Tgfb2-IRF5 therapeutic agents for cancer

By combining drugs that inhibit the expression of IRF5 and TGF-β2 with biomarkers to treat cancer, the limitations of existing anticancer drugs in efficacy and side effects have been addressed, resulting in more efficient and safer cancer treatment.

CN121773207APending Publication Date: 2026-03-31GMP BIOTECHNOLOGY LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-06-05
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Existing anticancer drugs have limited effectiveness, significant side effects, and high toxicity in treating cancer, necessitating the development of new agents and methods that can improve treatment outcomes and reduce side effects.

Method used

Using agents that inhibit the expression of IRF5 and TGF-β2, cancer is treated by combining IRF5 and TGF-β2 specific antisense oligonucleotides with biomarkers, in combination with chemotherapy and other standard care therapies, to selectively inhibit the growth of cancer cells.

Benefits of technology

It has significantly improved the effectiveness of cancer treatment, reduced toxic side effects, prolonged patient survival, and provided more precise treatment guidance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121773207A_ABST
    Figure CN121773207A_ABST
Patent Text Reader

Abstract

The present invention relates to agents, uses and methods for treating cancer using agents for inhibiting IRF5 expression. Synergistic therapies include agents, uses, and methods for treating cancer using agents for inhibiting IRF5 expression in combination with agents for inhibiting TGF-beta2 expression. In some embodiments, one or more biomarkers, including one or more of IFNGR2, JAK1, and STAT1, and TGF-beta 2 and IRF5, TLR9, FOXP3, CCL22, CREB5, CD8a, CD86, CC14, CD163, ITGAX, and CD11c, can be used to select a subject that can benefit from the method, agent, or use. The agents and compositions may be used in combination with chemotherapy and other standard care therapies.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] sequence list

[0002] This application includes a sequence list electronically submitted in the form of an ST.26 file, created on May 15, 2024, named 018988-015WO1_SL.xml, with a size of 904,128 bytes. Technical Field

[0003] This invention relates to agents, uses, and methods for treating cancer using agents that inhibit IRF5 expression. Co-treatment also includes agents, uses, and methods for treating cancer in combination with agents that inhibit IRF5 expression and agents that inhibit TGF-β2 expression. One or more biomarkers may be used to select subjects who will benefit from the methods, agents, or uses, said biomarkers including IFNGR2, JAK1, and STAT1, and one or more of TGF-β2 and IRF5, TLR9, FOXP3, CCL22, CREB5, CD8a, CD86, CC14, CD163, ITGAX, and CD11c. The agents and compositions may be used in combination with chemotherapy and other standard care therapies. Background Technology

[0004] Cancer is a complex pathology involving multiple different cellular pathways. Due to this complexity, many anticancer drugs have limited or partial therapeutic efficacy.

[0005] Disadvantages of conventional therapies include a lack of efficacy, as measured by overall survival.

[0006] Other drawbacks of conventional therapies include significant adverse side effects, such as killing healthy cells in addition to cancer cells.

[0007] Other drawbacks of anticancer drugs include high toxicity at the required therapeutic application levels.

[0008] What is needed are methods, agents, and uses for cancer treatment to increase efficacy and reduce toxicity and adverse side effects.

[0009] There is a need for therapeutic compositions of different agents to provide significant antitumor and cancer immunotherapy effects while minimizing side effects and adverse health impacts. There is an urgent need to improve guidance on the use of such compositions by selecting synergistic effects through the use of appropriate biomarkers. Summary of the Invention

[0010] This invention relates to agents, uses, and methods for treating cancer, used alone or in combination with other agents to inhibit or suppress IRF5 expression.

[0011] Embodiments of the present invention provide synergistic therapies, including agents, uses, and methods for treating cancer in combination with agents for inhibiting or suppressing IRF5 expression and agents for inhibiting or suppressing TGF-β2 expression.

[0012] This disclosure also covers the use of biomarkers to select subjects who will benefit from the methods, pharmaceuticals, or uses disclosed herein, said biomarkers including IFNGR2, JAK1, and STAT1, and one or more of TGF-β2 and IRF5, TLR9, FOXP3, CCL22, CREB5, CD8a, CD86, CC14, CD163, ITGAX, and CD11c.

[0013] The anticancer agents and compositions disclosed herein can also be used in combination with chemotherapy and other standard cancer care therapies.

[0014] In some implementations, the methods and treatment strategies of the present invention can improve the efficacy of cancer treatment and reduce toxic side effects and adverse health effects.

[0015] In other embodiments, the methods and treatment strategies of the present invention may use appropriate biomarkers to select for synergistic effects of the compositions, thereby improving therapy guidance.

[0016] The embodiments of the present invention include the following: A drug for inhibiting or suppressing IRF5 expression, used to treat or alleviate cancer symptoms in subjects.

[0017] Use of a composition containing an agent for inhibiting or suppressing IRF5 expression in the preparation of a medicament for treating or alleviating cancer symptoms in a subject.

[0018] A method for treating or alleviating cancer symptoms in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for inhibiting or suppressing IRF5 expression; and administering a therapeutically sufficient amount of the composition to the subject.

[0019] The above-mentioned drugs, uses, or methods, wherein the cancer is glioma, low-grade glioma, glioblastoma, diffuse intrinsic pontine glioma (DIPG), diffuse midline glioma (DMG), leptomeningeal or brain metastases, brain or spinal cord cancer, or CNS tumor.

[0020] The above-mentioned drugs, uses, or methods, wherein the cancer mentioned is pancreatic cancer.

[0021] The aforementioned pharmaceutical agents, uses, or methods include the use of one or more biomarkers to select subjects who will benefit from the pharmaceutical agent, use, or method, wherein said biomarkers are elevated levels of TGF-β2 and elevated levels of one or more of IFNGR2, JAK1, and STAT1.

[0022] The aforementioned pharmaceutical agents, uses, or methods include the use of one or more biomarkers to select subjects who will benefit from the pharmaceutical agent, use, or method, wherein the biomarker is a level of one or more of TGF-β2 and IRF5, TLR9, FOXP3, CCL22, CREB5, CD8a, CD86, CC14, CD163, ITGAX, and CD11c.

[0023] The above-described agents, uses, or methods, wherein the agent, drug, or application comprises one or more IRF5-specific antisense oligonucleotides that are complementary to the IRF5 transcript and have a length of 15-30 nucleotides.

[0024] The above-described agents, uses, or methods, wherein the agent, drug, or administration comprises one or more IRF5-specific antisense oligonucleotides that are complementary to IRF5 preRNA, premRNA, or mRNA and have a length of 18-21 nucleotides.

[0025] The above-described pharmaceutical preparations, uses, or methods, wherein the pharmaceutical preparation, drug, or application comprises one or more IRF5-specific antisense oligonucleotides complementary to the IRF5 transcript as shown in any of Tables 1, 2, and 3.

[0026] The above-described pharmaceutical agents, uses, or methods, wherein the pharmaceutical agent, drug, or administration contains the IRF5-specific antisense oligonucleotide CACACCTGATCAAATTTCTC SEQ ID NO: 1 or C A C A C C T G A T C A A A T T T C T CSEQ ID NO: 657.

[0027] The above-mentioned pharmaceutical preparations, uses, or methods include any of the IRF5-specific antisense oligonucleotides shown in Tables 1, 2, and 3, which have one or more nucleotides, said one or more nucleotides being chemically modified to be thiophosphate nucleoside linkages, methoxypropyl phosphate nucleoside linkages, aminophosphoside linkages linked to morpholine groups, 2'-OMe ribose groups, 2'-MOE methoxyethyl ribose groups, 2'-4'-restricted methoxyethyl bicyclic ribose groups, 2'-4'-restricted ethyl bicyclic ribose groups, LNA ribose groups, 2'-F ribose groups, or 5-methylcytosine bases.

[0028] The above-described pharmaceutical agent, use, or method, wherein the pharmaceutical agent is conjugated with polyethylene glycol, lipids, or tribranched N-acetyl-galactosamine.

[0029] The aforementioned pharmaceutical preparations, uses, or methods include carriers of sterile water for injection, saline, isotonic saline, phosphate-buffered saline, or combinations thereof.

[0030] The above-described pharmaceutical preparations, uses, or methods, wherein the pharmaceutical preparation, drug, or application is substantially free of excipients.

[0031] The above-described pharmaceutical preparations, uses, or methods, wherein the pharmaceutical preparation, drug, or administration thereof in a carrier is stable at 37°C for at least 14 days.

[0032] The above-described agents, uses, or methods, wherein the agents, drugs, or administration are combined with standard care treatment for cancer.

[0033] The above-described pharmaceutical agent, use, or method, wherein the pharmaceutical agent is administered by infusion, injection, or continuous intracranial infusion.

[0034] The above-mentioned pharmaceutical preparations, uses, or methods may include one or more other drugs, such as targeted cancer drugs, cancer growth inhibitors or EGFR inhibitors, erlotinib, gefitinib, afatinib, osimertinib, dacomitininb, and combinations thereof.

