sequence), 23-A9 (containing SEQ ID No. 31 (CDR-L2 amino acid sequence), SEQ ID No. 32 (CDR-L3 amino acid sequence), SEQ ID No. 33 (CDR-L2 amino acid sequence), SEQ ID No. 44 (CDR-L3 amino acid sequence), SEQ ID No. 35 (CDR-H3 amino acid sequence), SEQ ID No. 36 (CDR-L1 amino acid sequence), SEQ ID No. 43 (CDR-L2 amino acid sequence), SEQ ID No. 44 (CDR-L3 amino acid sequence), SEQ ID No. 36 (CDR-L2 amino acid sequence), SEQ ID No. 47 (CDR-L2 amino acid sequence), SEQ ID No. 48 (CDR-L3 amino acid sequence), SEQ ID No. 39 (CDR-H1 amino acid sequence), SEQ ID No. 40 (CDR-H2 amino acid sequence), The amino acid sequences of SEQ ID No. 45 (CDR-H1), SEQ ID No. 46 (CDR-H2), SEQ ID No. 47 (CDR-H3), SEQ ID No. 48 (CDR-L1), SEQ ID No. 49 (CDR-L2), and SEQ ID No. 50 (CDR-L3), and 11-C10 (containing the amino acid sequences of SEQ ID No. 51 (CDR-H1), SEQ ID No. 52 (CDR-H2), and SEQ ID No. 45 (CDR-H1), SEQ ID No. 46 (CDR-H2), and SEQ ID No. 47 (CDR-H3), respectively).The amino acid sequences of SEQ ID No. 53 (CDR-H3), SEQ ID No. 54 (CDR-L1), SEQ ID No. 55 (CDR-L2), and SEQ ID No. 56 (CDR-L3), 23-F9 (containing the amino acid sequences of SEQ ID No. 57, SEQ ID No. 58, SEQ ID No. 59, SEQ ID No. 60, SEQ ID No. 61, and SEQ ID No. 62), and 11-C4 (containing the amino acid sequences of SEQ ID No. 63, SEQ ID No. 64, SEQ ID No. 65, and SEQ ID No. 66, SEQ ID...) The amino acid sequences SEQ ID No. 67 (CDR-L2), SEQ ID No. 68 (CDR-L3), 30-B9 (containing the amino acid sequences SEQ ID No. 69 (CDR-H1), SEQ ID No. 70 (CDR-H2), SEQ ID No. 71 (CDR-H3), SEQ ID No. 72 (CDR-L1), SEQ ID No. 73 (CDR-L2), and SEQ ID No. 74 (CDR-L3), and 30-C9 (containing the amino acid sequences SEQ ID No. 75 (CDR-H1), SEQ ID No. 76 (CDR-H2), SEQ ID No. 77 (CDR-H3), SEQ ID No. 78 (CDR-L1), SEQ ID No. 79 (CDR-L2), and SEQ ID No. 80 (CDR-L3)).

[0013] In one embodiment of the first aspect of the invention, the antibody or its antigen-binding fragment comprises a combination of a variable region heavy chain amino acid sequence and a variable region light chain amino acid sequence selected from the group consisting of: 30-D9 (having the variable region heavy chain amino acid sequence of SEQ ID No. 1 and the variable region light chain amino acid sequence of SEQ ID No. 2), 30-B8 (having the variable region heavy chain amino acid sequence of SEQ ID No. 3 and the variable region light chain amino acid sequence of SEQ ID No. 4), 30-D7 (having the variable region heavy chain amino acid sequence of SEQ ID No. 5 and the variable region light chain amino acid sequence of SEQ ID No. 6), 11-A6 (having the variable region heavy chain amino acid sequence of SEQ ID No. 7 and the variable region light chain amino acid sequence of SEQ ID No. 8), 23-A9 (having the variable region heavy chain amino acid sequence of SEQ ID No. 9 and the variable region light chain amino acid sequence of SEQ ID No. 10), and 11-C10 (having the variable region heavy chain amino acid sequence of SEQ ID No. 11 and SEQ ID No. 10). The variable region light chain amino acid sequence of SEQ ID No. 12), 23-F9 (with the variable region heavy chain amino acid sequence of SEQ ID No. 13 and the variable region light chain amino acid sequence of SEQ ID No. 14), 11-C4 (with the variable region heavy chain amino acid sequence of SEQ ID No. 15 and the variable region light chain amino acid sequence of SEQ ID No. 16), 30-B9 (with the variable region heavy chain amino acid sequence of SEQ ID No. 17 and the variable region light chain amino acid sequence of SEQ ID No. 18), and 30-C9 (with the variable region heavy chain amino acid sequence of SEQ ID No. 19 and the variable region light chain amino acid sequence of SEQ ID No. 20).

[0014] In an embodiment of the first aspect of the present invention, the amino acid sequence included is an amino acid sequence of an antibody selected from the group consisting of 30-D9, 30-B8, 30-D7, 11-A6, 23-A9 and 11-C10, preferably an amino acid sequence of an antibody selected from the group consisting of 30-D9, 30-B8, 30-D7 and 11-A6, more preferably an amino acid sequence of an antibody selected from the group consisting of 30-D9 and 30-B8, and particularly preferably an amino acid sequence of antibody 30-B8.

[0015] In another embodiment of the first aspect of the invention, the antibody or its antigen-binding fragment targets a protein of the type III secretion system of Pseudomonas aeruginosa, preferably the PcrV protein of Pseudomonas aeruginosa (UniProt accession number G3XD49).

[0016] In yet another embodiment of the first aspect of the invention, the amino acid sequence of the included CDR or variable region is derived from an antibody capable of being used in the cytotoxicity assay described in the specification at an IC50 concentration of up to 2 µg / ml, preferably up to 1 µg / ml, more preferably up to 0.3 µg / ml, even more preferably up to 0.2 µg / ml, and particularly preferably up to 0.1 µg / ml. 50 Inhibits Pseudomonas aeruginosa wild-type strain PAO1.

[0017] In one embodiment of the first aspect of the invention, the amino acid sequence of the included CDR or variable region is derived from an antibody capable of inhibiting cell death induced by Pseudomonas aeruginosa strain PAO1 in an assay described in the specification, to obtain at least 80% cell viability, preferably at least 84% cell viability, more preferably at least 90% cell viability, and particularly preferably at least 95% cell viability compared to an uninfected control.

[0018] In an embodiment of the first aspect of the invention, the antibody or its antigen-binding fragment does not exhibit autoreactivity defined as detectable binding when tested against permeabilized HEp-2 cells using an antinuclear antibody (ANA) test kit (NOVA-Lite HEp-2 ANA kit; Inova Diagnostics).

[0019] According to a second aspect of the invention, a pharmaceutical composition is provided comprising an antibody or an antigen-binding fragment thereof according to a first aspect of the invention, and at least one pharmaceutically acceptable excipient.

[0020] According to a third aspect of the invention, a kit is provided comprising an antibody or an antigen-binding fragment thereof according to a first aspect of the invention, and a container.

[0021] According to a fourth aspect of the invention, an antibody or antigen-binding fragment thereof according to the first aspect of the invention, a pharmaceutical composition according to the second aspect of the invention, or a kit according to the third aspect of the invention are used as pharmaceuticals.

[0022] According to a fifth aspect of the present invention, an antibody or antigen-binding fragment thereof according to a first aspect of the present invention, a pharmaceutical composition according to a second aspect of the present invention, or a kit according to a third aspect of the present invention are used for the treatment or prevention of Pseudomonas aeruginosa infection in mammalian subjects (preferably human subjects).

[0023] According to a sixth aspect of the invention, a nucleic acid encoding an antibody or an antigen-binding fragment thereof according to a first aspect of the invention is provided.

[0024] According to a seventh aspect of the invention, an expression vector is provided comprising a nucleic acid according to a sixth aspect of the invention, which is functionally linked to an expression control sequence.

[0025] According to an eighth aspect of the invention, a host cell is provided which contains a nucleic acid according to a sixth aspect of the invention or an expression vector according to a seventh aspect of the invention.

[0026] According to a ninth aspect of the invention, a method for producing an antibody or an antigen-binding fragment thereof according to a first aspect of the invention is provided, comprising: (a) culturing a host cell according to an eighth aspect of the invention under conditions that allow expression of the antibody or the antigen-binding fragment thereof; and (b) recovering the antibody or the antigen-binding fragment thereof.

[0027] Brief description of the attached diagram This disclosure will be better understood by referring to the following detailed description when considered in conjunction with the accompanying drawings, in which: Figure 1 This is a graph showing the results of cell line-based assays. A549 cells were infected with PAO1 at an MOI of 0.5 for 150 min in the presence of monoclonal anti-PcrV antibody (50 µg / mL). As controls, cells were left uninfected or infected in the presence of a simulant control, humanized mouse anti-PcrV antibody (1F3) (50 µg / mL), or gentamicin (20 µg / mL). Relative fluorescence units (RFU) were measured after the addition of resazurin. Each data point represents the mean of technical replicates from independent experiments. Box plots show the median, upper and lower quartiles, and minimum and maximum values. Significance was calculated relative to infected cells treated with the simulant control using one-way ANOVA and Tukey's multiple comparison test.

[0028] Figure 2 This is a graph showing the results of cell line-based assays. A549 cells were infected with different drug-resistant *Pseudomonas aeruginosa* strains (A, B), both isolated from patients with bloodstream infections. Cells were treated with piperacillin / tazobactam (16 µg / mL), meropenem (8 µg / mL), ceftazidime (8 µg / mL), ciprofloxacin (1 µg / mL), gentamicin (4 µg / mL), and a selected patient-derived monoclonal anti-PcrV antibody (50 µg / mL). Significance relative to infected cells treated with simulated controls was calculated using one-way ANOVA and Tukey's multiple comparison test. Box plots show the median, 25th and 75th percentiles, and minimum and maximum values ​​for the four independent experiments.

[0029] Figure 3 This is a graph showing the results of a hemolysis-based assay.

[0030] Figure 3A: Cyclophosphamide was administered intraperitoneally to CD-1 mice on days -4 and -1 to induce neutropenia. Subsequently, lung infection was induced by aerosolized Pseudomonas aeruginosa (Boston 41501 strain). An inoculum group was used to confirm successful bacterial administration. Two hours later, a vector control (PBS), levofloxacin (100 mg / kg), or mAb (5 mg / kg) was administered intraperitoneally. The experiment was terminated 24 hours later, and homogenized lung samples were subsequently used for CFU quantification.

[0031] Figure 3 B: CD-1 mice were induced to have neutropenia by intraperitoneal administration of 150 mg / kg and 100 mg / kg cyclophosphamide on day-4 and day-1, respectively. Two hours before infection, control mAb (MCA1) or mAb 30-B8 or 30-D9 (5 mg / kg) were administered intraperitoneally. Neutropenia was also induced by intramuscular injection of 1.2 x 10 mg / kg cyclophosphamide into the thigh muscles of each mouse. 5 Infection was initiated with PA (Boston 41501) at CFU / ml. As a control, levofloxacin (100 mg / kg) was administered at 2, 6, and 10 hours post-infection. To confirm bacterial infection after injection, six animals were used as a control group. Animals were sacrificed 24 hours later, muscle was homogenized, and CFU was measured. Box plots show the median, 25th and 75th percentiles, and minimum and maximum values. Significance was calculated relative to animals treated with the control antibody using one-way ANOVA and Tukey's multiple comparison test.

[0032] Figure 4 This is a graph showing the titration curves for cell line-based assays. A549 cells were infected with human PcrV mAb 30-D9 at concentrations ranging from 50 µg / mL to 24 ng / mL, bispecific PcrV-Psl antibody (MEDI3902), and in the presence of 1F3. RFU was measured after the addition of resazurin. Box plots show the median, 25th and 75th percentiles, and minimum and maximum values ​​for two independent experiments.

[0033] Figure 5 This image shows the results of the self-reactivity test. HepG2 cells were stained with 100 µg / mL anti-PcrVmAb for 30 minutes at room temperature. After washing with PBS, cells were labeled with a second FITC-conjugated anti-human IgG antibody for 30 minutes. A positive control was used according to the instructions of the kit used. PBS was used instead of the primary antibody as a negative control. The stained slides were mounted and analyzed under a microscope at 40x magnification.