[0035] The above-mentioned pharmaceutical preparations, uses, or methods include any one or more other drugs that are targeted cancer drugs selected from bevacizumab, everolimus, belzutifan, dabrafenib, trametinib, and combinations thereof.

[0036] The above-mentioned agents, uses, or methods include any one or more other drugs, said other drugs being cancer growth inhibitors selected from angiogenesis inhibitors, histone deacetylase inhibitors, hedgehog factor inhibitors, mTOR inhibitors, p53 inhibitors, PARP inhibitors, proteasome inhibitors, tyrosine kinase inhibitors, and combinations thereof.

[0037] The above-mentioned pharmaceutical preparations, uses, or methods include any one or more additional drugs for the treatment of gliomas, said additional drugs being selected from TMZ, radiation, and bevacizumab; or include any one or more additional drugs for the treatment of pancreatic cancer, said additional drugs being selected from paclitaxel, gemcitabine, 5FU, leucovrin, nal-Irinotecan liposome, FOLFOX, FOLFIRI, FOLFIRINOX, and nal-FIRINOX.

[0038] The above-described agents, uses, or methods of administration, wherein the agent, drug, or administration reduces mortality in subjects at 6, 12, 18, 24, 30, or 36 months.

[0039] The above-described agents, uses, or methods, wherein the agent, drug, or administration improves the survival rate of subjects at 6, 12, 18, 24, 30, or 36 months.

[0040] A reagent kit comprising: the aforementioned pharmaceutical agent and a carrier.

[0041] A drug for inhibiting or suppressing IRF5 expression, in combination with a drug for inhibiting or suppressing TGF-β2 expression, is used to treat or alleviate cancer symptoms in a subject.

[0042] Use of a composition comprising a combination of an agent for inhibiting or suppressing IRF5 expression and an agent for inhibiting or suppressing TGF-β2 expression in the preparation of a medicament for treating or alleviating cancer symptoms in a subject.

[0043] A method for treating or alleviating cancer symptoms in a patient in need, the method comprising: preparing a pharmaceutical composition comprising a combination of an agent for inhibiting or suppressing IRF5 expression and an agent for inhibiting or suppressing TGF-β2 expression; and administering a therapeutically sufficient amount of the composition to a subject.

[0044] The above-mentioned drugs, uses or methods, wherein the cancer is glioma, low-grade glioma, glioblastoma, diffuse en bloc glioma (DIPG), diffuse midline glioma (DMG), leptomeningeal or brain metastases, brain or spinal cord cancer, or CNS tumor.

[0045] The above-mentioned drugs, uses, or methods, wherein the cancer is pancreatic cancer.

[0046] The aforementioned pharmaceutical agents, uses, or methods include the use of one or more biomarkers to select subjects who will benefit from the pharmaceutical agent, use, or method, wherein the biomarker is a level of TGF-β2 and one or more of IFNGR2, STAT1, IRF1, IRF5, CD276, and CD204.

[0047] The above-mentioned drugs, uses, or methods, wherein the cancer is a low-grade glioma, and the tumor cells exhibit wild-type IDH1 or IDH2, as well as one or more of the following: upregulated IFNGR2, upregulated STAT1, upregulated IRF1, upregulated IRF5, upregulated CD276, and upregulated CD204.

[0048] The above-mentioned pharmaceutical preparations, uses, or methods, wherein the IRF5 preparation, drug, or application comprises one or more IRF5-specific antisense oligonucleotides that are complementary to the IRF5 transcript and have a length of 15-30 nucleotides.

[0049] The above-mentioned agents, uses or methods, wherein the IRF5 agent, drug or administration comprises one or more IRF5-specific antisense oligonucleotides that are complementary to IRF5 preRNA, premRNA or mRNA and have a length of 18-21 nucleotides.

[0050] The above-mentioned pharmaceutical preparations, uses, or methods, wherein the IRF5 preparation, drug, or application comprises one or more IRF5-specific antisense oligonucleotides complementary to the IRF5 transcript as shown in any of Tables 1, 2, and 3.

[0051] The above-mentioned agents, uses, or methods, among which the agents used to inhibit or suppress IRF5 expression are YE6144 (S,E)-N1-(6-fluoro-3-(2-(6-morpholinopyridazine-3-yl)vinyl)-1H-indazol-5-yl)butane-1,2-diamine hydrochloride, IRF5 dimerization cell-penetrating peptide inhibitors, NLS peptide mimics, or bait peptides.

[0052] The above-mentioned agents, uses or methods, wherein the TGF-β2 agents, drugs or administrations contain one or more TGF-β2-specific antisense oligonucleotides that are complementary to the TGF-β2 transcripts and have a length of 15-30 nucleotides.

[0053] The above-mentioned agents, uses or methods, wherein the TGF-β2 agent, drug or administration comprises one or more TGF-β2-specific antisense oligonucleotides that are complementary to TGF-β2 preRNA, premRNA or mRNA and have a length of 18-21 nucleotides.

[0054] The above-mentioned agents, uses or methods, wherein the TGF-β2 agents, drugs or administrations contain one or more TGF-β2-specific antisense oligonucleotides that are complementary to the TGF-β2 transcripts as shown in any of Tables 4 and 5.

[0055] The above-described pharmaceutical preparations, uses, or methods, wherein the pharmaceutical preparation, drug, or administration comprises the combination CACACCTGATCAAATTTCTC SEQ ID NO:1 and CGGCATGTCTATTTTGTA SEQ ID NO:667, or C A C A C C T G A T C A A A T T T C T C SEQ ID NO:657 and C G G C A T G T C T A T T T T G T A SEQ ID NO:803.

[0056] The above-mentioned pharmaceuticals, uses, or methods, wherein the antisense oligonucleotides are shown in any of Tables 1, 2, 3, 4, and 5, and contain one or more nucleotides, said one or more nucleotides being chemically modified to be thiophosphate nucleoside linkages, methoxypropyl phosphate nucleoside linkages, aminophosphoside linkages linked to morpholine groups, 2'-OMe ribose groups, 2'-MOE methoxyethyl ribose groups, 2'-4'-restricted methoxyethyl bicyclic ribose groups, 2'-4'-restricted ethyl bicyclic ribose groups, LNA ribose groups, 2'-F ribose groups, or 5-methylcytosine bases.

[0057] The above-described pharmaceutical agent, use, or method, wherein the pharmaceutical agent is conjugated with polyethylene glycol, lipids, or tribranched N-acetyl-galactosamine.

[0058] The above-mentioned pharmaceuticals, uses, or methods include carriers of sterile water for injection, saline, isotonic saline, phosphate-buffered saline, or combinations thereof.

[0059] The above-described pharmaceutical preparations, uses, or methods, wherein the pharmaceutical preparation, drug, or application is substantially free of excipients.

[0060] The above-described pharmaceutical preparations, uses, or methods, wherein the pharmaceutical preparation, drug, or administration thereof in a carrier is stable at 37°C for at least 14 days.

[0061] The above-mentioned agents, uses, or methods, wherein the agents, drugs, or administrations are combined with standard care treatments for cancer.

[0062] The above-mentioned drugs, uses or methods, wherein the drugs for inhibiting or suppressing IRF5 expression and the drugs for inhibiting or suppressing TGF-β2 expression are administered in parallel, simultaneously, sequentially or separately in time.

[0063] The above-described pharmaceutical agent, use, or method, wherein the pharmaceutical agent is administered by infusion, injection, or continuous intracranial infusion.

[0064] The above-described pharmaceutical preparations, uses, or methods may include any one or more other drugs, including targeted cancer drugs, cancer growth inhibitors or EGFR inhibitors, erlotinib, gefitinib, afatinib, osimertinib, dacomitinib, and combinations thereof.

[0065] The above-described pharmaceutical preparations, uses, or methods may include any one or more other drugs, wherein the other drugs are targeted cancer drugs selected from bevacizumab, everolimus, bezutefal, dabrafenib, trametinib, and combinations thereof.

[0066] The above-described pharmaceutical preparations, uses, or methods may include any one or more other drugs, said other drugs being cancer growth inhibitors selected from angiogenesis inhibitors, histone deacetylase inhibitors, hedgehog factor blockers, mTOR inhibitors, p53 inhibitors, PARP inhibitors, proteasome inhibitors, tyrosine kinase inhibitors, and combinations thereof.

[0067] The above-described pharmaceutical preparations, uses, or methods may include any one or more additional drugs for the treatment of gliomas, said additional drugs being selected from TMZ, radiation, and bevacizumab; or may include any one or more additional drugs for the treatment of pancreatic cancer, said additional drugs being selected from paclitaxel, gemcitabine, 5-FU, leucovorin, irinotecan liposomes, FOLFOX, FOLFIRI, FOLFIRINOX, and nal-FIRINOX.

[0068] The above-described agents, uses, or methods of administration, wherein the agent, drug, or administration reduces mortality in subjects at 6, 12, 18, 24, 30, or 36 months.

[0069] The above-described agents, uses, or methods, wherein the agent, drug, or administration improves the survival rate of subjects at 6, 12, 18, 24, 30, or 36 months.

[0070] A reagent kit comprising: the aforementioned pharmaceutical agent and a carrier. Attached Figure Description

[0071] Figure 1 This study demonstrates the results of a clinical outcome study in patients with pancreatic cancer (PDAC) and the beneficial effect of combined treatment with an IRF5-specific antisense agent and a TGF-β2-specific antisense agent on overall survival in PDAC patients. Figure 1 Kaplan-Meier plots (KM plotter) showed a significant improvement in overall survival for patients with both low IRF5 and low TGF-β2. This study lays the foundation for the therapeutic use of combination IRF5-specific antisense agents with TGF-β2-specific antisense agents in the treatment of pancreatic cancer. The median overall survival in the IRF5 (low)-TGFβ2 (low) group was 38 months (log-rank P = 0.00059), which was significantly and unexpectedly prolonged compared to the 16 months observed in the IRF5 (low)-TGFβ2 (high) group.

[0072] Figure 2 The results of a clinical outcome study (cBioPortal) involving 513 patients with low-grade gliomas were presented, along with the beneficial effect of the use of IRF5-specific antisense agents on overall survival in patients with low-grade gliomas. Figure 2 Kaplan-Meier plots showed a significant improvement in overall survival in patients with IRF5 levels below the median. This study lays the foundation for the therapeutic use of IRF5-specific antisense agents in low-grade gliomas. The median overall survival in the IRF5 (low) group was 95 months (log-rank P < 0.0001), a significant and unexpectedly prolonged period compared to the 64 months observed in the IRF5 (high) group.

[0073] Figure 3 The study presented the results of a clinical outcome study (cBioPortal) involving 513 patients with low-grade gliomas, and the beneficial effect of the combined use of an IRF5-specific antisense agent and a TGF-β2-specific antisense agent on overall survival in patients with low-grade gliomas. Figure 3Kaplan-Meier plots showed a significant improvement in overall survival for patients with both low IRF5 and low TGF-β2. This study lays the foundation for the therapeutic use of combination IRF5-specific antisense agents with TGF-β2-specific antisense agents in the treatment of low-grade gliomas. The median overall survival in the IRF5(low)-TGFβ2(low) group was 105 months (log-rank P<0.0001), which was significantly and unexpectedly prolonged compared to the 27 months observed in the IRF5(high)-TGFβ2(high) group.

[0074] Figure 4 Results of a study on pediatric DIPG tumor samples are presented. For primary tumor samples, mRNA expression levels of IFNGR2 (N=45), JAK1 (N=45), and STAT1 (N=45) were obtained, expressed as log2-converted transcripts per million (TPM). IFNGR2 mRNA levels were significantly upregulated in DIPG samples compared to normal pontine tissue (1.58-fold increase; P=0.0006). Pediatric DIPG patients with brain tumors located in the pons / brainstem included molecular subtypes: DMG, H3K27M (N=23); DMG, H3K27M, TP53 (N=8); HGG, H3 wild-type (N=2); HGG, H3 wild-type, TP53 (N=1); HGG, unclassified (N=10); and 1 case undetermined. mRNA expression levels in DIPG samples were compared with levels in normal pontine samples from 29 pontine regions (21 subjects). The bar chart shows the mean mRNA expression levels in tumor samples (dark gray bars) and normal pontine samples (light gray bars). Two-way ANOVA was used to assess the statistical significance of the differences in mRNA expression levels.

[0075] Figure 5 The results of a study on pediatric DIPG tumor samples are presented. Compared with normal brainstem tissue, the expression levels of antigen-presenting cell mRNAs were downregulated in pediatric DIPG tumors. The mRNA expression levels (log2 TPM) of CD14 (N=45), CD163 (N=45), CD86 (N=45), and ITGAX (N=45) were obtained in pediatric DIPG samples and compared with those in normal pons samples. Bar plots show the mean mRNA expression levels in pediatric DIPG patient tumor samples (dark gray bars) compared to normal pons samples (light gray bars). Compared with normal brainstem / pons tissue, the expression of CD14, CD163, and ITGAX mRNAs in pediatric DIPG patients was significantly reduced by 1.64-fold (P=0.037), 1.75-fold (P=0.019), and 3.33-fold (P<0.0001), respectively. Differences in mRNA expression levels were assessed using two-way ANOVA. Detailed Implementation Invention Details

[0077] This invention relates to methods, compositions, and uses thereof for treating or alleviating cancer symptoms in human or animal subjects using pharmaceutical compositions designed to promote antitumor effects.

[0078] Embodiments of the present invention cover the suppression of IRF5 mRNA expression, for example, using antisense oligonucleotides.

[0079] This invention relates to agents, compositions, uses, pharmaceutical products, and methods for treating cancer using agents for inhibiting or suppressing IRF5 expression, agents for inhibiting or suppressing TGF-β2 expression, and combinations thereof. These agents can be used in combination with checkpoint inhibitors.

[0080] Synergistic therapies include agents used alone to inhibit or suppress IRF5 or in combination with agents used to inhibit or suppress TGF-β2 expression.

[0081] In some implementations, agents that inhibit IRF5 expression may be used alone or in combination with agents that inhibit TGF-β2 expression to treat or alleviate cancer symptoms in subjects.

[0082] Further embodiments include the use of a composition comprising an agent that alone inhibits IRF5 expression or a combination of an agent that inhibits TGF-β2 expression in the preparation of a medicament for treating or alleviating cancer symptoms in a subject.

[0083] Another implementation method includes a method for treating or alleviating cancer symptoms in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent alone for inhibiting IRF5 expression or a combination thereof with an agent for inhibiting TGF-β2 expression; and administering the composition to the subject.

[0084] Unwilling to be bound by theory, the applicant discovered that among the three subtypes of TGF-β, only TGF-β2 is associated with cancer pathology. Therefore, embodiments of the present invention provide agents and methods for inhibiting or suppressing TGF-β2 expression in combination with other agents, which unexpectedly improve overall survival in cancer patients.

[0085] In some implementations, one or more biomarkers may be used to select subjects who will benefit from the method, agent, or use, including IRF5 and / or ITGAM. Other biomarkers include IFNGR2, JAK1, and STAT1, as well as IRF5, TLR9, FOXP3, CCL22, CREB5, CD8a, CD86, IFNGR2, CC14, CD163, ITGAM, and CD11c.

[0086] As used herein, the term "agent" can refer to one or more active compounds, a combination of active compounds, or a composition containing one or more active compounds and a carrier, and / or a solvent and / or any number of excipients. In some embodiments, the composition may be a pharmaceutical composition. In some embodiments, the composition may be a pharmaceutical composition containing a therapeutically effective amount of one or more active compounds. Some examples of excipients are given in the following literature: Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 1975, and Liberman, HA and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980. Methods for determining a therapeutically effective amount of a compound are known in the art.

[0087] In some implementations, the methods and treatment strategies of the present invention can improve the efficacy of cancer treatment and reduce toxic side effects and adverse health effects.

[0088] In a further embodiment, the methods and treatment strategies of the present invention may use appropriate biomarkers to select the synergistic effects of the compositions, thereby improving therapy guidance.

[0089] Human IRF5-specific antisense oligodeoxynucleotides

[0090] Embodiments of the present invention also include pharmaceutical compositions for inhibiting or suppressing IRF5 expression or for treating or improving cancer symptoms in humans or animals. The pharmaceutical composition may comprise a pharmaceutically acceptable salt, ester, or polymorph or stereoisomer of any active ingredient disclosed herein, and a carrier. IRF5 inhibitors may be selected from IRF5-specific antisense oligonucleotides. The carrier may be sterile water for injection, saline, isotonic saline, or a combination thereof.

[0091] IRF5 antisenses can be chemically modified in the same manner as TGF-β-2 antisenses described below.

[0092] Examples of pharmaceutical agents used to inhibit or suppress IRF5 expression in this disclosure include the IRF5-specific antisense oligonucleotides listed in Table 1.

[0093] Table 1: IRF5-specific antisense oligonucleotides

[0094] In some implementations, antisense oligonucleotides may be selected using the following criteria: A) 40% <= GC% <= 60%; B) The target sequence contains no GGGG; C) The average unpaired probability of target site nucleotides is >= 0.5; D) For each peak in the reachability feature with a probability higher than the threshold of 0.5, all sites targeting the same peak can be ranked according to their average unpaired probability (the higher the better), and each peak can select up to n sites, where n is determined by max([peak width / site length], 2); E) Among the sites that meet the standard AD, the top 20 unique sites with the highest average unpaired probability can be listed.

[0095] In some implementations, the average unpaired probability can be used to screen criteria C, D, and E to reduce the number of reported sites, thereby making the calculation of interference energy controllable.

[0096] As is known in the art, the IRF5 antisense sequence can be chemically modified to provide its active variant, its LNA variant, and its gapmer variant. These sequences can be used as active ingredients in any combination, such as aggregated combinations.