[0034] Figure 6This is a graph showing the direct comparison of A549 cell viability after infection with wild-type Pseudomonas aeruginosa strain PAO1 in the presence of increased doses of the reference antibody H1H29336P or the representative antibodies of this invention 30-B8 and 30-D9; higher RFU indicates higher viability, representing improved and superior neutralizing strength of the antibody used.

[0035] Detailed description of the preferred implementation scheme The invention will now be described in more detail with reference to the accompanying drawings. In the drawings, the same elements are labeled with the same reference numerals, and repeated descriptions may be omitted to avoid redundancy.

[0036] To make this specification easier to understand, some terms are defined first. The remaining definitions are explained throughout the detailed description.

[0037] It should be noted that the term "a" or "an" refers to one or more of the same entity; for example, "a nucleotide sequence" should be understood as representing one or more nucleotide sequences. Therefore, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably in this document.

[0038] Furthermore, when used herein, “and / or” should be considered as a specific disclosure of each of two particular features or components, whether or not the other is also included. Therefore, the term “and / or” as used in phrases such as “A and / or B” herein is intended to include “A and B”, “A or B”, “A” (alone), and “B” (alone). Similarly, the term “and / or” as used in phrases such as “A, B, and / or C” is intended to cover each of the following: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0039] It should be understood that wherever the language “comprising / including” is used in this document, similar aspects described as “consisting of” and / or “substantially consisting of” are also provided.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press are all general dictionaries provided by those skilled in the art for the use of many terms used in this disclosure.

[0041] Units, prefixes, and symbols are all represented in their International System of Units (SI) accepted form. Numerical ranges include the numbers that define the range. Unless otherwise specified, nucleotide sequences are written from left to right in the 5' to 3' direction. Amino acid sequences are written from left to right in the amino to carboxyl direction. The headings provided herein are not intended to limit any aspect of this disclosure and are available by referring to the full text of the specification. Therefore, terms that are directly defined below should be more fully defined with reference to the full text of the specification.

[0042] The term "about" is used in this document to mean approximately, roughly, about, or within a certain range. When the term "about" is used in conjunction with a numerical range, it modifies the range by extending the boundaries above and below the specified value. Typically, the term "about" allows the value to fluctuate around the stated value, for example, by a difference of 10% (higher or lower).

[0043] The term “antibody” is used in the broadest sense herein to refer to molecules having immunoglobulin-like domains (e.g., IgG, IgM, IgA, IgD, or IgE), and includes monoclonal antibodies, recombinant antibodies, chimeric antibodies, human antibodies, humanized antibodies, multispecific antibodies (including bispecific antibodies), and heteroconjugated antibodies; single variable domain (e.g., VH, VHH, VL domain antibodies), antigen-binding antibody fragments, Fab, F(ab')2, Fv, disulfide-linked Fv, single-chain Fv, disulfide-linked scFv, diabodies, and any modified versions of the foregoing.

[0044] As used herein, the term "antibody" refers to a protein capable of specifically binding to an antigen or its antigen-binding portion. This term includes full-length antibodies of any class or subtype, as well as any single chain or fragment thereof. Antibodies that specifically bind to an antigen or its antigen-binding portion may bind only to that antigen or a portion thereof, or may bind to a limited number of homologous antigens or portions thereof. Full-length antibodies typically contain at least four polypeptide chains: two heavy (H) chains and two light (L) chains, interconnected by disulfide bonds.

[0045] One immunoglobulin subclass of particular interest in the pharmaceutical field is the IgG family. In humans, based on the sequence of their heavy chain constant regions, the IgG class can be further subdivided into four subclasses: IgG1, IgG2, IgG3, and IgG4. Light chains can be classified into two types based on their sequence composition: κ and λ. An IgG molecule consists of two heavy chains (interconnected by two or more disulfide bonds) and two light chains, each light chain linked to the heavy chain by a disulfide bond. The heavy chain may contain a heavy chain variable region (VH) and up to three heavy chain constant (CH) regions: CH1, CH2, and CH3. The light chain may contain a light chain variable region (VL) and a light chain constant region (CL).

[0046] The VH and VL regions can be further subdivided into hypervariable regions (called complementarity-determining regions (CDRs)) alternating with more conserved regions (called frame regions (FRs)). The VH and VL regions typically consist of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The hypervariable regions of the heavy and light chains constitute binding domains capable of interacting with antigens, while the constant regions of the antibody mediate the binding of immunoglobulins to host tissues or factors, including but not limited to various cells of the immune system (effector cells), Fc receptors, and the first component (C1q) of the classical complement system. The antibodies of this invention can be isolated.

[0047] The term "isolated antibody" refers to an antibody that has been isolated and / or recovered from other components in the environment in which it was produced, and / or purified from a mixture of components present in the environment in which it was produced. In the context of this invention, certain antigen-binding fragments of the antibody may be applicable, as it has been shown that the antigen-binding function of an antibody can be achieved by fragments of the full-length antibody.

[0048] The term "binding fragment" or "antigen-binding fragment" of an antibody refers to one or more fragments of an antibody that retain the ability to specifically bind to antigens, such as proteins of the type III secretion system of Pseudomonas aeruginosa as described herein.

[0049] Examples of antigen-binding fragments include Fab, Fab', F(ab)2, F(ab')2, F(ab)S, Fv (typically the VL and VH domains of a single arm of an antibody), single-chain Fv (scFv; see, for example, Bird et al., 1988; Huston et al., 1988), dsFv, Fd (typically the VH and CH1 domains), and dAb (typically the VH domain) fragments; VH, VL, VHH, and V-NAR domains; monovalent molecules containing a single VH chain and a single VL chain; mini-antibodies, biantibodies, triantibodies, tetraantibodies, and κ-antibodies (see, for example, Ill et al., 1997); camel IgG; IgNAR; and one or more separate CDRs or functional paratopes, wherein separate CDRs or antigen-binding residues or peptides may bind or link together to form a functional antibody fragment.

[0050] Various types of antibody fragments have been described or reviewed, for example, in Holliger and Hudson, 2005; International Publication No. WO 2005 / 040219 and US Publications Nos. 2005 / 0238646 and 2002 / 0161201. These antibody fragments can be obtained using conventional techniques known to those skilled in the art, and fragments can be screened for use in the same manner as intact antibodies.

[0051] Human antibodies (HuMAb) are antibodies with variable regions, where both the framework region and CDR region are derived from human immunoglobulin sequences. Furthermore, if the antibody contains a constant region, that constant region is also derived from human immunoglobulin sequences. Antibodies described herein may include amino acid residues not encoded by human immunoglobulin sequences (e.g., mutations introduced through random or site-specific mutagenesis in vitro or through somatic mutations in vivo).

[0052] However, as used herein, the term "human antibody" is not intended to include antibodies in which a CDR sequence derived from a lineage of another mammalian species (such as a mouse) is grafted onto a human frame sequence. The term "human" antibody is used synonymously with "fully human" antibody.

[0053] "Recombinant human antibody" refers to any human antibody prepared, expressed, created, or isolated by recombinant means, such as (a) antibodies isolated from transgenic or transchromosomal animals (e.g., mice) carrying the human immunoglobulin gene or hybridomas prepared therefrom; (b) antibodies isolated from host cells transformed to express antibodies (e.g., from transfected tumors); (c) antibodies isolated from a recombinant human antibody library; and (d) antibodies prepared, expressed, created, or isolated by any other means of splicing the human immunoglobulin gene sequence with other DNA sequences.

[0054] These recombinant human antibodies contain specific human germline immunoglobulin sequences encoded by germline genes, but also include variable and constant regions, such as those resulting from subsequent rearrangements and mutations during antibody maturation. As is known in the art (see, for example, Lonberg, 2005), the variable region contains an antigen-binding domain encoded by multiple genes, which can be rearranged to form antibodies specific to foreign antigens. In addition to rearrangements, the variable region can be further modified by multiple single-amino acid changes (called somatic mutations or hypermutations) to increase the antibody's affinity for foreign antigens. The constant region will be altered through further responses to antigens (i.e., isotype switching).

[0055] Therefore, rearrangements of the light and heavy chain immunoglobulin polypeptides encoded in response to antigens and somatic mutations in nucleic acid molecules cannot be identical to the original nucleic acid molecule sequence, but will be substantially identical or similar (i.e., have at least 80% identity).

[0056] "Chimeric antibody" refers to an antibody in which the variable region is derived from one species and the constant region is derived from another species, such as an antibody in which the variable region is derived from a mouse antibody and the constant region is derived from a human antibody.

[0057] Alternative antibody formats include alternative scaffolds in which one or more CDRs of the antigen-binding moiety can be arranged onto a suitable non-immunoglobulin protein scaffold or backbone, such as affibody, SpA scaffold, LDL receptor class A domain, avimer, or EGF domain.

[0058] The term "domain" (which is used interchangeably with "region" in this text) refers to a folded protein structure that maintains its tertiary structure independently of the rest of the protein. Typically, a domain is responsible for the discrete functional properties of a protein and can be added, removed, or transferred to other proteins in many cases without causing the loss of function of the rest of the protein and / or the domain itself.

[0059] The term "variable domain" refers to a folded polypeptide domain containing a sequence characteristic of an antibody variable domain. Therefore, the term includes complete antibody variable domains (such as VH, VHH, and VL), as well as modified antibody variable domains, such as those where one or more loops have been replaced by sequences not characteristic of antibody variable domains, or truncated antibody variable domains, or antibody variable domains containing N-terminal or C-terminal extensions, and folded fragments of variable domains that retain at least the binding activity and specificity of the full-length domain.

[0060] A single variable (V) domain can bind to an antigen or epitope independently of different variable regions or domains. "Domain antibody" or "dAb™" can be considered synonymous with "single variable domain". A single variable domain can be a human single variable domain, but also includes single variable domains from other species (such as the rodent nurse shark and camelid VHH dAbs™). Camelid VHHs are immunoglobulin single variable domain peptides derived from species including camels, llamas, alpacas, dromedaries, and guanacos, which naturally produce heavy chain antibodies that do not contain light chains. Such VHH domains can be humanized using standard techniques available in the prior art, and all such domains are considered "single variable domains".

[0061] Antigen-binding fragments can be provided by arranging one or more CDRs on a non-antibody protein scaffold. The “protein scaffold” may include an immunoglobulin (Ig) scaffold, such as an IgG scaffold, which may be a four-chain or two-chain antibody, or it may contain only the Fc region of the antibody, or it may contain one or more antibody constant regions, which may be of human or primate origin, or it may be an artificial chimera of human and primate constant regions.

[0062] Phrases such as “antibody that recognizes antigen” and “antibody that is specific to antigen” can be used interchangeably with the term “antibody that specifically binds to antigen” in this article.

[0063] The terms “treat,” “treating,” or “treatment of” (or grammatically equivalent terms) refer to the reduction of the severity of a subject’s condition or at least partial improvement or relief of the severity of a subject’s condition, and / or some relief, reduction, or decrease of at least one clinical symptom, and / or delay of the progression of the condition.

[0064] As used herein, the terms “prevent,” “prevents,” or “prevention,” as well as “inhibit,” “inhibits,” or “inhibition” (and their grammatical equivalents) are not intended to imply the complete elimination of disease, but rather to encompass any type of preventative treatment that reduces the incidence of disease, delays the onset of disease, and / or alleviates disease-related symptoms after an onset.

[0065] As used herein, “effective,” “preventive effective,” or “therapeutic effective” means an amount sufficient to provide some improvement or benefit to the subject. In other words, “effective,” “preventive effective,” or “therapeutic effective” means an amount that provides some delay, relief, reduction, or decrease in at least one clinical symptom to the subject. Those skilled in the art will understand that the effect need not be complete or curative, as long as it provides some benefit to the subject.

[0066] "Neutralizing antibody" can refer to any antibody or its antigen-binding fragment that binds to a pathogen and interferes with the pathogen's ability to infect cells and / or cause disease in a subject.

[0067] For peptides, the term "fundamentally homologous" means that when two peptides or their designated sequences are optimally aligned and compared, at least about 80% of the amino acids, at least about 90% to 95% of the amino acids, or at least about 98% to 99.5% of the amino acids are identical (with appropriate amino acid insertions or deletions).