[0097] In some implementations, the IRF5 antisense sequence can be nMn RNA (2'-OMe). -DNA -RNA(2'-OMe) The gapmer is defined as n = 3–7 and M = 6–12. In some implementations, the IRF5 antisense sequence can be a 3–10–3 or 5–10–5 LNA. -DNA -LNA or cEt -DNA -cEt gapmer.

[0098] It is understood that various forms of other antisense oligonucleotides can be constructed based on the IRF5 gene sequence.

[0099] Further examples of agents disclosed herein for inhibiting or suppressing IRF5 expression include the IRF5-specific antisense oligonucleotides given in Table 2.

[0100] Table 2: IRF5-specific antisense oligonucleotides

[0101] Any unmodified antisense oligonucleotide described herein may have any number and sequence of phosphate-thioester linked nucleotides. In some embodiments, all nucleotides may be modified with phosphate-thioester links.

[0102] Further examples of agents disclosed herein for inhibiting or suppressing IRF5 expression include the IRF5-specific phosphate thioester antisense oligonucleotides given in Table 3. Phosphothioesters are linked by an asterisk ( )express.

[0103] Table 3: IRF5-specific phosphate thioester antisense oligonucleotides

[0104] In some implementations, as described herein, the IRF5 antisense sequence can be a gapmer formed by adding 1 to 5 protected ribonucleotides to each flanking flank of the phosphate thioester deoxynucleotide sequence in Table 3. For example, the ribonucleotides can be protected with 2'-OMe, 2'-OEt, or 2'-O-MOE substituents, or with LNA, cMOE, or cEt bridges and phosphate thioester linkages.

[0105] Anticancer methods and compositions

[0106] This invention includes agents for inhibiting or suppressing IRF5 expression, which are used to treat or alleviate cancer symptoms in subjects.

[0107] In a further embodiment, the invention includes the use of a composition comprising an agent for inhibiting or suppressing IRF5 expression in the preparation of a medicament for treating or alleviating cancer symptoms in a subject.

[0108] In some embodiments, the present invention includes a method for treating or alleviating cancer symptoms in a subject in need, the method comprising: preparing a pharmaceutical composition comprising an agent for inhibiting or suppressing IRF5 expression; and administering a therapeutically sufficient amount of the composition to the subject.

[0109] This invention includes the use of agents for inhibiting or suppressing IRF5 expression in combination with agents for inhibiting or suppressing TGF-β2 expression to treat or alleviate cancer symptoms in subjects.

[0110] In a further embodiment, the invention includes the use of a composition comprising a combination of an agent for inhibiting or suppressing IRF5 expression and an agent for inhibiting or suppressing TGF-β2 expression in the preparation of a medicament for treating or alleviating cancer symptoms in a subject.

[0111] In some embodiments, the present invention includes a method of treating or alleviating cancer symptoms in a subject in need, the method comprising: preparing a pharmaceutical composition comprising a combination of an agent for inhibiting or suppressing IRF5 expression and an agent for inhibiting or suppressing TGF-β2 expression; and administering a therapeutically sufficient amount of the composition to the subject.

[0112] The present invention also includes agents for inhibiting or suppressing IRF5 expression, in combination with agents for inhibiting or suppressing TGF-β2 expression and immune checkpoint inhibitors for treating or alleviating cancer symptoms in subjects.

[0113] In a further embodiment, the invention includes the use of a composition comprising a combination of an agent for inhibiting or suppressing IRF5 expression, an agent for inhibiting or suppressing TGF-β2 expression, and an immune checkpoint inhibitor in the preparation of a medicament for treating or alleviating cancer symptoms in a subject.

[0114] In some embodiments, the present invention includes a method of treating or alleviating cancer symptoms in a subject in need, the method comprising: preparing a pharmaceutical composition comprising a combination of an agent for inhibiting or suppressing IRF5 expression and an agent for inhibiting or suppressing TGF-β2 expression and an immune checkpoint inhibitor; and administering a therapeutically sufficient amount of the composition to the subject.

[0115] The present invention includes methods for treating or alleviating cancer symptoms in human or animal subjects in need by administering to a subject a therapeutically sufficient amount of a pharmaceutical composition comprising an agent for inhibiting or suppressing TGF-β2 expression, and by administering to a subject a therapeutically sufficient amount of a pharmaceutical composition comprising a checkpoint inhibitor.

[0116] In some embodiments, the present invention includes agents for inhibiting or suppressing TGF-β2 expression in combination with immune checkpoint inhibitors, for treating or alleviating cancer symptoms in human subjects or animals.

[0117] In another aspect, the present invention includes the use of a composition comprising an agent for inhibiting or suppressing TGF-β2 expression in combination with an immune checkpoint inhibitor in the preparation of a medicament for treating or alleviating cancer symptoms in human subjects or animals.

[0118] Any of the above therapies can be combined with immune checkpoint inhibitors.

[0119] Any of the above therapies can be combined with standard care for cancer. Anticancer therapies and medications can be administered via infusion, injection, or continuous intracranial infusion.

[0120] Any of the above therapies may be combined with one or more other drugs, including targeted cancer drugs, cancer growth blockers or EGFR inhibitors, erlotinib, gefitinib, afatinib, osimertinib, dacomitinib, and combinations thereof.

[0121] In some implementations, any of the above therapies may be combined with one or more additional drugs selected from bevacizumab, everolimus, bezutefal, dabrafenib, trametinib, and combinations thereof as targeted cancer drugs.

[0122] In a further embodiment, any of the above therapies may be combined with one or more other drugs, said one or more other drugs being cancer growth inhibitors selected from angiogenesis inhibitors, histone deacetylase inhibitors, hedgehog factor blockers, mTOR inhibitors, p53 inhibitors, PARP inhibitors, proteasome inhibitors, tyrosine kinase inhibitors, and combinations thereof.

[0123] In some embodiments, any of the above-described therapies may be combined with one or more additional drugs for treating gliomas, selected from TMZ, radiation, and bevacizumab, or may include one or more additional drugs for treating pancreatic cancer, selected from paclitaxel, gemcitabine, 5-FU, leucovorin, irinotecan liposomes, FOLFOX, FOLFIRI, FOLFIRINOX, and nal-FIRINOX.

[0124] Human TGF-β2 specific phosphate thioester antisense oligodeoxynucleotide

[0125] Antisense oligonucleotides (ASOs) can be single-stranded deoxyribonucleotides that are complementary to mRNA targets. Antisense therapy can downregulate molecular targets, which can be achieved by inducing RNase H endonuclease activity, which cleaves RNA-DNA heteroduplexes, thereby significantly reducing the translation of target genes. Other ASO mechanisms may include inhibiting 5' cap formation, altering splicing processes (e.g., splice transition), and steric hindrance of ribosome activity.

[0126] Antisense therapeutic strategies can utilize single-stranded DNA oligonucleotides, which inhibit protein production by mediating the catalytic degradation of target mRNA or by binding to sites on mRNA required for translation. Antisense oligonucleotides can be engineered to target viral RNA genomes or viral transcripts. Antisense oligonucleotides can provide a method for identifying potential targets and therefore represent potential therapeutic agents.

[0127] Antisense oligonucleotides (ASOs) can be small synthetic fragments of single-stranded DNA, ranging in length from 15 to 30 nucleotides. ASOs specifically bind to complementary DNA / RNA sequences via Watson-Crick hybridization, and once bound to the target RNA, they inhibit translation through cleavage induction or by suppressing mRNA maturation. ASOs can selectively suppress gene expression with specificity. Stability can be increased through chemical modifications to DNA or RNA.

[0128] For example, modifications can be introduced into the phosphodiester bond, sugar ring, and backbone. ASO antiviral agents can block translation by (i) ribonuclease H (RNase H) or RNase P-mediated mRNA cleavage; or (ii) by spatially (non-bonded) blocking of enzymes involved in the translation of target genes. Human TGF-β2-specific phosphate thioester antisense oligodeoxynucleotides (OT-101; AP 12009; Trabedersen), hereinafter referred to as OT-101 or AP12009, are designed to reduce the level of TGF-β2 protein in malignant gliomas and thus delay disease progression.

[0129] Antisense oligodeoxynucleotides are short segments of DNA designed to downregulate gene expression by interfering with the translation of specific encoded proteins at the mRNA level. OT-101 is a synthetic 18-meric phosphate-thioester oligodeoxynucleotide (S-ODN) in which all 3'-5' links are modified to phosphate-thioester. Its molecular formula is C1. 177 H 208 N 60 Na17 O 94 P 17 S 17 It has a molecular weight of 6,143 g / mol. OT-101 is designed to be complementary to a specific sequence of human TGF-β2 mRNA after gene expression.