[0068] The percentage identity between two sequences is a function of the number of common positions shared by the two sequences (i.e., percentage of homology = number of common positions / total number of positions × 100), taking into account the number of gaps required to achieve optimal alignment of the two sequences and the length of each gap. Sequence comparison and determination of percentage identity between two sequences can be implemented using mathematical algorithms, as described in the non-restrictive examples below.

[0069] Nucleic acids can be present in intact cells, cell lysates, or in partially purified or substantially pure forms. A nucleic acid is “isolated” or “substantially pure” when purified from other cellular components or other contaminants (such as other cellular nucleic acids, e.g., other parts of chromosomes) or proteins using standard techniques, including alkali / SDS treatment, CsCl banding, column chromatography, agarose gel electrophoresis, and other techniques known in the art. See Ausubel, 1987.

[0070] Nucleic acids (such as cDNA) can be mutated using standard techniques to provide gene sequences. For coding sequences, these mutations can affect the amino acid sequence as needed. In particular, DNA sequences that are substantially homologous to or derived from the natural V, D, J, constant, switch, and other such sequences as described herein are envisioned (where “derived” means a sequence that is identical to or modified from another sequence).

[0071] As used herein, the term "vector" is intended to refer to a nucleic acid molecule capable of carrying another nucleic acid to which it has been linked. One type of vector is the "plasmid," which refers to a circular double-stranded DNA loop into which an additional DNA segment can be linked. Another type of vector is a viral vector, in which an additional DNA or RNA segment can be linked to the viral genome. Some vectors are capable of autonomous replication in the host cells into which they are introduced (e.g., bacterial vectors with bacterial replication origins and free-living mammalian vectors).

[0072] Other vectors (such as non-free mammalian vectors) can integrate into the host cell genome after introduction into the host cell, thereby replicating with the host genome. Furthermore, some vectors can direct the expression of genes operatively linked to them. Such vectors are referred to herein as "recombinant expression vectors" (or simply "expression vectors"). Typically, expression vectors used in recombinant DNA technology are in plasmid form. In this specification, "plasmid" and "vector" are used interchangeably because plasmids are the most commonly used vector form. However, other forms of expression vectors are also included, such as viral vectors that provide equivalent functionality (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses).

[0073] As used herein, the term "recombinant host cell" (or simply "host cell") is intended to refer to a cell containing nucleic acids not naturally present in that cell, and may be a cell into which a recombinant expression vector has been introduced. It should be understood that such terms are intended not only to refer to a specific subject cell, but also to the offspring of such cells. Such offspring may not actually be identical to the parent cells due to modifications that may occur in subsequent generations due to mutations or environmental influences, but are still included within the scope of the term "host cell" as used herein.

[0074] As used herein, the term "link" refers to the association of two or more molecules. Links can be covalent or non-covalent. Links can also be genetic (i.e., recombination fusion). Such links can be achieved using a variety of techniques recognized in the art, such as chemical conjugation and recombinant protein production.

[0075] "Fc receptors" or "FcRs" are receptors that bind to the Fc region of immunoglobulins. FcRs that bind to IgG antibodies include receptors of the FcγR family, including allelic variants and alternative splicing forms of these receptors. The FcγR family consists of three activating receptors (FcγRI, FcγRIII, and Fc.RIV in mice; FcγRIA, FcγRIIA, and FcγRIIIA in humans) and one repressive receptor (FcγRIIB). The diverse characteristics of human FcγRs are known in the art. Most innate effector cell types co-express one or more activating FcγRs and one repressive FcγRIIB, while natural killer (NK) cells selectively express one activating Fc receptor (FcγRIII in mice and FcγRIIIA in humans), and the repressive FcγRIIB is not expressed in either mice or humans. Human IgG1 binds to most Fc receptors and, in terms of the type of activating Fc receptor it binds to, is considered equivalent to mouse IgG2a.

[0076] The “Fc region” (crystallizable fragment region), “Fc domain”, or simply “Fc” refers to the C-terminal region of the antibody heavy chain. This region mediates the binding of immunoglobulins to host tissues or factors, including binding to Fc receptors located on various cells of the immune system (such as effector cells) or to the first component (C1q) of the classical complement system. Therefore, the Fc region contains the constant region of the antibody but does not include the first constant region, the immunoglobulin domain (such as CH1 or CL).

[0077] Constant regions can be modified to stabilize antibodies, for example, reducing the risk of bivalent antibodies separating into two monovalent VH-VL fragments. For instance, in the IgG4 constant region, residue S228 (residue numbered according to the EU index) can be mutated to a proline (P) residue to stabilize the formation of inter-heavy chain disulfide bridges at the hinge (see, for example, Angal et al., 1993). Antibodies or fragments thereof can also be defined by their complementarity-determining regions (CDs).

[0078] When used in this paper, the terms “complementarity-determining region” or “hypervariant region” refer to the region in an antibody containing amino acid residues involved in antigen binding. A hypervariable region, or CDR, can be identified as the region with the highest variability in the amino acid alignment of the antibody's variable domains. Typically, CDRs can be identified using databases such as the Kabat database, where, for example, a CDR is defined as amino acid residues 24-34 (CDR1), 50-59 (CDR2), and 89-97 (CDR3) of the light chain variable region, and 31-35 (CDR1), 50-65 (CDR2), and 95-102 (CDR3) of the heavy chain variable region (Kabat et al. 1991). Alternatively, CDR is usually defined as those residues from the “hypervariant ring” (residues 26-33 (L1), 50-52 (L2) and 91-96 (L3) in the light chain variable region, and 26-32 (H1), 53-55 (H2) and 96-101 (H3) in the heavy chain variable region) (Chothia and Lesk, 1987).

[0079] The CDR region of the antibody sequence described in this article is preferably defined according to the IMGT numbering scheme, which is an adaptation of the Chothia numbering scheme (ImMunoGeneTics Information System®; Lefranc et al., 1999.). http: / / imgt.org ).

[0080] As used herein, the terms "specific binding," "selective binding," "selectively binding," and "specifically binding" refer to the binding of an antibody to an epitope on a predetermined antigen. Preferably, the antibody's affinity for the predetermined antigen is at least twice its affinity for nonspecific antigens (such as BSA or casein) other than the predetermined antigen or closely related antigens.

[0081] The term "binding affinity" in this article refers to a measure of the strength of the non-covalent interaction between two molecules (such as an antibody or fragment thereof and an antigen). The term "binding affinity" is used to describe monovalent interactions (intrinsic activity).

[0082] The binding affinity between two molecules (e.g., an antibody or fragment thereof and an antigen) through monovalent interactions can be quantified by determining the equilibrium dissociation constant (KD). Accordingly, KD can be determined by measuring the kinetics of complex formation and dissociation (e.g., using the SPR method). The rate constants corresponding to the binding and dissociation of the monovalent complex are called the binding rate constant ka (or kon) and the dissociation rate constant kd (or koff), respectively. KD is related to ka and kd by the equation KD = kd / ka. Based on the above definitions, the binding affinity associated with different molecular interactions can be compared by comparing the KD values ​​of individual antibody / antigen complexes, for example, comparing the binding affinity of different antibodies for a given antigen.

[0083] The term "binding specificity" in this article refers to the interaction of a molecule (such as an antibody or fragment thereof) with a single unique antigen, or with a limited number of highly homologous antigens (or epitopes). In contrast, antibodies that specifically bind to proteins of the type III secretion system of Pseudomonas aeruginosa cannot bind to dissimilar molecules.

[0084] The specificity of the interaction and the value of the equilibrium binding constant can be determined directly using methods well known in the art. Standard assays for assessing the ability of ligands (such as antibodies) to bind to their targets are known in the art, including, for example, ELISA, Western blotting, RIA, and flow cytometry. The binding kinetics and binding affinity of antibodies can also be assessed using standard assays known in the art, such as SPR.

[0085] A polypeptide is a chain containing at least two consecutively linked amino acid residues, with no upper limit on its length. One or more amino acid residues in a protein may contain modifications, such as, but not limited to, glycosylation, phosphorylation, or disulfide bond formation. A protein may contain one or more polypeptides.

[0086] As used herein, the term "nucleic acid" or "nucleic acid molecule" is intended to include both DNA and RNA molecules. Nucleic acid molecules can be single-stranded or double-stranded and can be cDNA.

[0087] The term "subject" includes humans and other mammalian subjects who receive preventative or therapeutic treatment. As used herein, the term "subject" includes any human or non-human animal. The term "non-human animal" includes all vertebrates, such as mammals and non-mammals, including non-human primates, sheep, dogs, cattle, chickens, amphibians, reptiles, etc.

[0088] As used in this article, the terms “ug” and “uM” are used interchangeably with “μg” and “μM”, respectively.

[0089] As used herein, “administration” means the physical introduction of a composition containing a therapeutic agent into a subject using various methods and delivery systems known to those skilled in the art. Different routes of administration of the antibodies described herein include intravenous, intraperitoneal, intramuscular, subcutaneous, spinal, or other parenteral administration routes, such as by injection or infusion.

[0090] As used in this article, the phrase “parenteral administration” refers to administration methods other than enteral and local administration, usually by injection, including but not limited to intravenous, intraperitoneal, intramuscular, intra-arterial, intrathecal, intralymphatic, intralesional, intracystic, intraorbital, intracardiac, intradermal, tracheal, subcutaneous, subepidermal, intra-articular, subcapsular, subarachnoid, intraspinal, epidural, and intrasternal injections and infusions, as well as intracorporeal electroporation.

[0091] Alternatively, the antibodies described herein may be administered via non-parenteral routes, such as local, epidermal, or mucosal administration, including intranasal, oral, vaginal, rectal, sublingual, or topical administration. Administration may also be performed, for example, once, multiple times, and / or over one or more extended time periods.

[0092] As used herein, "vaccine composition" means a pharmaceutical composition comprising at least one antibody of the present invention or its antigen-binding portion capable of providing active and / or passive immunity. As used herein, "active immunity" means inducing or enhancing an immune response in a subject to an antigen. As used herein and preferably, "passive immunity" means supplementing an immune response in a subject to an antigen or pathogen by providing an antibody and / or its antigen-binding portion that neutralizes the antigen.

[0093] The inventors dedicated themselves to solving the problems of this invention and successfully discovered a novel human monoclonal antibody against Pseudomonas aeruginosa, which has superior neutralizing efficacy against currently prevalent drug-resistant Pseudomonas aeruginosa.

[0094] Therefore, the present invention provides an antibody or antigen-binding fragment thereof against *Pseudomonas aeruginosa*, wherein the antibody or antigen-binding fragment thereof comprises a combination of heavy chain CDR1 to CDR3 and light chain CDR1 to CDR3 amino acid sequences selected from the group consisting of: 30-D9 (having the CDR-H1 amino acid sequence of SEQ ID No. 21, the CDR-H2 amino acid sequence of SEQ ID No. 22, the CDR-H3 amino acid sequence of SEQ ID No. 23, the CDR-L1 amino acid sequence of SEQ ID No. 24, the CDR-L2 amino acid sequence of SEQ ID No. 25, and the CDR-L3 amino acid sequence of SEQ ID No. 26), 30-B8 (having the CDR-H1 amino acid sequence of SEQ ID No. 27, the CDR-H2 amino acid sequence of SEQ ID No. 28, the CDR-H3 amino acid sequence of SEQ ID No. 29, the CDR-L1 amino acid sequence of SEQ ID No. 30, and SEQ ID No. 26). SEQ ID No. 31 (CDR-L2 amino acid sequence, SEQ ID No. 32 (CDR-L3 amino acid sequence)), 30-D7 (containing SEQ ID No. 33 (CDR-H1 amino acid sequence), SEQ ID No. 34 (CDR-H2 amino acid sequence), SEQ ID No. 35 (CDR-H3 amino acid sequence), SEQ ID No. 36 (CDR-L1 amino acid sequence), SEQ ID No. 37 (CDR-L2 amino acid sequence), SEQ ID No. 38 (CDR-L3 amino acid sequence), 11-A6 (containing SEQ ID No. 39 (CDR-H1 amino acid sequence), SEQ ID No. 40 (CDR-H2 amino acid sequence), SEQ ID No. 41 (CDR-H3 amino acid sequence), SEQ ID No. 42 (CDR-L1 amino acid sequence), SEQ ID No. 43 (CDR-L2 amino acid sequence), SEQ ID No. 44 (CDR-L3 amino acid sequence), 23-A9 (containing SEQ ID No. 31 (CDR-L2 amino acid sequence), SEQ ID No. 42 (CDR-L2 amino acid sequence), SEQ ID No. 44 (CDR-L3 amino acid sequence)), SEQ ID No. 30-D7 (containing SEQ ID No. 33 (CDR-H1 amino acid sequence), SEQ ID No. 34 (CDR-H2 amino acid sequence), SEQ ID No. 45 (CDR-H3 amino acid sequence), SEQ ID No. 36 (CDR-L1 amino acid sequence), SEQ ID No. 47 (CDR-L2 amino acid sequence), SEQ ID No. 48 (CDR-L3 amino acid sequence), SEQ ID No. 49 (CDR-H1 amino acid sequence), SEQ ID No. 40 (CDR-H2 amino acid sequence), SEQ ID No. 41 (CDR-H3 amino acid sequence), SEQ ID No The amino acid sequences of SEQ ID No. 45 (CDR-H1), SEQ ID No. 46 (CDR-H2), SEQ ID No. 47 (CDR-H3), SEQ ID No. 48 (CDR-L1), SEQ ID No. 49 (CDR-L2), and SEQ ID No. 50 (CDR-L3), and 11-C10 (containing the amino acid sequences of SEQ ID No. 51 (CDR-H1), SEQ ID No. 52 (CDR-H2), and SEQ ID No. 45 (CDR-H1), SEQ ID No. 46 (CDR-H2), and SEQ ID No. 47 (CDR-H3), respectively).The amino acid sequences of SEQ ID No. 53 (CDR-H3), SEQ ID No. 54 (CDR-L1), SEQ ID No. 55 (CDR-L2), and SEQ ID No. 56 (CDR-L3), 23-F9 (containing the amino acid sequences of SEQ ID No. 57, SEQ ID No. 58, SEQ ID No. 59, SEQ ID No. 60, SEQ ID No. 61, and SEQ ID No. 62), and 11-C4 (containing the amino acid sequences of SEQ ID No. 63, SEQ ID No. 64, SEQ ID No. 65, and SEQ ID No. 66, and SEQ ID No. 57, SEQ ID No. 58, SEQ ID No. 59, SEQ ID No. 60, SEQ ID No. 61, and SEQ ID No. 62, respectively), are listed below. The amino acid sequences of SEQ ID No. 67 (CDR-L2 amino acid sequence), SEQ ID No. 70 (CDR-H2 amino acid sequence), SEQ ID No. 71 (CDR-H3 amino acid sequence), SEQ ID No. 72 (CDR-L1 amino acid sequence), SEQ ID No. 73 (CDR-L2 amino acid sequence), and SEQ ID No. 74 (CDR-L3 amino acid sequence) are listed. The amino acid sequences of SEQ ID No. 75 (CDR-H1 amino acid sequence), SEQ ID No. 76 (CDR-H2 amino acid sequence), SEQ ID No. 77 (CDR-H3 amino acid sequence), SEQ ID No. 78 (CDR-L1 amino acid sequence), SEQ ID No. 79 (CDR-L2 amino acid sequence), and SEQ ID No. 80 (CDR-L3 amino acid sequence) are also listed.

[0095] In the context of this invention, the resulting and described antibodies may be used and claimed as complete human monoclonal antibodies or any functional fragment or antigen-binding fragment thereof. Preferably, the antibody or any kind of functional fragment or antigen-binding fragment thereof shall contain at least complementarity-determining regions (CDRs) 1 to 3 of the antibody heavy chain and CDRs 1 to 3 of the light chain.

[0096] The CDR region of the antibody sequence described in this article is preferably defined according to the IMGT numbering scheme, which is an adaptation of the Chothia numbering scheme (ImMunoGeneTics Information System®; Lefranc et al., 1999); http: / / imgt.org ).

[0097] Based on common knowledge and the information provided herein regarding the amino acid sequences of the heavy chain variable region and the light chain variable region of the antibody of the present invention, those skilled in the art can easily and without doubt determine the CDR.

[0098] According to a preferred embodiment of the present invention, the light chain and heavy chain variable region sequences of the preferred antibodies and their antigen-binding fragments having internal designations 30-D9, 30-B8, 30-D7, 11-A6, 23-A9, 11-C10, 23-F9, 11-C4, 30-B9 and 30-C9 described herein are as follows:

[0099] According to one embodiment of the present invention, the antibody or its antigen-binding fragment comprises the heavy chain variable region amino acid sequence of antibody 30-D9 (SEQ ID No. 1), or the heavy chain variable region amino acid sequence of antibody 30-B8 (SEQ ID No. 3), or the heavy chain variable region amino acid sequence of antibody 30-D7 (SEQ ID No. 5), or the heavy chain variable region amino acid sequence of antibody 11-A6 (SEQ ID No. 7), or the heavy chain variable region amino acid sequence of antibody 23-A9 (SEQ ID No. 9), or the heavy chain variable region amino acid sequence of antibody 11-C10 (SEQ ID No. 11), or the heavy chain variable region amino acid sequence of antibody 23-F9 (SEQ ID No. 13), or the heavy chain variable region amino acid sequence of antibody 11-C4 (SEQ ID No. 15), or the heavy chain variable region amino acid sequence of antibody 30-B9 (SEQ ID No. 17), or the heavy chain variable region amino acid sequence of antibody 30-C9 (SEQ ID No. 19).

[0100] According to embodiments of the present invention, the antibody or its antigen-binding fragment comprises the amino acid sequence of the light chain variable region of antibody 30-D9 (SEQ ID No. 2), or the amino acid sequence of the light chain variable region of antibody 30-B8 (SEQ ID No. 4), or the amino acid sequence of the light chain variable region of antibody 30-D7 (SEQ ID No. 6), or the amino acid sequence of the light chain variable region of antibody 11-A6 (SEQ ID No. 8), or the amino acid sequence of the light chain variable region of antibody 23-A9 (SEQ ID No. 10), or the amino acid sequence of the light chain variable region of antibody 11-C10 (SEQ ID No. 12), or the amino acid sequence of the light chain variable region of antibody 23-F9 (SEQ ID No. 14), or the amino acid sequence of the light chain variable region of antibody 11-C4 (SEQ ID No. 16), or the amino acid sequence of the light chain variable region of antibody 30-B9 (SEQ ID No. 181), or the amino acid sequence of the light chain variable region of antibody 30-C9 (SEQ ID No. 20).

[0101] According to a preferred embodiment of the present invention, the antibody comprises the heavy chain variable region amino acid sequence of SEQ ID No. 1 and the light chain variable region amino acid sequence of SEQ ID No. 2, or the antibody comprises the heavy chain variable region amino acid sequence of SEQ ID No. 3 and the light chain variable region amino acid sequence of SEQ ID No. 4, or the antibody comprises the heavy chain variable region amino acid sequence of SEQ ID No. 5 and the light chain variable region amino acid sequence of SEQ ID No. 6, or the antibody comprises the heavy chain variable region amino acid sequence of SEQ ID No. 7 and the light chain variable region amino acid sequence of SEQ ID No. 8, or the antibody comprises the heavy chain variable region amino acid sequence of SEQ ID No. 9 and the light chain variable region amino acid sequence of SEQ ID No. 10, or the antibody comprises the heavy chain variable region amino acid sequence of SEQ ID No. 11 and the light chain variable region amino acid sequence of SEQ ID No. 12, or the antibody comprises the heavy chain variable region amino acid sequence of SEQ ID No. 13 and the light chain variable region amino acid sequence of SEQ ID No. 14, or the antibody comprises SEQ ID No. 14. The antibody comprises the heavy chain variable region amino acid sequence of SEQ ID NO: 15 and the light chain variable region amino acid sequence of SEQ ID NO: 16, or the antibody comprises the heavy chain variable region amino acid sequence of SEQ ID NO: 17 and the light chain variable region amino acid sequence of SEQ ID NO: 18, or the antibody comprises the heavy chain variable region amino acid sequence of SEQ ID NO: 19 and the light chain variable region amino acid sequence of SEQ ID NO: 20.

[0102] According to a specific embodiment of the present invention, the antibody is composed of two heavy chains of sequence SEQ ID No. 1 and two light chains of sequence SEQ ID No. 2, or the antibody is composed of two heavy chains of sequence SEQ ID No. 3 and two light chains of sequence SEQ ID No. 4, or the antibody is composed of two heavy chains of sequence SEQ ID No. 5 and two light chains of sequence SEQ ID No. 6, or the antibody is composed of two heavy chains of sequence SEQ ID No. 7 and two light chains of sequence SEQ ID No. 8, or the antibody is composed of two heavy chains of sequence SEQ ID No. 9 and two light chains of sequence SEQ ID No. 10, or the antibody is composed of two heavy chains of sequence SEQ ID No. 11 and two light chains of sequence SEQ ID No. 12, or the antibody is composed of two heavy chains of sequence SEQ ID No. 13 and two light chains of sequence SEQ ID No. 14, or the antibody is composed of two heavy chains of sequence SEQ ID No. 15 and two light chains of sequence SEQ ID No. 16. The antibody may be composed of two heavy chains of sequence SEQ ID No. 17 and two light chains of sequence SEQ ID No. 18, or the antibody may be composed of two heavy chains of sequence SEQ ID No. 19 and two light chains of sequence SEQ ID No. 20.

[0103] According to a preferred embodiment of the present invention, the CDR sequences of the light chain and heavy chain variable regions of the antibody and its antigen-binding fragment described herein are as follows:

[0104] According to a preferred embodiment of the present invention, the antibody that is the source of the sequence contained in the antibody or its antigen-binding fragment according to the present invention is selected from the group comprising 30-D9, 30-B8, 30-D7, 11-A6, 23-A9 and 11-C10, preferably from an antibody comprising 30-D9, 30-B8, 30-D7 and 11-A6, more preferably from an antibody comprising 30-D9 and 30-B8, and particularly preferably antibody 30-B8.

[0105] In another embodiment of the present invention, the antibody that serves as the source of the sequence contained in the antibody of the present invention is 30-D9. In another embodiment of the present invention, the antibody that serves as the source of the sequence contained in the antibody of the present invention is 30-B8. In one embodiment of the present invention, the antibody that serves as the source of the sequence contained in the antibody of the present invention is 30-D7. In another embodiment of the present invention, the antibody that serves as the source of the sequence contained in the antibody of the present invention is 11-A6.

[0106] According to another preferred embodiment of the invention, the antibody or its antigen-binding fragment targets a protein of the type III secretion system of Pseudomonas aeruginosa, preferably the PcrV protein of Pseudomonas aeruginosa (UniProt accession number G3XD49).

[0107] According to one embodiment of the invention, the amino acid sequence of the included CDR or variable region is derived from an antibody capable of being used in the cytotoxicity assay described in the specification at an IC50 concentration of up to 2 µg / ml, preferably up to 1 µg / ml, more preferably up to 0.3 µg / ml, even more preferably up to 0.2 µg / ml, and particularly preferably up to 0.1 µg / ml. 50 Inhibits the cytotoxicity of Pseudomonas aeruginosa wild-type strain PAO1.

[0108] According to the present invention, for determining IC 50 The neutralization determination of the value was performed by a series of dilution experiments, as described in the examples below. In vitro neutralizing effect of human anti-PcrV antibody against Pseudomonas aeruginosa As stated in the text.

[0109] Generally, the antibodies or antigen-binding fragments described herein also include at least 80% identical antibody amino acid sequences to the above sequences, provided that they still target proteins of the type III secretion system of Pseudomonas aeruginosa, preferably as long as they still target the PcrV protein of Pseudomonas aeruginosa.

[0110] According to another embodiment, the antibody or its antigen-binding fragment does not exhibit autoreactivity defined as detectable binding when tested against permeabilized HEp-2 cells using an antinuclear antibody (ANA) assay kit (NOVA-Lite HEp-2 ANA kit; Inova Diagnostics) at a concentration of 100 pg / ml.