[0130] OT-101 is available as a lyophilized powder in three different amounts in 50 mL glass vials. Each vial is labeled with the name of the investigational product, trial number, dosing group, method of administration, amount of OT-101 contained (in mg), total volume after dissolution (in mL), and concentration obtained (in μM), sponsor name, manufacturer name, batch number, vial number, storage temperature, and expiry date. The investigational drug can be supplied in a closed unit, individually packaged for each concentration. The package may contain the appropriate vial and all necessary components of the application system (i.e., syringe, tubing, and filter). Before use, dissolve the OT-101 lyophilized powder in an isotonic (0.9%) sodium chloride aqueous solution. Instructions may be included with the package instructing on how to prepare the product for the desired concentration.

[0131] Examples of agents disclosed herein for inhibiting or suppressing TGF-β expression include antisense oligonucleotides that are specific for TGF-β1, TGF-β2, or TGF-β3.

[0132] Examples of agents disclosed herein for inhibiting or suppressing TGF-β2 expression include the TGF-β2-specific antisense oligonucleotides given in Table 4, SEQ ID NO: 667-802.

[0133] Table 4: TGF-β2-specific antisense oligonucleotides

[0134] The sequences in Table 4 can be chemically modified to provide their active variants, their LNA variants, and their gapmer variants known in the art. The sequences in Table 4 can be used as active agents in any combination, such as aggregated combinations.

[0135] It will be understood that other antisense oligonucleotides disclosed herein can be constructed based on the TGF-β2 gene sequence.

[0136] In some embodiments, the antisense sequence agent can be a gapmer formed by adding 1 to 5 protected ribonucleotides to each flanking flank of the phosphate thioester deoxynucleotide sequence in Table 4. For example, the ribonucleotides can be protected with 2'-OMe, 2'-OEt, or 2'-O-MOE substituents, or with LNA, cMOE, or cEt bridges and phosphate thioester linkages.

[0137] In some implementations, the antisense sequence agent can be nMn RNA (2'-OMe). -DNA -RNA (2'-OMe) The gapmer is defined as n = 3-7 and M = 6-12. In some implementations, the gapmer can be 3-10-3 or 5-10-5 LNA. -DNA -LNA or cEt -DNA -cEt gapmer (Indicates thiophosphate linkage).

[0138] Examples of agents disclosed herein for inhibiting or suppressing TGF-β2 expression include the TGF-β2-specific antisense oligonucleotides given in Table 5, SEQ ID NO: 803-810.

[0139] Table 5: TGF-β2-specific phosphate thioester antisense oligonucleotides

[0140] Embodiments of the present invention also include pharmaceutical compositions for inhibiting or suppressing TGF-β expression or for treating or alleviating cancer symptoms in humans or animals. The pharmaceutical composition may contain a TGF-β inhibitor, artemisinin, its pharmaceutically acceptable salt form, ester, polymorph or stereoisomer, or any combination thereof, and a carrier. The TGF-β inhibitor may be selected from a TGF-β2-specific antisense oligonucleotide. The carrier may be sterile water for injection, saline, isotonic saline, or a combination thereof.

[0141] Importantly, the compositions disclosed herein can be substantially excipient-free. The substantially excipient-free compositions of the present invention have been found to exhibit surprising stability in a carrier. In some embodiments, the composition is stable in a carrier at 37°C for at least 14 days, at least 21 days, or at least 28 days.

[0142] In other embodiments, the pharmaceutical composition for infusion may contain less than 1% by weight, or less than 0.5% by weight, or less than 0.1% by weight of excipients.

[0143] OT-101 antisense oligonucleotide drug product

[0144] API Tribedsen / OT-101 is a synthetic 18-mer S-ODN composed of adenine (A), thymine (T), guanine (G), and cytosine (C) bases, with all 3'-5' links modified to phosphate thioesters. This sulfur modification enhances the drug's resistance to degradation, thereby improving its stability in vitro and in vivo. Its molecular structure (nucleotide sequence) is engineered to be complementary to a specific sequence of human transforming growth factor-β2 (TGF-β2) mRNA. This sequence was selected from relevant molecules due to its excellent chemical and structural properties, biological activity, and specificity, achieving optimal antisense effects in vitro and in vivo.

[0145] Table 6 shows the chemical structure of trobedsen, the exemplary thiophosphate moiety (CAG), and its physical characteristics.

[0146] Table 6: Chemical and physical characteristics of Tribedsen

[0147] This IMP is provided as a sterile lyophilized infusion solution in 50H glass vials (master container) containing 7.37 mg trobedsen (intratumoral therapy) and 20R glass vials (master container) containing 250 mg trobedsen (intravenous therapy). The finished drug product is excipient-free. These glass vials are commonly used for parenteral medications. Sterile rubber stoppers suitable for lyophilization can seal the glass vials. The stoppers can be sealed with crimped capsules with colored flip-tops. For clinical use, each vial is provided in a white folding box to protect it from light exposure and damage during transport. Labeling of both the glass vials and folding boxes can be done according to local requirements. Both the master and secondary containers of this closed system meet international quality standards for the packaging of sterile solid pharmaceutical products for injection.

[0148] Checkpoint inhibitor drugs

[0149] As mentioned herein, checkpoint inhibitors known in the art are immune checkpoint inhibitor agents. Checkpoint inhibitors are immunotherapeutic drugs that block the binding of checkpoint proteins to their chaperone proteins. This prevents the “off” signal from being emitted, thereby allowing T cells to kill cancer cells. More specifically, checkpoint proteins on T cells, such as PD-1, maintain the checkpoint for the immune response. PD-L1 binds to PD-1, preventing T cells from killing tumor cells. Therefore, using immune checkpoint inhibitors to block the binding of PD-L1 to PD-1 can allow T cells to kill tumor cells. The immune system is essentially ignored, allowing T cells to attack cancer cells.

[0150] In some embodiments, the checkpoint inhibitors of this disclosure may be inhibitors of CTLA-4, PD-1, or PD-L1.

[0151] In some embodiments, the checkpoint inhibitor of this disclosure may be a PD-1 inhibitor.

[0152] In some implementations, the checkpoint inhibitor disclosed herein may be pembrolizumab.

[0153] In some embodiments, the checkpoint inhibitors disclosed herein may be pembrolizumab, nivolumab, cemiplimab, spartalizumab, atezolizumab, avelumab, or durvalumab.

[0154] Unwilling to be bound by theory, PD-1 receptor-ligand interactions could be a major pathway for tumor hijacking to suppress immune control. In healthy individuals, the normal function of PD-1, expressed on the cell surface of activated T cells, is to downregulate unwanted or excessive immune responses, including autoimmune responses. Upon T cell stimulation, PD-1 recruits tyrosine phosphatases SHP-1 and SHP-2 to tyrosine-based immunoreceptor-based switch motifs in its cytoplasmic tail, leading to the dephosphorylation of effector molecules involved in the CD3 T cell signaling cascade, such as CD3 zeta (CD3ζ), protein kinase C-theta (PKCθ), and ζ-chain-associated protein kinase (ZAP70).

[0155] The numbered embodiments of the present invention include the following: 1) A drug for treating or alleviating cancer symptoms in a subject, which inhibits or suppresses IRF5 expression.

[0156] 2) Use of a composition comprising an agent for inhibiting or suppressing IRF5 expression in the preparation of a medicament for treating or alleviating cancer symptoms in a subject.

[0157] 3) A method for treating or alleviating cancer symptoms in a subject in need, the method comprising: Prepare a pharmaceutical composition comprising an agent for inhibiting or suppressing IRF5 expression; and Administer a sufficient amount of the composition to the subject for treatment.

[0158] 4) The agent, use or method of implementation of any one of 1-3, wherein the cancer is glioma, low-grade glioma, glioblastoma, diffuse endophytic pontine glioma (DIPG), diffuse midline glioma (DMG), leptomeningeal or brain metastases, brain or spinal cord cancer or CNS tumor.

[0159] 5) The agent, use or method of implementation of any one of 1-4, wherein the cancer is pancreatic cancer.

[0160] 6) Any of the embodiments 1-5, the drug, use or method, including the use of one or more biomarkers to select subjects who will benefit from the drug, use or method, wherein the biomarker is an elevated level of TGF-β2 and an elevated level of one or more of IFNGR2, JAK1 and STAT1.

[0161] 7) Any of the following formulations, uses, or methods, including the use of one or more biomarkers to select subjects who will benefit from the formulation, use, or method, wherein the biomarker is a level of TGF-β2 and a level of one or more of IRF5, TLR9, FOXP3, CCL22, CREB5, CD8a, CD86, CC14, CD163, ITGAX, and CD11c.

[0162] 8) A pharmaceutical preparation, use or method according to any one of embodiments 1-7, wherein the pharmaceutical preparation, drug or administration comprises one or more IRF5-specific antisense oligonucleotides that are complementary to the IRF5 transcript and have a length of 15-30 nucleotides.

[0163] 9) A pharmaceutical agent, use or method according to any one of embodiments 1-8, wherein the pharmaceutical agent, drug or administration comprises one or more IRF5-specific antisense oligonucleotides that are complementary to IRF5 preRNA, premRNA or mRNA and have a length of 18-21 nucleotides.