[0111] The sequence variations covered herein are intended to include sequences with minor mutations (i.e., conserved mutations) in the antibody amino acid sequence that do not interfere with the structural folding of the antibody or its affinity for proteins of the type III secretion system of Pseudomonas aeruginosa. Preferably, amino acid sequence deviations resulting in at least 80%, 85%, 90%, or 95% overall identity with a single sequence explicitly disclosed herein exist only outside the CDR region of the antibody according to the invention and are covered herein as part of the invention. In particular, the invention covers antibody amino acid sequences having 1, 2, 3, 4, 5, or 6 mutations within the antibody constant region.

[0112] The antibodies according to the present invention are preferably of human origin. Therefore, at least the sequences outside the CDR (such as the frame region and constant region) in the antibody are preferably of human origin or attributable to human origin. Furthermore, the antibodies of the present invention are preferably monoclonal antibodies.

[0113] In a preferred embodiment, the antibody is a monoclonal antibody or a fragment thereof, which retains its binding specificity and ability to neutralize infectious pathogens. In a preferred embodiment, the antibody is an IgG1, IgG2, IgG3, or IgG4 antibody. For example, the antibody may be an antibody containing an Fc domain of any human IgG subtype (such as IgG1, IgG2, IgG3, or IgG4).

[0114] Optionally, the antigen-binding compound consists of Fab, Fab', Fab'-SH, F(ab)2, Fv, a biantibody, a single-chain antibody fragment, or a multispecific antibody containing multiple different antibody fragments, or a multispecific antibody containing Fab, Fab', Fab'-SH, F(ab)2, Fv, a biantibody, a single-chain antibody fragment, or a multispecific antibody containing multiple different antibody fragments.

[0115] In this invention, an antibody or antigen-binding fragment against Pseudomonas aeruginosa or PcrV of Pseudomonas aeruginosa means an antibody whose affinity for binding to PcrV of Pseudomonas aeruginosa is increased by at least 10 times, more preferably at least 50 times, and particularly preferably at least 100 times compared to unrelated epitopes, proteins, or protein regions.

[0116] For technicians, determining whether antibodies with a certain degree of similarity target Pseudomonas aeruginosa PcrV is a routine task based on the above content or common knowledge.

[0117] According to the present invention, the percentage identity between two sequences is determined by employing the mathematical algorithm of Karlin and Altschul (Karlin and Altschul, 1993). This algorithm is based on the BLASTN and BLASTP programs of Altschul et al. (Altschul et al., 1990). BLAST nucleotide searches are performed using the BLASTN program. To obtain vacancy alignments for comparison purposes, Gapped BLAST is used as described by Altschul et al. (Altschul et al., 1997). When using the BLAST and Gapped BLAST programs, the default parameters of each program are used.

[0118] According to a preferred embodiment of the present invention, the antibody amino acid sequence constitutes part of the present invention, which consists of a nucleic acid sequence that is at least 85% identical, more preferably at least 90% identical, or even more preferably at least 95% identical to the sequence defined above and disclosed herein, or contains a nucleic acid sequence that is at least 85% identical, more preferably at least 90% identical, or even more preferably at least 95% identical to the sequence defined above and disclosed herein.

[0119] In the description of this application, antibody designations may be used. It should be noted that antibodies consist of heavy and light chains, which is also part of this specification. If antibodies are referred to by antibody designations or SEQ ID No., it should be understood that these references are interchangeable.

[0120] The present invention further relates to pharmaceutical compositions comprising an antibody or antigen-binding fragment thereof as defined and further described herein, and at least one pharmaceutically acceptable excipient. The pharmaceutical composition may be a vaccination composition for human and / or animal subjects.

[0121] The present invention also covers kits comprising antibodies or antigen-binding fragments thereof as defined and further described herein, and containers.

[0122] In one aspect, the invention also relates to antibodies or antigen-binding fragments thereof as defined and further described herein, pharmaceutical compositions as described herein, and kits used as pharmaceuticals.

[0123] In another aspect, the present invention also relates to antibodies or antigen-binding fragments thereof as defined and further described herein, pharmaceutical compositions as described herein, and kits for treating Pseudomonas aeruginosa infection in mammalian subjects (preferably human subjects).

[0124] In one aspect, the invention also relates to antibodies or antigen-binding fragments thereof as defined and further described herein, pharmaceutical compositions as described herein, and kits for the prevention of Pseudomonas aeruginosa infection in mammalian subjects (preferably human subjects).

[0125] The antibodies and / or their antigen-binding fragments according to the invention may be administered to patients in need by intravenous injection or infusion, subcutaneous injection, intramuscular injection or inhalation, preferably by intravenous injection.

[0126] The dosage of the antibody of the present invention or its antigen-binding fragment to be administered to the subject may be varied depending on the severity of the symptoms exhibited by the subject and factors such as the subject's age, sex, and health status.

[0127] The antibody according to the invention can be administered to patients in need by inhalation. The antibody can be administered by inhalation, wherein the antibody is provided in the form of a liquid pharmaceutical composition and nebulized via a mesh nebulizer or a jet nebulizer prior to administration.

[0128] The pharmaceutical compositions of the present invention are formulated in a manner compatible with their intended route of administration. Examples of routes of administration include, but are not limited to, parenteral (e.g., intravenous, intradermal, subcutaneous), oral, intranasal (e.g., oral inhalation and inhalation), transdermal (e.g., topical), transmucosal, and rectal administration.

[0129] In specific embodiments, the composition is formulated according to conventional procedures to be suitable for intravenous, subcutaneous, intramuscular, oral, intranasal, or topical administration to humans. Typically, compositions for intravenous administration are solutions in sterile isotonic buffer solutions. If necessary, the composition may also include a solubilizer and a local anesthetic (such as lidocaine) to reduce pain at the injection site.

[0130] The methods of the present invention may include, for example, the administration of a nebulized composition to the lungs using an inhaler or nebulizer. See, for example, U.S. Patent Nos. 6,019,968, 5,985,320, 5,985,309, 5,934,272, 5,874,064, 5,855,913, 5,290,540, and 4,880,078; and PCT Publications WO 92 / 19244, WO 97 / 32572, WO 97 / 44013, WO 98 / 31346, and WO 99 / 66903, each of which is incorporated herein by reference in its entirety.

[0131] The method of the present invention may also include administering the composition formulated for parenteral administration by injection (e.g., by bolus or continuous infusion). The pharmaceutical formulation of the present invention may be provided in liquid form or in lyophilized form.

[0132] In one aspect, the present invention relates to nucleic acids encoding antibodies or antigen-binding fragments thereof as described herein.

[0133] In another aspect, the present invention relates to an expression vector comprising a nucleic acid as described herein, functionally linked to an expression control sequence.

[0134] In another aspect, the present invention relates to host cells comprising nucleic acids as described herein.

[0135] In one aspect, the present invention relates to host cells comprising expression vectors as described herein.

[0136] In another aspect, the present invention relates to a method for producing an antibody or antigen-binding fragment as described herein, comprising: (a) culturing a host cell as described herein under conditions that allow expression of the antibody or its antigen-binding fragment, and (b) recovering the antibody or its antigen-binding fragment.

[0137] In another aspect, the present invention also relates to the use of antibodies or antigen-binding fragments thereof according to the invention, or pharmaceutical compositions of the invention, in the manufacture of medicaments for treating diseases caused by Pseudomonas aeruginosa in human or animal subjects.

[0138] Unless a person skilled in the art considers a combination to be technically meaningless or excluded due to contradiction, all embodiments of the invention described and / or claimed herein are considered to be possible in any combination within the scope of the invention.

[0139] Example In vitro neutralizing effect of human anti-PcrV antibody against Pseudomonas aeruginosa To determine neutralizing activity, antibodies 30-D9, 30-B8, 30-D7, 11-A6, 23-A9, 11-C10, 23-F9, 11-C4, 30-B9, and 30-C9 at 5 µg / mL were screened in a hemolysis assay. As controls, hemolysis was measured using 5 µg / mL of PcrV-specific antibody 1F3 (US 2005 / 0063985 A1 / US 8,501,179 B2), bispecific PcrV-Psl antibody MEDI3902 (DiGiandomenico et al), polyclonal human antibody (IVIG), and 20 µg / mL gentamicin.

[0140] The humanized mouse anti-PcrV antibody 1F3, used as a reference antibody for comparing the neutralization efficiency of the antibodies of this invention, is disclosed as a best-in-class antibody in US Patent 8,501,179 B2, having a low IC50 of 5.3 nM or 4.0 nM. 50 (Depending on the cell type used to test neutralizing potency) (See US 8,501,179 B2, column 15, lines 28 and 33). A direct comparison between the reference antibody 1F3 and the antibody of this invention confirms the superiority of this invention over the prior art (see the table below). Figure 1 and Figure 4 ).

[0141] The antibody of this invention exhibits >50% inhibition of hemolysis and is identified as a highly neutralizing antibody. Further titration of the antibody was performed to determine the half-maximal inhibitory concentration (IC50). 50 ).

[0142] Here, the inhibitory effects of 12 different concentrations (50 µg / ml to 24 ng / ml) of the antibody were tested in a hemolysis assay using a 1:1 serial dilution. The percentage of hemolysis relative to the control (infected untreated cells) was calculated for each concentration, and dose-response curves were generated by plotting on a logarithmic x-axis (concentration) and a linear y-axis (percentage of hemolysis relative to the control). The IC50 value for each antibody was calculated using a variable slope model (four parameters). 50 Values. The results are shown in the table below.

[0143] In the A549 cytotoxicity assay, the neutralizing effect of the antibody was further tested at a concentration of 50 µg / mL. This was achieved by reacting A549 cells with T3SS-deficient PAO1F... Co-incubation with pscD strain (which has no effect on cell viability) confirmed T3SS-dependent lysis of the cells. Cell viability >50% (calculated relative to uninfected controls) indicated that the antibody inhibited bacterial-induced cell death. In this assay, neither mouse-derived antibody 1F3 nor IVIG protected cells from bacterial death. PA Mediated cell death. The three antibodies 30-D9, 30-B8, and 30-D7 provided near-complete protection (>90%) to cells, similar to treatment with the antibiotic gentamicin (30-B8: 90.45%, 30-D7: 91.83%, 30-D9: 96.42% vs. gentamicin: 95.41% viability). Results were... Figure 1 As shown in the table below.

[0144] A series of dilution experiments were performed to determine the IC50 of the antibody of the present invention. 50 The value was compared with 1F3 and MEDI3902 (gremubamab), the latter of which showed good activity in preclinical experiments but failed to prevent Pseudomonas aeruginosa-associated pneumonia in early clinical trials. The human PcrV antibody of the present invention is significantly superior to mouse-derived antibodies. MEDI3902 showed an IC50 value of 11.46 µg / mL. 50 Protect A549 cells from PA Induced cytotoxicity, while the most potent patient-derived antibody, 30-D9, showed an IC50 of 79.5 ng / mL. 50 Achieve a 144-fold improvement.

[0145] IC 50 The values ​​were calculated using a 1:1 serial dilution test at 12 different concentrations from 50 µg / ml to 24 ng / ml. RFU values ​​for each antibody at each concentration were plotted on a logarithmic x-axis (concentration) and a linear y-axis (RFU), forming a dose-response curve. IC50 values ​​for each antibody were also plotted. 50 The values ​​were calculated using a variable slope model (four parameters). The results are in... Figure 4 As shown in the table below.

[0146]

[0147] The anti-PcrV antibodies of the present invention did not show autoreactivity in the autoreactivity assay based on HEp-2 cells, while the mouse-derived PcrV mAb 1F3 showed moderate cytoplasmic autoreactivity (see [link to original text]). Figure 4 ).

[0148] In vitro neutralizing effect of human anti-PcrV antibody on drug-resistant clinical Pseudomonas aeruginosa isolates The neutralizing activity of anti-PcrV mAb 30-B8 against clinical isolates from patients with bloodstream infections was tested. Human mAb 30-B8 showed similar activity against clinical isolates, including those highly resistant to commonly used antibiotics, compared to the reference strain PAO1 (see [link to relevant documentation]). Figure 2 (A and 2B). To rule out any natural resistance mechanisms caused by mutations and to evaluate the efficacy spectrum of anti-PcrV mAb from high- and medium-sized patients in the clinical setting, 30 clinical isolates were analyzed. pcrV The gene was sequenced and compared with the reference strain PAO1. pcrV Gene sequence comparisons were performed. Silent mutations were detected in most isolates. A total of five different mutations were detected, resulting in amino acid alterations in PcrV. However, none of the observed mutations led to loss of function of the tested human anti-PcrV mAb 30-B8.

[0149] In vivo potency assay of patient-derived anti-PcrV mAb To evaluate the in vivo function and efficacy of human B cell-derived mAbs, the therapeutic efficacy of two highly neutralizing anti-PcrV mAbs, 30-B8 and 30-D9, was tested in a mouse model of pneumonia. CD-1 mice were first treated with cyclophosphamide four days and one day prior to infection to induce neutropenia, increasing susceptibility to *Pseudomonas aeruginosa* infection. Pneumonia was then induced by nebulized delivery of *P. aeruginosa* (Boston 41501 strain). Two hours later, anti-PcrV mAb (5 mg / kg), a vector control, or the conventional antimicrobial agent levofloxacin (100 mg / kg) were administered intraperitoneally. Mice were sacrificed 24 hours later, and bacterial load was determined by counting colony-forming units (CFU) in lung tissue homogenates. Treatment with patient-derived anti-PcrV mAbs 30-B8 and 30-D9 resulted in a significant reduction in bacterial load in the mouse lungs (see [link to relevant documentation]). Figure 3 A). For mAb 30-B8, its growth-inhibiting effect was comparable to that of levofloxacin treatment (mean CFU: control 1.00 × 10⁻⁶). 9 vs Levofloxacin 1.15×10 530-B8 4.59×10 3 30-D9 2.70×10 6 Furthermore, mAb treatment significantly reduced the systemic inflammatory response in infected animals, as evidenced by a marked decrease in plasma cytokine levels (mean IL-6 / TNF plasma concentrations: control 3362.54 / 27 ng / mL vs levofloxacin 54.88 / 3.15 ng / mL, 30-B8 15.92 / 0.84 ng / mL). Figure 6 Consistent with these findings, almost complete prevention of hemorrhagic infiltration was observed in lung sections of infected animals that received mAb treatment.

[0150] The prophylactic activity of the mAb was evaluated in a neutropenic thigh infection model. The antibody was administered intraperitoneally 2 hours before intramuscular injection of Pseudomonas aeruginosa into the lateral thigh, and endpoint analysis was performed 24 hours later. Treatment of mice with human anti-PcrV mAb significantly reduced bacterial load in tissues compared to the control antibody (MCA1; anti-MERS-CoV S glycoprotein antibody) (see [link to relevant documentation]). Figure 3 B). The efficacy of anti-PcrV mAb 30-B8 and 30-D9 was comparable to that of levofloxacin treatment (three doses post-infection vs. a single pre-infection dose of 5 mg / kg mAb). Compared to the pulmonary infection model, the systemic inflammatory response observed in this study was milder. However, both PcrV mAb treatment and levofloxacin treatment were found to reduce plasma IL-6 levels to the same extent.

[0151] Direct comparison with existing technology antibody H1H29336P According to reports, the existing PcrV antibody H1H29336P showed extremely low IC50 in the A549 cytotoxicity assay against Pseudomonas aeruginosa (for Pseudomonas aeruginosa strains 6077 and ATCC 700888; see Table 10 on page 69 of WO 2020 / 252029 A1). 50 value.

[0152] To evaluate and compare the human monoclonal antibody of the present invention with the reference antibody, a series of dilution experiments were performed to determine the IC50 of H1H29336P. 50 The value was compared directly with 30-B8 and 30-D9 (see [reference]). Figure 6 (and the results shown below).

[0153] In the infection experiment, the reference strain P. aeruginosa PAO1, which is commonly used in P. aeruginosa infection studies, was used (see Grace A, Sahu R, Owen DR, Dennis VA. Pseudomonas aeruginosa reference strains PAO1 and PA14: A genomic, phenotypic, and therapeutic review. Front Microbiol. 2022 Oct 13;13:1023523. doi: 10.3389 / fmicb.2022.1023523. PMID: 36312971; PMCID: PMC9607943.).

[0154] The results obtained by comparing H1H29336P with the antibody of the present invention are considered to be able to assess the efficacy and relative potency of the antibody of the present invention relative to H1H29336P and other reference antibodies disclosed in WO 2020 / 252029 A1.

[0155] In fact, H1H29336P showed significantly inferior efficacy compared to the representative antibodies 30-B8 and 30-D9 of this invention. In the comparative assay, the calculated IC50 of H1H29336P was... 50 The concentration is 9.14 µg / ml, wherein the IC50 of the representative antibody of this invention is... 50 Value more than 30 times lower: 30-D9 was 56.22 ng / ml (approximately 163 times lower ), 30-B8 was 195.9 ng / ml (approximately 47 times lower The experimental results are as follows: Figure 6 As shown.

[0156] Additional comparative data are provided for other antibodies of the present invention and are reported as follows: 30-D7 is 127.6 ng / ml (approximately...) 72 times lower ), 11-A6 was 223.3 ng / ml (approximately 41 times lower ), 23-F9 was 248.3 ng / ml (approximately 37 times lower ), 23-A9 was 262.7 ng / ml (compared to the reference antibody H1H29336P). Approximately 35 times lower ).

[0157] It should be noted that in WO 2020 / 252029 A1, the competitive antibody REGN3514 (also known as MEDI3902) was used, as cited in WO 2013 / 070615 (see WO 2020 / 252029 A1, page 63, paragraph

[00227] ). The A549 cytotoxicity assay revealed that REGN3514 had an IC50 of [missing information] against Pseudomonas aeruginosa strain 6077. 50 The value is 8.07 × 10 - ¹ 0 M, IC50 against Pseudomonas aeruginosa strain ATCC 700888 50 The value is 1.784 × 10 -8 M (see Table 10, paragraph

[00238] of WO 2020 / 252029 A1).

[0158] The values ​​obtained in the comparative experiments in Table 10 of WO 2020 / 252029 A1 were only surpassed by H1H29339P in both strains (24 times lower than Pseudomonas aeruginosa strain 6077 and 2.3 times lower than Pseudomonas aeruginosa strain ATCC 700888), and only by H1H29336P in Pseudomonas aeruginosa strain ATCC 700888 (2.8 times lower, WO 2020 / 252029A1, page 69).

[0159] Based on the infection experiment of Pseudomonas aeruginosa strain PAO1 ( Figure 4 (Example shown in the text) Newly generated data and the IC of MEDI3902 (as exemplarily illustrated) 50 In comparison, the representative antibody of this invention outperformed MEDI3902 in the PAO1 infection experiment, with a fold increase ranging from 25 to 204 times (11-A6 = 51 times higher, 11-C10 = 25 times higher, 23-A9 = 44 times higher, 23-F9 = 46 times higher, 30-B8 = 59 times higher, 30-D7 = 90 times higher, 30-D9 = 204 times higher).

[0160] The data clearly demonstrates the unprecedented neutralizing potency and broad spectrum of the antibodies described above, and it can be concluded that all antibodies according to the present invention exhibit surprisingly improved properties compared to any and all antibodies in the prior art.

[0161] Method details Separation of serum and PBMCs from whole blood Serum collection tubes (Sarstedt, Nuembrecht, Germany) were centrifuged at 3800×g for 10 minutes at 4°C to separate serum from clotted blood. The serum was inactivated by heating at 56°C for 30 minutes and then stored at -80°C. PBMCs were collected in Compoflex® CPDA-1 blood bags (Fresenius, Bad Homburg, Germany). Cytiva Ficoll was used. ® PBMCs were purified by density gradient centrifugation using Paque (GE Healthcare, Chicago, USA) and Leucosep™ tubes (Greiner, Kremsmuenster, Austria). Cells were then stored at -150°C in FBS (Thermo Fisher Scientific, Waltham, MA, USA) containing 10% (v / v) dimethyl sulfoxide (DMSO) (Merck, Darmstadt, Germany).

[0162] Bacterial strains and cultures of Pseudomonas aeruginosa In vitro experiments used Pseudomonas aeruginosa strains PAO1 and PAO2. pscD PA14 and clinical strains. All clinical strains were isolated from patients with bloodstream infections. In the infection experiments, we will use bacteria (in...) The culture (stored in glycerol stock solution at 80°C) was inoculated into 5 mL of LB medium (Carl Roth, Karlsruhe, Germany) and incubated with shaking at 37°C. The next day, the culture was transferred to fresh LB medium and adjusted to the optical density (OD). 600 The value was set at 0.2. The culture was then incubated at 37°C / 200 rpm until exponential growth (OD) was achieved. 600 0.8–1.5). Wash cultures twice with Dulbecco phosphate-buffered saline (DPBS) (Thermo Fisher Scientific) prior to infection.

[0163] Hemolysis test Human erythrocytes from healthy donors were washed four times with Dulbecco phosphate-buffered saline (DPBS) to remove residual serum components and diluted to a final concentration of 2.5 × 10⁶ cells / mL. 100 µL of the suspension was added to 96-well plates and infected with bacteria of multiplicity of infection (MOI) 1 (2.5 × 10⁶ bacteria / mL in DPBS). The plates were then centrifuged at 1000 × g for 5 min and incubated at 37 °C for 2 h. After 2 hours, the cells were resuspended and followed by centrifugation at 1500 × g for 10 min. 100 µL of supernatant was transferred from each well to a new plate, and the OD at 540 nm was measured using a microplate reader.

[0164] Recombinant expression and isolation of PcrV Genomic DNA was isolated from strain PAO1 using the DNeasy® Blood & Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Phusion high-fidelity polymerase (Thermo Fisher Scientific) and primer pairs were used. fwd TCACCATCACGGATCCGAAGTCAGAAAACCTTAATG and rev TCAGCTAATTAAG CTTCTA GATCGCGCTGAGAATG Amplification pcrV Genes. After digesting the expression vector (pQE80, Qiagen) with restriction enzymes BamHI and HindIII (both from NEB, Ipswich, MA, USA), purified PCR products were cloned into the expression vector using the Takara Bio (Kusatsu, Japan) In-Fusion® HD EcoDry™ Cloning Kit and Stellar cells. Clones were selected on ampicillin-supplemented agar plates (Sigma-Aldrich, St. Louis, MO, USA) and validated by sequencing. pcrV Correct insertion of the gene into the expression vector. Colonies containing the vector were cultured in liquid medium. The plasmid was isolated using the QIAprep® Spin Miniprep kit (Qiagen), transformed into BL21 *E. coli* competent cells via heat shock, and selected on ampicillin agar plates. Single colonies were selected, incubated overnight in LB broth, and then transferred to fresh LB broth. At OD... 600Once the concentration reached 0.5, 300 µM IPTG (isopropyl-β-D-thiogalactopyranoside) (Sigma-Aldrich) was added, and the bacteria were incubated at 30°C with shaking for 3 hours. Subsequently, the bacteria were centrifuged at 4000×g for 5 minutes and lysed using the B-PER™ bacterial protein extraction reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. Recombinant PcrV was separated using HisPur™ Ni-NTA resin (Thermo Fisher Scientific) via gravity flow column (Carl Roth). Briefly, the bacterial lysate was equilibrated with 15 mM imidazole (Sigma-Aldrich) and added to a gravity column containing Ni-NTA resin. After multiple washes with phosphate-buffered saline (PBS) containing 25 mM imidazole, the His-labeled PcrV was released using 250 mM imidazole, and the buffer was replaced with PBS using a 10 kDa centrifugal filter (Sigma-Aldrich). The purity of recombinant PcrV was determined by SDS-PAGE using 4-12% Bis-Tris protein gel (Thermo Fisher Scientific) and InstantBlue™ protein staining agent (Expedeon, Heidelberg, Germany).

[0165] Determination of anti-PcrV titer in serum High-binding 96-well ELISA plates (Corning Inc., Corning, NY, USA) were coated overnight at 4°C with recombinant PcrV protein (2 µg / mL) in ELISA coating buffer (Biolegend, San Diego, CA, USA). The plates were washed four times with PBS / 0.05% Merck (PBST) and blocked for 120 minutes at room temperature with PBS containing 5% BSA (Sigma-Aldrich). Serially diluted serum in PBS / 5% BSA was then added at room temperature and incubated for 60 minutes. After washing with PBST, the plates were incubated for 60 minutes at room temperature with horseradish peroxidase-conjugated goat anti-human IgG antibody (Jackson ImmunoResearch West Grove, PA, USA; 1:2500 in PBS / 5% BSA). The ELISA was developed using 3,3',5,5'-tetramethylbenzidine (TMB) (ThermoFisher Scientific). After 15 minutes, sulfuric acid (Carl Roth) was added, and the absorbance was measured at 450 nm using a multi-mode microplate reader (Hidex, Turku, Finland).