[0164] 10) A pharmaceutical preparation, use or method according to any one of embodiments 1-9, wherein the pharmaceutical preparation, drug or application comprises one or more IRF5-specific antisense oligonucleotides complementary to the IRF5 transcript as shown in Tables 1, 2 and 3.

[0165] 11) A pharmaceutical agent, use or method according to any one of embodiments 1-10, wherein the pharmaceutical agent, drug or application comprises an IRF5-specific antisense oligonucleotide SEQ ID NO:1 or SEQ ID NO:657.

[0166] 12) Any pharmaceutical preparation, use, or method according to any one of embodiments 1-11, including the IRF5-specific antisense oligonucleotide shown in any one of Tables 1, 2, and 3, wherein the IRF5-specific antisense oligonucleotide has one or more nucleotides, wherein the one or more nucleotides are chemically modified to be a thiophosphate nucleoside linker, a methoxypropyl phosphate nucleoside linker, an aminophosphoside linker linked to a morpholine group, a 2'-OMe ribose group, a 2'-MOE methoxyethyl ribose group, a 2'-4'-restricted methoxyethyl bicyclic ribose group, a 2'-4'-restricted ethyl bicyclic ribose group, an LNA ribose group, a 2'-F ribose group, or a 5-methylcytosine base.

[0167] 13) The agent, use or method of any one of embodiments 1-12, wherein the agent is conjugated with polyethylene glycol, lipid or triple-branched N-acetyl-galactosamine.

[0168] 14) The agent, use or method of any one of the embodiments 1-13, including a carrier of sterile water for injection, saline, isotonic saline, phosphate buffered saline or combinations thereof.

[0169] 15) A pharmaceutical preparation, use or method according to any one of embodiments 1-14, wherein the pharmaceutical preparation, drug or application is substantially free of excipients.

[0170] 16) The agent, use or method of any one of embodiments 1-15, wherein the agent, drug or administration in a carrier is stable at 37°C for at least 14 days.

[0171] 17) The agent, use or method of administration of any one of embodiments 1-16, wherein the agent, drug or administration is combined with standard care treatment for cancer.

[0172] 18) The agent, use or method of any one of embodiments 1-17, wherein the agent is administered by infusion, injection or continuous intracranial infusion.

[0173] 19) Any of the following formulations, uses, or methods of implementation, including any one or more other drugs, including targeted cancer drugs, cancer growth blockers or EGFR inhibitors, erlotinib, gefitinib, afatinib, osimertinib, dacomitinib, and combinations thereof.

[0174] 20) Any of the pharmaceutical preparations, uses, or methods described in any of embodiments 1-19, including any one or more other pharmaceutical preparations that are targeted cancer drugs, said targeted cancer drugs being selected from: bevacizumab, everolimus, bezotefantran, dabrafenib, trametinib, and combinations thereof.

[0175] 21) Any of the pharmaceutical agents, uses, or methods described in any one of embodiments 1-20, comprising any one or more other pharmaceutical agents that are cancer growth inhibitors, said cancer growth inhibitors being selected from: angiogenesis inhibitors, histone deacetylase inhibitors, hedgehog factor inhibitors, mTOR inhibitors, p53 inhibitors, PARP inhibitors, proteasome inhibitors, tyrosine kinase inhibitors, and combinations thereof.

[0176] 22) Any of the following formulations, uses, or methods of administration, including any one or more additional drugs selected from TMZ, radiation, and bevacizumab for the treatment of glioma; or containing any one or more additional drugs selected from the following for the treatment of pancreatic cancer: paclitaxel, gemcitabine, 5FU, leucovorin, irinotecan liposome, FOLFOX, FOLFIRI, FOLFIRINOX, and nal-FIRINOX.

[0177] 23) The agent, use or method of administration of any one of embodiments 1-22, wherein the agent, drug or administration reduces the mortality rate of the subject at 6, 12, 18, 24, 30 or 36 months.

[0178] 24) The agent, use or method of any one of embodiments 1-23, wherein the agent, drug or administration improves the survival rate of the subject at 6, 12, 18, 24, 30 or 36 months.

[0179] 25) A kit comprising: The pharmaceutical preparations described in any one of Implementation Schemes 1-24; and Carrier.

[0180] 26) An agent for inhibiting or suppressing IRF5 expression in combination with an agent for inhibiting or suppressing TGF-β2 expression, used to treat or alleviate cancer symptoms in a subject.

[0181] 27) Use of a composition comprising an agent for inhibiting or suppressing IRF5 expression in combination with an agent for inhibiting or suppressing TGF-β2 expression in the preparation of a medicament for treating or alleviating cancer symptoms in a subject.

[0182] 28) A method for treating or alleviating cancer symptoms in a subject in need, the method comprising: Prepare a pharmaceutical composition comprising an agent for inhibiting or suppressing IRF5 expression in combination with an agent for inhibiting or suppressing TGF-β2 expression; and Administer a sufficient amount of the composition to the subject for treatment.

[0183] 29) The agent, use or method of implementation of any one of 26-28, wherein the cancer is a glioma, a low-grade glioma, a glioblastoma, a diffuse endophytic pontine glioma (DIPG), a diffuse midline glioma (DMG), a leptomeningeal or brain metastasis, a brain or spinal cord cancer or a CNS tumor.

[0184] 30) The agent, use or method of implementation of any one of 26-29, wherein the cancer is pancreatic cancer.

[0185] 31) Any of the embodiments 26-30, the drug, use or method, includes using one or more biomarkers to select subjects who will benefit from the drug, use or method, wherein the biomarker is a level of TGF-β2 and a level of one or more of IFNGR2, STAT1, IRF1, IRF5, CD276 and CD204.

[0186] 32) The agent, use or method of any one of embodiments 26-31, wherein the cancer is a low-grade glioma whose tumor cells exhibit wild-type IDH1 or IDH2, and one or more of IFNGR2 upregulation, STAT1 upregulation, IRF1 upregulation, IRF5 upregulation, CD276 upregulation and CD204 upregulation.

[0187] 33) Any of the embodiments 26-32, the pharmaceutical preparation, use or method thereof, wherein the IRF5 preparation, drug or administration comprises one or more IRF5-specific antisense oligonucleotides that are complementary to the IRF5 transcript and have a length of 15-30 nucleotides.

[0188] 34) Any of the embodiments 26-33, the pharmaceutical preparation, use or method thereof, wherein the IRF5 preparation, drug or administration comprises one or more IRF5-specific antisense oligonucleotides that are complementary to IRF5 preRNA, premRNA or mRNA and have a length of 18-21 nucleotides.

[0189] 35) Any of the embodiments 26-34, the pharmaceutical preparation, use or method thereof, wherein the IRF5 preparation, drug or administration comprises one or more IRF5-specific antisense oligonucleotides complementary to the IRF5 transcript as shown in any one of Tables 1, 2 and 3.

[0190] 36) Any of the following embodiments, uses, or methods, wherein the agent that inhibits or suppresses IRF5 expression is YE6144 (S,E)-N1-(6-fluoro-3-(2-(6-morpholinopyridazine-3-yl)vinyl)-1H-indazol-5-yl)butane-1,2-diamine hydrochloride, an IRF5 dimerizing cell-penetrating peptide inhibitor, an NLS peptide mimic, or a bait peptide.

[0191] 37) Any of the embodiments 26-36, the pharmaceutical preparation, use or method thereof, wherein the TGF-β2 preparation, drug or administration comprises one or more TGF-β2-specific antisense oligonucleotides that are complementary to the TGF-β2 transcript and have a length of 15-30 nucleotides.

[0192] 38) Any of the embodiments 26-37, the agent, use or method thereof, wherein the TGF-β2 agent, drug or administration comprises one or more TGF-β2-specific antisense oligonucleotides that are complementary to TGF-β2 preRNA, premRNA or mRNA and have a length of 18-21 nucleotides.

[0193] 39) Any of the embodiments 26-38, the pharmaceutical preparation, use or method thereof, wherein the TGF-β2 preparation, drug or administration comprises one or more TGF-β2-specific antisense oligonucleotides complementary to the TGF-β2 transcript as shown in any one of Tables 4 and 5.

[0194] 40) A pharmaceutical agent, use or method according to any one of embodiments 26-39, wherein the pharmaceutical agent, drug or application comprises a combination of SEQ ID NO:1 and SEQ ID NO:667, or a combination of SEQ ID NO:657 and SEQ ID NO:803.

[0195] 41) The pharmaceutical preparation, use or method of any one of embodiments 26-40, wherein the antisense oligonucleotide in any one of Tables 4 and 5 comprises one or more nucleotides, said one or more nucleotides being chemically modified to be a thiophosphate nucleoside linker, a methoxypropyl phosphate nucleoside linker, an aminophosphoside linker linked to a morpholine group, a 2'-OMe ribose group, a 2'-MOE methoxyethyl ribose group, a 2'-4'-restricted methoxyethyl bicyclic ribose group, a 2'-4'-restricted ethyl bicyclic ribose group, an LNA ribose group, a 2'-F ribose group or a 5-methylcytosine base.