[0166] Isolation of PcrV-specific B cells CD19 in PBMCs was enriched using CD19 microbeads (Miltenyi Biotec, Bergisch-Gladbach, Germany) according to the manufacturer's instructions. + Cells. After washing with FACS buffer, the cells were centrifuged to pellet and blocked in 10% FCS for 30 min. The cells were then resuspended in a solution containing 4',6-bisamidinyl-2-phenylindole (DAPI) (Thermo Fisher Scientific) (1:100), anti-human IgG-PE (clone: ​​G18-145) (BD Biosciences), and anti-human CD20-Alexa Fluor 700 (clone: ​​2H7) (Biolegend), PcrV. AF488 and PcrV AF647 Cells were incubated in 10 µg / mL FACS buffer at 4°C for 20 minutes. The cells were then washed with 15 mL of FACS buffer, centrifuged, and resuspended in 500 µL of FACS buffer. The cell suspension was used for further single-cell sorting into 96-well plates using BD FACSAria™ III (BD Biosciences). All wells contained 4 μL of lysis buffer (composed of PBS, 0.5 U / μL RNAsin (Promega), 0.5 U / μL RNaseOUT™ (Thermo Fisher Scientific), and 10 mM DTT (Thermo Fisher Scientific)). After sorting, the plates were immediately stored at -80°C until further processing.

[0167] Ig heavy / light chain amplification and sequence analysis As previously described, single-cell amplification of the antibody heavy and light chains was performed (Gieselmann et al., 2021). Briefly, cDNA was generated via reverse transcription using random hexamer primers and Superscript IV reverse transcriptase (both from Thermo Fisher Scientific) in the presence of RNaseOUT™ (Thermo Fisher Scientific) and RNasin® (Promega). The target sequence was amplified using a semi-nested PCR sequence employing Platinum™ Taq Hot Start polymerase (Thermo Fisher Scientific) and an optimized mixture of V gene-specific primers, followed by sequencing (Kreer et al., 2020). Sequences were annotated with IgBLAST and pruned to extract only the variable region from the FWR1 to the J gene ends (Ye et al., 2013). To identify clone-related sequences within individual subjects, the heavy chain sequences of that particular subject were grouped according to the same VH and VJ genes, and pairwise Levenshtein distances between CDRH3s within the VH / VJ groups were determined. If sequences share the same VH / VJ gene combination and have 75% minimum CDRH3 amino acid identity (as far as the shortest CDRH3 is concerned), they are assigned to the same clone. All clones were cross-validated by the researchers, taking into account shared mutations, IGHG isotypes, and light chain information where available.

[0168] Cloning and Production of PcrV-Specific mAbs Antibody cloning was performed on the first-generation PCR product as previously described. Q5 was used. ® Hot-start high-fidelity DNA polymerase (New England Biolabs) and specific primers for sequence-independent and ligation-independent cloning (SLIC) amplicones for cloning are generated from first-generation PCR. After purification (NucleoSpin) ®96 PCR Clean-up (Macherey-Nagel, Dueren, Germany) was performed using T4 DNA polymerase (New England Biolabs) and chemically competent *E. coli* DH5α (Tiller et al., 2008) to clone the target sequence into the expression vector via SLIC. After verifying positive clones by colony PCR and Sanger sequencing, the plasmid was amplified and purified from midi culture (Macherey-Nagel). Human heavy chain (IgG1 isotype) and light chain antibody expression plasmids were co-transfected into HEK293-6E cells using polyethyleneimine (PEI) (Sigma-Aldrich) and maintained at 37°C and 6% CO2 with constant shaking at 90–120 rpm in FreeStyle 293 expression medium (Thermo Fisher Scientific) containing 0.2% penicillin / streptomycin (Thermo Fisher Scientific). To isolate monoclonal antibodies, the supernatant was centrifuged seven days after transfection, filtered using a PES filter, and then conjugated with Protein G-conjugated Sepharose. ® Beads (GE Life Sciences) were incubated together. The beads were centrifuged, washed with PBS, and the antibody was eluted from the Protein G-conjugated beads in a chromatography column using 0.1 M glycine (pH=3) and buffered with 1 M Tris (pH=8). Amicon was used. ® Replace the buffer with PBS using a 30 kDa filter tube (Millipore). Determine antibody concentration using UV spectrophotometry (Nanodrop, Thermo Fisher Scientific) and store the antibody at 4°C until further use.

[0169] ELISA analysis was used to determine the binding activity of the antibody to PcrV. ELISA plates (Thermo Fisher Scientific) were coated overnight at 4°C with 2.5 μg / mL recombinant PcrV in PBS. The plates were blocked for 60 min at room temperature with 2.5% BSA and 2.5% dry milk powder in PBS / 0.05% Tween-20 (PBST), incubated for 120 min with primary antibody in 2.5% BSA and 2.5% dry milk powder in PBST, and then incubated for 60 min at room temperature with goat anti-human IgG-HRP (Southern Biotech) diluted 1:2000 in PBS. The plates were washed three times with PBST between each step. The ELISA plates were developed with ABTS solution (Thermo Fisher Scientific), and absorbance was measured at 415 nm and 695 nm. Positive binding was defined as a minimum top OD ≥ 0.2 and EC50. 50 ≤ 30 μg / mL.

[0170] A549 Cytotoxicity Assay Human lung epithelial cells (A549) (ATCC, Manassas, VA, USA) were seeded at a density of 2 × 10⁶ cells / mL in 100 μL of RPMI medium (ThermoFisher Scientific) containing 10% FBS in 96-well plates (TPP, Trasadingen, Switzerland) and incubated at 37°C and 5% CO₂. After 24 hours, the supernatant was removed, and the cells were infected with bacteria resuspended in RPMI / 10% FBS (100 μL / well). After 150 minutes, the cells were washed with RPMI, and 100 μL of RPMI / 10% FBS supplemented with 20 μg / mL gentamicin and 10 μg / mL moxifloxacin was added. After another 18 hours of incubation, 10 μL of resazurin (Sigma-Aldrich) was added, and the cells were incubated for 140 minutes. 560 nm / Em 590 nm Fluorescence was measured at a specific wavelength.

[0171] Clinical isolates pcrV sequencing According to the manufacturer's instructions, use DNeasy ® Bacterial genomic DNA was extracted using a kit (Qiagen). Amplification was performed using primer set fwd 5'-GCA GGG CGA GCA GGG TAC C-3' / 5'-GCC GAT GCG TGG CTT GTT G-3' and rev5'GCC TGT TGC TGG TCG GTG TC-3' / 5'-GCT GGT CGG TGT CGG AAG G-3'. pcrV Gene regions were sequenced (Microsynth Seqlab, Balgach, Switzerland).

[0172] In vivo infection experiment For a therapeutic pneumonia model, cyclophosphamide at 150 mg / kg and 100 mg / kg was administered intraperitoneally (ip) to female CD1 mice on days -4 and -1, respectively, to induce neutropenia. On day 0, neutropenia was induced by nebulization of 20 μl of 1.7 x 10 CFU / ml cyclophosphamide. PA Mice were infected (Boston 41501). Two hours later, mice were treated with 5 mg / kg mAb, 100 mg / kg levofloxacin, or a vector control. Two animals were used as inoculum control groups to control the bacterial load after nebulization. Mice were sacrificed 24 hours after pi for endpoint analysis. After blood separation, lungs and kidneys were removed, weighed, and homogenized in 3 mL of 0.9% NaCl. To determine CFU, the suspension of homogenized organs was serially diluted, plated on agar plates, and incubated overnight at 37°C. CFU was determined by manual counting. Plasma TNF and IL-6 were measured using commercial ELISA kits (both Thermo Fisher Scientific) according to the manufacturer's instructions. Human IgG concentrations were determined as described above.

[0173] Prophylactic methods were tested using a thigh infection model with neutropenia. Neutropenia was induced in male CD1 mice by intraperitoneal administration of cyclophosphamide at 150 mg / kg and 100 mg / kg on days -4 and -1, respectively. Antibody (5 mg / kg) was administered intraperitoneally 2 hours prior to infection. 1.2 x 10⁻⁶ CFU / ml was injected intramuscularly into each thigh (in 30 μl). PA (Boston 41501) Infection was initiated. As a control, levofloxacin (100 mg / kg) was administered at 2, 6, and 10 hours post-infection. To control the bacterial load after injection, six animals were used as inoculum control groups. For analgesia, all animals were subcutaneously injected with tramadol 20 mg / kg. The experiment was terminated 24 hours later, and whole blood was collected into tubes coated with 0.5 m EDTA and immediately centrifuged at 4°C, 13,000 rpm for 10 minutes. Plasma was transferred to new tubes and analyzed as described above. Infected muscle was removed, homogenized, and CFU was measured.

[0174] Microscopic analysis To determine autoreactivity, HepG2 cells (NOVA Lite HEp-2 ANA kit) (InovaDiagnostics, San Diego, CA, USA) were stained with 100 µg / mL mAb for 30 minutes at room temperature, followed by washing with PBS and labeling with FITC-conjugated anti-human IgG secondary antibody for 30 minutes. Stained slides were mounted and analyzed under a microscope. Each mAb was tested at least twice.

[0175] For histological analysis, mouse lungs were fixed in formalin for 24 hours and stored in 70% ethanol. The fixed lungs were embedded in paraffin, sectioned using a microtome, and stained with H&E. Slides were scanned using an S360 slide scanner (Hamamatsu Photonics, Hamamatsu, Japan), and images were generated using OMERO software (OME University of Dundee & OpenMicroscopy Environment). Alveolar space was quantified using ImageJ software by applying thresholds of 205 and 246, respectively. Alveolar space was quantified relative to total surface area.

[0176] Statistical analysis Statistical analysis was performed using GraphPad Prism 8.0.2 software (GraphPad). P Values ​​less than or equal to 0.05 were considered statistically significant. For comparisons among multiple groups, we used one-way or two-way ANOVA based on the dataset (homogeneity variance was tested for all groups). For comparisons between two groups, a t-test with Welsh correction was used. Box plots show the median, upper and lower quartiles, and minimum and maximum values. Data points represent biological replicates.

[0177] Direct comparison with antibody H1H29336P H1H29336P is expressed according to the sequence specified in the published international patent application WO 2020 / 252029 A1 (e.g., the full-length heavy chain amino acid sequence of SEQ ID NO: 69 and the full-length light chain amino acid sequence of SEQ ID NO: 70 disclosed in Table 3 on page 62 of WO 2020 / 252029 A1).

[0178] A549 cells were infected with wild-type Pseudomonas aeruginosa strain PAO1 at an MOI of 0.5 for 150 minutes in the presence of H1H29336P at doses ranging from 5 µg / ml to 9.77 ng / ml. As controls, the anti-PcrVmAb 30-B8 and 30-D9 of the present invention, as well as human polyclonal IgG (intravenous immunoglobulin (IVIG)), were tested at the corresponding concentrations.

[0179] Metabolic activity (as an indicator of A549 cell viability) was determined using resazurin (a cell-permeable, redox-sensitive fluorescent dye). Fluorescence was measured at Ex560 nm / Em590 nm wavelengths, with values ​​ranging from... Figure 6 The value is represented as relative fluorescence unit (RFU).