[0196] 42) The agent, use or method of any one of embodiments 26-41, wherein the agent is conjugated with polyethylene glycol, lipid or triple-branched N-acetyl-galactosamine.

[0197] 43) Any of the following formulations, uses, or methods, including carriers of sterile water for injection, saline, isotonic saline, phosphate-buffered saline, or combinations thereof.

[0198] 44) A pharmaceutical preparation, use or method according to any one of embodiments 26-43, wherein the pharmaceutical preparation, drug or application is substantially free of excipients.

[0199] 45) The agent, use or method of any one of embodiments 26-44, wherein the agent, drug or administration is stable at 37°C for at least 14 days in a carrier.

[0200] 46) The agent, use or method of administration of any one of embodiments 26-45, wherein the agent, drug or administration is combined with standard care treatment for cancer.

[0201] 47) The agent, use or method of any one of embodiments 26-46, wherein the agent for inhibiting or suppressing IRF5 expression and the agent for inhibiting or suppressing TGF-β2 expression may be administered in parallel, simultaneously, sequentially or separately in time.

[0202] 48) The agent, use or method of administration of any one of embodiments 26-47, wherein the agent is administered by infusion, injection or continuous intracranial infusion.

[0203] 49) Any of the pharmaceutical preparations, uses, or methods described in any of embodiments 26-48, including any one or more other pharmaceutical preparations, said other pharmaceutical preparations including targeted cancer drugs, cancer growth blockers or EGFR inhibitors, erlotinib, gefitinib, afatinib, osimertinib, dacomitinib, and combinations thereof.

[0204] 50) Any of the pharmaceutical preparations, uses, or methods described in any of embodiments 26-49, including any one or more other pharmaceutical preparations that are targeted cancer drugs, said targeted cancer drugs being selected from: bevacizumab, everolimus, bezotefantran, dabrafenib, trametinib, and combinations thereof.

[0205] 51) Any of the pharmaceutical agents, uses, or methods described in any of embodiments 26-50, including any one or more other pharmaceutical agents that are cancer growth inhibitors selected from: angiogenesis inhibitors, histone deacetylase inhibitors, hedgehog factor inhibitors, mTOR inhibitors, p53 inhibitors, PARP inhibitors, proteasome inhibitors, tyrosine kinase inhibitors, and combinations thereof.

[0206] 52) Any of the following pharmaceutical preparations, uses, or methods of administration, including any one or more of the following additional pharmaceutical preparations for the treatment of gliomas: selected from TMZ, radiation, and bevacizumab; or including any one or more of the following additional pharmaceutical preparations for the treatment of pancreatic cancer: paclitaxel, gemcitabine, 5-FU, leucovorin, irinotecan liposome, FOLFOX, FOLFIRI, FOLFIRINOX, and nal-FIRINOX.

[0207] 53) The agent, use or method of administration of any one of embodiments 26-52, wherein the agent, drug or administration reduces the mortality rate of the subject at 6, 12, 18, 24, 30 or 36 months.

[0208] 54) The agent, use or method of any one of embodiments 26-53, wherein the agent, drug or administration improves the survival rate of the subject at 6, 12, 18, 24, 30 or 36 months.

[0209] 55) A kit comprising: The pharmaceutical preparations described in any one of embodiments 26-54; and Carrier.

[0210] All publications mentioned in this specification, including patent, patent application publications and non-patent publications and serial lists, are expressly incorporated herein by reference in their entirety for all purposes.

[0211] Although the foregoing disclosure has been described in detail by way of example for purposes of clarity, it will be apparent to those skilled in the art that this disclosure includes certain changes and modifications and can be practiced within the scope of the appended claims without excessive experimentation, the claims being presented in an exemplary and not restrictive manner. The invention includes all such additional embodiments, equivalents, and modifications. The invention includes any combination or mixture of various exemplary components, examples, and features, materials, elements, or limitations of the claimed embodiments.

[0212] The nomenclature of the pharmaceuticals, compounds and structures disclosed herein is intended to cover all possible isomers, stereoisomers, diastereomers, enantiomers and / or optical isomers of the particular structure, including any mixtures thereof (racemic or other forms).

[0213] Example

[0214] Example 1: This example demonstrates the clinical outcome of pancreatic cancer patients benefiting from a combination of IRF5 suppression and TGF-β2 suppression.

[0215] Figure 1This study demonstrates the results of a clinical outcome study in patients with pancreatic cancer (PDAC) and the beneficial effect of combined treatment with an IRF5-specific antisense agent and a TGF-β2-specific antisense agent on overall survival in PDAC patients. Figure 1 Kaplan-Meier plots (KM plotter) showed a significant improvement in overall survival for patients with IRF5 below the median and low TGF-β2. This study lays the foundation for the therapeutic use of IRF5-specific antisense agents in combination with TGF-β2-specific antisense agents in the treatment of pancreatic cancer.

[0216] The median overall survival in the IRF5 (low)-TGFβ2 (low) group was 38 months (log-rank P=0.00059), which was significantly and unexpectedly prolonged compared with the 16 months observed in the IRF5 (low)-TGFβ2 (high) group.

[0217] Example 2: This example demonstrates the clinical outcome of low-grade glioma patients benefiting from IRF5 suppression.

[0218] Figure 2 The results of a clinical outcome study (cBioPortal) involving 513 patients with low-grade gliomas were presented, along with the beneficial effect of the use of IRF5-specific antisense agents on overall survival in patients with low-grade gliomas. Figure 2 Kaplan-Meier plots showed that patients with IRF5 levels below the median had significantly improved overall survival. This study lays the foundation for the therapeutic use of IRF5-specific antisense agents in low-grade gliomas.

[0219] The median overall survival for patients in the IRF5 (low) group was 95 months (log-rank P < 0.0001), which was significantly and unexpectedly prolonged compared to the 64 months observed in patients in the IRF5 (high) group.

[0220] Example 3: This example demonstrates the clinical outcome of patients with low-grade gliomas benefiting from a combination of IRF5 suppression and TGF-β2 suppression.

[0221] Figure 3 The study presented the results of a clinical outcome study (cBioPortal) involving 513 patients with low-grade gliomas, and the beneficial effect of the combined use of an IRF5-specific antisense agent and a TGF-β2-specific antisense agent on overall survival in patients with low-grade gliomas. Figure 3 Kaplan-Meier plots showed a significant improvement in overall survival for patients with IRF5 levels below the median and low TGF-β2 levels. This study lays the foundation for the therapeutic use of combination IRF5-specific antisense agents with TGF-β2-specific antisense agents in the treatment of low-grade gliomas.

[0222] The median overall survival in the IRF5 (low)-TGFβ2 (low) group was 105 months (log-rank P < 0.0001), which was significantly and unexpectedly prolonged compared with the 27 months observed in the IRF5 (high)-TGFβ2 (high) group.

[0223] Example 4: This example demonstrates that IFNGR2, JAK1, and STAT1 are biomarkers for selecting pediatric DIPG patients. The mRNA levels of IFNGR2, JAK1, and STAT1 can be used alone, in any combination with each other, or in any combination with other biomarkers and patient inclusion criteria to select pediatric DIPG patients.

[0224] Figure 4 Results of a study on pediatric DIPG tumor samples are presented. For primary tumor samples, mRNA expression levels of IFNGR2 (N=45), JAK1 (N=45), and STAT1 (N=45) were obtained, expressed as log2-converted transcripts per million (TPM). IFNGR2 mRNA levels were significantly upregulated in DIPG samples compared to normal pontine tissue (1.58-fold increase; P=0.0006). Pediatric DIPG patients with brain tumors located in the pons / brainstem included molecular subtypes: DMG, H3K27M (N=23); DMG, H3K27M, TP53 (N=8); HGG, H3 wild-type (N=2); HGG, H3 wild-type, TP53 (N=1); HGG, unclassified (N=10); and 1 case undetermined. mRNA expression levels in DIPG samples were compared with levels in normal pontine samples from 29 pontine regions (21 subjects). The bar chart shows the mean mRNA expression levels in tumor samples (dark gray bars) and normal pontine samples (light gray bars). Two-way ANOVA was used to assess the statistical significance of the differences in mRNA expression levels.

[0225] Example 5: This example demonstrates that CD14, CD163, and ITGAX are biomarkers for selecting pediatric DIPG patients. The mRNA levels of CD14, CD163, and ITGAX can be used alone or in any combination with other biomarkers and patient inclusion criteria to select pediatric DIPG patients.