[0180] References 1. DiGiandomenico, Antonio, et al. "A multifunctional bispecificantibody protects against Pseudomonas aeruginosa." Science TranslationalMedicine 6.262 (2014): 262ra155-262ra155. 2. Bird, RE, et al. "Single-chain antibody-binding sites." Science242 (1988): 423-426. 3. Huston, James S., et al. "Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fvanalogue produced in Escherichia coli." Proceedings of the National Academy of Sciences 85.16 (1988): 5879-5883. 4. Ill, CR, et al. “Design and construction of a hybridimmunoglobulin domain with properties of both heavy and light chain variable regions.” Protein Engineering, Design and Selection, Volume 10, Issue 8, (1997): 949–957. 5. Holliger, Philipp, and Peter J. Hudson. "Engineered antibodyfragments and the rise of single domains." Nature biotechnology 23.9 (2005):1126-1136. 6. Lonberg, Nils. "Human antibodies from transgenic animals." Naturebiotechnology 23.9 (2005): 1117-1125. 7. Ausubel, F. M. "In FM Ausubel et al. eds." Current protocols inmolecular biology. Greene Publication Associates and Wiley-Interscience, NewYork (1987). 8. Angal, S., et al. "A single amino acid substitution abolishes theheterogeneity of chimeric mouse / human (IgG4) antibody." Molecular immunology30.1 (1993): 105-108. 9. Kabat, E. A., et al. "Sequences of Proteins of ImmunologicalInterest, 5th edit." National Institutes of Health, Bethesda, MD (1991). 10. Chothia, Cyrus, and Arthur M. Lesk. "Canonical structures for thehypervariable regions of immunoglobulins." Journal of molecular biology 196.4(1987): 901-917. 11. Lefranc, Marie-Paule, et al. "IMGT, the internationalImMunoGeneTics database." Nucleic acids research 27.1 (1999): 209-212. 12. Karlin, Samuel, and Stephen F. Altschul. "Applications andstatistics for multiple high-scoring segments in molecular sequences."Proceedings of the National Academy of Sciences 90.12 (1993): 5873-5877. 13. Altschul, Stephen F., et al. "Basic local alignment search tool."Journal of molecular biology215.3 (1990): 403-410. 14. Altschul, Stephen F., et al. "Gapped BLAST and PSI-BLAST: a newgeneration of protein database search programs." Nucleic acids research 25.17(1997): 3389-3402. 15. Gieselmann, L., Kreer, C., Ercanoglu, M.S., Lehnen, N., Zehner,M., Schommers, P., Potthoff, J., Gruell, H., and Klein, F. (2021). Effectivehigh-throughput isolation of fully human antibodies targeting infectiouspathogens. Nat Protoc 16, 3639-3671. 10.1038 / s41596-021-00554-w. 16. Kreer, C., Doring, M., Lehnen, N., Ercanoglu, M.S., Gieselmann,L., Luca, D., Jain, K., Schommers, P., Pfeifer, N., and Klein, F. (2020).openPrimeR for multiplex amplification of highly diverse templates. J ImmunolMethods 480, 112752. 10.1016 / j.jim.2020.112752. 17. Ye, J., Ma, N., Madden, T.L., and Ostell, J.M. (2013). IgBLAST:an immunoglobulin variable domain sequence analysis tool. Nucleic Acids Res41, W34-40. 10.1093 / nar / gkt382. 18. Tiller, T., Meffre, E., Yurasov, S., Tsuiji, M., Nussenzweig,M.C., and Wardemann, H. (2008). Efficient generation of monoclonal antibodiesfrom single human B cells by single cell RT-PCR and expression vectorcloning. J Immunol Methods 329, 112-124. 10.1016 / j.jim.2007.09.017.

Claims

1. Targeting Pseudomonas aeruginosa ( Pseudomonas aeruginosa An antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment comprises a combination of the heavy chain CDR1 to CDR3 and the light chain CDR1 to CDR3 amino acid sequences of an antibody selected from the group consisting of: 30-D9 (containing the CDR-H1 amino acid sequence of SEQ ID No. 21, the CDR-H2 amino acid sequence of SEQ ID No. 22, the CDR-H3 amino acid sequence of SEQ ID No. 23, the CDR-L1 amino acid sequence of SEQ ID No. 24, the CDR-L2 amino acid sequence of SEQ ID No. 25, and the CDR-L3 amino acid sequence of SEQ ID No. 26), 30-B8 (containing the CDR-H1 amino acid sequence of SEQ ID No. 27, the CDR-H2 amino acid sequence of SEQ ID No. 28, the CDR-H3 amino acid sequence of SEQ ID No. 29, the CDR-L1 amino acid sequence of SEQ ID No. 30, the CDR-L2 amino acid sequence of SEQ ID No. 31, and the CDR-L3 amino acid sequence of SEQ ID No. 32), 30-D7 (containing the CDR-H1 amino acid sequence of SEQ ID No. 33, the CDR-H2 amino acid sequence of SEQ ID No. 34, the CDR-H3 amino acid sequence of SEQ ID No. 35, the CDR-L1 amino acid sequence of SEQ ID No. 36, the CDR-L2 amino acid sequence of SEQ ID No. 37, and the CDR-L3 amino acid sequence of SEQ ID No. 38), 11-A6 (containing the CDR-H1 amino acid sequence of SEQ ID No. 39, the CDR-H2 amino acid sequence of SEQ ID No. 40, the CDR-H3 amino acid sequence of SEQ ID No. 41, the CDR-L1 amino acid sequence of SEQ ID No. 42, the CDR-L2 amino acid sequence of SEQ ID No. 43, and the CDR-L3 amino acid sequence of SEQ ID No. 44), 23-A9 (containing the CDR-H1 amino acid sequence of SEQ ID No. 45, the CDR-H2 amino acid sequence of SEQ ID No. 46, the CDR-H3 amino acid sequence of SEQ ID No. 47, the CDR-L1 amino acid sequence of SEQ ID No. 48, the CDR-L2 amino acid sequence of SEQ ID No. 49, and the CDR-L3 amino acid sequence of SEQ ID No. 50), 11-C10 (containing the CDR-H1 amino acid sequence of SEQ ID No. 51, the CDR-H2 amino acid sequence of SEQ ID No. 52, the CDR-H3 amino acid sequence of SEQ ID No. 53, the CDR-L1 amino acid sequence of SEQ ID No. 54, the CDR-L2 amino acid sequence of SEQ ID No. 55, and the CDR-L3 amino acid sequence of SEQ ID No. 56), 23-F9 (containing the CDR-H1 amino acid sequence of SEQ ID No. 57, the CDR-H2 amino acid sequence of SEQ ID No. 58, the CDR-H3 amino acid sequence of SEQ ID No. 59, the CDR-L1 amino acid sequence of SEQ ID No. 60, the CDR-L2 amino acid sequence of SEQ ID No. 61, and the CDR-L3 amino acid sequence of SEQ ID No. 62), 11-C4 (containing the CDR-H1 amino acid sequence of SEQ ID No. 63, the CDR-H2 amino acid sequence of SEQ ID No. 64, the CDR-H3 amino acid sequence of SEQ ID No. 65, the CDR-L1 amino acid sequence of SEQ ID No. 66, the CDR-L2 amino acid sequence of SEQ ID No. 67, and the CDR-L3 amino acid sequence of SEQ ID No. 68), 30-B9 (containing the CDR-H1 amino acid sequence of SEQ ID No. 69, the CDR-H2 amino acid sequence of SEQ ID No. 70, the CDR-H3 amino acid sequence of SEQ ID No. 71, the CDR-L1 amino acid sequence of SEQ ID No. 72, the CDR-L2 amino acid sequence of SEQ ID No. 73, and the CDR-L3 amino acid sequence of SEQ ID No. 74), and 30-C9 (containing the CDR-H1 amino acid sequence of SEQ ID No. 75, the CDR-H2 amino acid sequence of SEQ ID No. 76, the CDR-H3 amino acid sequence of SEQ ID No. 77, the CDR-L1 amino acid sequence of SEQ ID No. 78, the CDR-L2 amino acid sequence of SEQ ID No. 79, and the CDR-L3 amino acid sequence of SEQ ID No. 80).

2. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment thereof comprises a combination of a variable region heavy chain amino acid sequence and a variable region light chain amino acid sequence selected from the group consisting of: 30-D9 (containing the variable region heavy chain amino acid sequence of SEQ ID No. 1 and the variable region light chain amino acid sequence of SEQ ID No. 2). 30-B8 (containing the variable region heavy chain amino acid sequence of SEQ ID No. 3 and the variable region light chain amino acid sequence of SEQ ID No. 4), 30-D7 (containing the variable region heavy chain amino acid sequence of SEQ ID No. 5 and the variable region light chain amino acid sequence of SEQ ID No. 6), 11-A6 (containing the variable region heavy chain amino acid sequence of SEQ ID No. 7 and the variable region light chain amino acid sequence of SEQ ID No. 8), 23-A9 (containing the variable region heavy chain amino acid sequence of SEQ ID No. 9 and the variable region light chain amino acid sequence of SEQ ID No. 10). 11-C10 (containing the variable region heavy chain amino acid sequence of SEQ ID No. 11 and the variable region light chain amino acid sequence of SEQ ID No. 12), 23-F9 (containing the variable region heavy chain amino acid sequence of SEQ ID No. 13 and the variable region light chain amino acid sequence of SEQ ID No. 14), 11-C4 (containing the variable region heavy chain amino acid sequence of SEQ ID No. 15 and the variable region light chain amino acid sequence of SEQ ID No. 16), 30-B9 (containing the variable region heavy chain amino acid sequence of SEQ ID No. 17 and the variable region light chain amino acid sequence of SEQ ID No. 18), and 30-C9 (containing the variable region heavy chain amino acid sequence of SEQ ID No. 19 and the variable region light chain amino acid sequence of SEQ ID No. 20).

3. The antibody or antigen-binding fragment thereof according to claim 1 or 2, wherein the amino acid sequence comprises an amino acid sequence selected from the group consisting of 30-D9, 30-B8, 30-D7, 11-A6, 23-A9 and 11-C10, preferably an amino acid sequence selected from the group consisting of 30-D9, 30-B8, 30-D7 and 11-A6, more preferably an amino acid sequence selected from the group consisting of 30-D9 and 30-B8, and particularly preferably an amino acid sequence of antibody 30-B8.

4. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, wherein the antibody or antigen-binding fragment thereof targets a protein of the type III secretion system of Pseudomonas aeruginosa, preferably targeting the PcrV protein of Pseudomonas aeruginosa (UniProt accession number G3XD49).

5. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, wherein the amino acid sequence of the CDR or variable region contained therein is derived from an antibody capable of achieving an IC50 concentration of up to 2 µg / ml, preferably up to 1 µg / ml, more preferably up to 0.3 µg / ml, even more preferably up to 0.2 µg / ml, and particularly preferably up to 0.1 µg / ml in an IC50 assay as described in the specification. 50 Inhibits Pseudomonas aeruginosa wild-type strain PAO1.

6. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 5, wherein the amino acid sequence of the CDR or variable region contained therein is derived from an antibody capable of inhibiting cell death induced by Pseudomonas aeruginosa strain PAO1 in an assay described in the specification to obtain at least 80% viability, preferably at least 84% viability, more preferably at least 90% viability, and particularly preferably at least 95% viability compared to an uninfected control.

7. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 6, wherein the antibody or antigen-binding fragment thereof does not exhibit autoreactivity defined as detectable binding when tested against permeabilized HEp-2 cells using an antinuclear antibody (ANA) assay kit (NOVA-Lite HEp-2 ANA kit; InovaDiagnostics) at a concentration of 100 pg / ml.

8. A pharmaceutical composition comprising an antibody or an antigen-binding fragment thereof according to any one of claims 1 to 7 and at least one pharmaceutically acceptable excipient.

9. A kit comprising an antibody or an antigen-binding fragment thereof according to any one of claims 1 to 7, and a container.

10. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, the pharmaceutical composition according to claim 8, or the kit according to claim 9, used as a medicine.

11. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, the pharmaceutical composition according to claim 8, or the kit according to claim 9, for the treatment or prevention of Pseudomonas aeruginosa infection in mammalian subjects, preferably human subjects.

12. A nucleic acid encoding an antibody or an antigen-binding fragment thereof according to any one of claims 1 to 7.

13. An expression vector comprising the nucleic acid of claim 12 functionally linked to an expression control sequence.

14. A host cell comprising the nucleic acid according to claim 12 or the expression vector according to claim 13.

15. A method for producing an antibody or an antigen-binding fragment thereof according to any one of claims 1 to 7, comprising: (a) Culturing the host cells of claim 14 under conditions that allow expression of the antibody or its antigen-binding fragment, and (b) Recover the antibody or its antigen-binding fragment.

Images