[0226] Figure 5The results of a study on pediatric DIPG tumor samples are presented. Compared with normal brainstem tissue, the expression levels of antigen-presenting cell mRNAs were downregulated in pediatric DIPG tumors. The mRNA expression levels (log2 TPM) of CD14 (N=45), CD163 (N=45), CD86 (N=45), and ITGAX (N=45) were obtained in pediatric DIPG samples and compared with those in normal pons samples. Bar plots show the mean mRNA expression levels in pediatric DIPG patient tumor samples (dark gray bars) compared to normal pons samples (light gray bars). Compared with normal brainstem / pons tissue, the expression of CD14, CD163, and ITGAX mRNAs in pediatric DIPG patients was significantly reduced by 1.64-fold (P=0.037), 1.75-fold (P=0.019), and 3.33-fold (P<0.0001), respectively. Differences in mRNA expression levels were assessed using two-way ANOVA.

Claims

1. A drug agent for treating or alleviating cancer symptoms in a subject, which inhibits or suppresses IRF5 expression.

2. Use of a composition comprising an agent for inhibiting or suppressing IRF5 expression in the preparation of a medicament for treating or alleviating cancer symptoms in a subject.

3. A method for treating or alleviating cancer symptoms in a subject in need, the method comprising: Prepare a pharmaceutical composition comprising an agent for inhibiting or suppressing IRF5 expression; as well as Administer a therapeutically sufficient amount of the composition to the subject.

4. The pharmaceutical preparation, use, or method according to any one of claims 1-3, wherein the cancer is a glioma, a low-grade glioma, a glioblastoma, a diffuse endophytic pontine glioma (DIPG), a diffuse midline glioma (DMG), a leptomeningeal or brain metastasis, a brain or spinal cord cancer, or a CNS tumor.

5. The pharmaceutical preparation, use, or method according to any one of claims 1-3, wherein the cancer is pancreatic cancer.

6. The pharmaceutical preparation, use, or method of any one of claims 1-3, comprising using one or more biomarkers to select subjects who will benefit from the pharmaceutical preparation, use, or method, wherein the biomarker is an elevated level of TGF-β2 and an elevated level of one or more of IFNGR2, JAK1, and STAT1.

7. The pharmaceutical agent, use, or method of any one of claims 1-3, comprising using one or more biomarkers to select subjects who will benefit from the pharmaceutical agent, use, or method, wherein the biomarker is the level of TGF-β2 and the level of one or more of IRF5, TLR9, FOXP3, CCL22, CREB5, CD8a, CD86, CC14, CD163, ITGAX, and CD11c.

8. The agent, use, or method of any one of claims 1-3, wherein the agent, drug, or administration comprises one or more IRF5-specific antisense oligonucleotides that are complementary to the IRF5 transcript and have a length of 15-30 nucleotides.

9. The agent, use, or method of any one of claims 1-3, wherein the agent, drug, or administration comprises one or more IRF5-specific antisense oligonucleotides that are complementary to IRF5 preRNA, premRNA, or mRNA and have a length of 18-21 nucleotides.

10. The pharmaceutical preparation, use, or method according to any one of claims 1-3, wherein the pharmaceutical preparation, drug, or administration comprises one or more IRF5-specific antisense oligonucleotides complementary to the IRF5 transcript as shown in any one of Tables 1, 2, and 3.

11. The pharmaceutical agent, use, or method according to any one of claims 1-3, wherein the pharmaceutical agent, drug, or administration comprises the IRF5-specific antisense oligonucleotide CACACCTGATCAAATTTCTC SEQ ID NO: 1 or C A C A C C T G A T C A A A T T T C T C SEQ ID NO:

657.

12. The pharmaceutical preparation, use, or method according to any one of claims 1-3, comprising the IRF5-specific antisense oligonucleotide shown in any one of Tables 1, 2, and 3, wherein the IRF5-specific antisense oligonucleotide has one or more nucleotides, said one or more nucleotides being chemically modified to be a thiophosphate nucleoside linker, a methoxypropyl phosphate nucleoside linker, an aminophosphoside linker linked to a morpholine group, a 2'-OMe ribose group, a 2'-MOE methoxyethyl ribose group, a 2'-4'-restricted methoxyethyl bicyclic ribose group, a 2'-4'-restricted ethyl bicyclic ribose group, an LNA ribose group, a 2'-F ribose group, or a 5-methylcytosine base.

13. The agent, use, or method according to any one of claims 1-3, wherein the agent is conjugated with polyethylene glycol, lipids, or tribranched N-acetylgalactosamine.

14. The pharmaceutical preparation, use, or method according to any one of claims 1-3, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate-buffered saline, or combinations thereof.

15. The pharmaceutical preparation, use, or method according to any one of claims 1-3, wherein the pharmaceutical preparation, drug, or application is substantially free of excipients.

16. The pharmaceutical preparation, use, or method according to any one of claims 1-3, wherein the pharmaceutical preparation, drug, or administration thereof is stable at 37°C for at least 14 days in a carrier.

17. The agent, use, or method of any one of claims 1-3, wherein the agent, drug, or administration is combined with standard care treatment for cancer.

18. The pharmaceutical agent, use, or method of any one of claims 1-3, wherein the pharmaceutical agent is administered by infusion, injection, or continuous intracranial infusion.

19. The pharmaceutical preparation, use, or method of any one of claims 1-3, comprising any one or more other pharmaceutical products, said other pharmaceutical products including targeted cancer drugs, cancer growth inhibitors or EGFR inhibitors, erlotinib, gefitinib, afatinib, osimertinib, dacomitinib, and combinations thereof.

20. The pharmaceutical preparation, use, or method according to any one of claims 1-3, comprising any one or more other pharmaceutical preparations that are targeted cancer drugs, said targeted cancer drugs being selected from: bevacizumab, everolimus, bezotefantran, dabrafenib, trametinib, and combinations thereof.

21. The pharmaceutical preparation, use, or method according to any one of claims 1-3, comprising any one or more other pharmaceutical preparations that are cancer growth inhibitors, said cancer growth inhibitors being selected from: angiogenesis inhibitors, histone deacetylase inhibitors, hedgehog factor inhibitors, mTOR inhibitors, p53 inhibitors, PARP inhibitors, proteasome inhibitors, tyrosine kinase inhibitors, and combinations thereof.

22. The pharmaceutical preparation, use, or method of any one of claims 1-3, comprising any one or more additional pharmaceutical preparations for treating glioma, selected from TMZ, radiation, and bevacizumab; or comprising one or more additional pharmaceutical preparations for treating pancreatic cancer, selected from paclitaxel, gemcitabine, 5-FU, leucovorin, irinotecan liposome, FOLFOX, FOLFIRI, FOLFIRINOX, and nal-FIRINOX.

23. The agent, use, or method of any one of claims 1-3, wherein the agent, drug, or administration reduces mortality in subjects at 6, 12, 18, 24, 30, or 36 months.

24. The agent, use, or method of any one of claims 1-3, wherein the agent, drug, or administration improves the survival rate of the subject at 6, 12, 18, 24, 30, or 36 months.

25. A reagent kit comprising: The pharmaceutical preparation according to any one of claims 1-3; as well as Carrier.

26. An agent for inhibiting or suppressing IRF5 expression, used in combination with an agent for inhibiting or suppressing TGF-β2 expression for the treatment or relief of cancer symptoms in a subject.

27. Use of a composition comprising a combination of an agent for inhibiting or suppressing IRF5 expression and an agent for inhibiting or suppressing TGF-β2 expression in the preparation of a medicament for treating or alleviating cancer symptoms in a subject.

28. A method for treating or alleviating cancer symptoms in a subject in need, the method comprising: Prepare a pharmaceutical composition comprising a combination of an agent for inhibiting or blocking IRF5 expression and an agent for inhibiting or blocking TGF-β2 expression; as well as Administer a therapeutically sufficient amount of the composition to the subject.

29. The pharmaceutical preparation, use, or method according to any one of claims 26-28, wherein the cancer is a glioma, a low-grade glioma, a glioblastoma, a diffuse entropional glioma (DIPG), a diffuse midline glioma (DMG), a leptomeningeal or brain metastasis, a brain or spinal cord cancer, or a CNS tumor.

30. The pharmaceutical preparation, use, or method according to any one of claims 26-28, wherein the cancer is pancreatic cancer.

31. The pharmaceutical preparation, use, or method of any one of claims 26-28, comprising using one or more biomarkers to select subjects who will benefit from the pharmaceutical preparation, use, or method, wherein the biomarker is a level of TGF-β2 and a level of one or more of IFNGR2, STAT1, IRF1, IRF5, CD276, and CD204.

32. The pharmaceutical preparation, use, or method according to any one of claims 26-28, wherein the cancer is a low-grade glioma whose tumor cells exhibit wild-type IDH1 or IDH2, and one or more of the following: upregulated IFNGR2, upregulated STAT1, upregulated IRF1, upregulated IRF5, upregulated CD276, and upregulated CD204.

33. The pharmaceutical preparation, use, or method according to any one of claims 26-28, wherein the IRF5 preparation, drug, or administration comprises one or more IRF5-specific antisense oligonucleotides that are complementary to the IRF5 transcript and have a length of 15-30 nucleotides.

34. The pharmaceutical preparation, use, or method according to any one of claims 26-28, wherein the IRF5 preparation, drug, or administration comprises one or more IRF5-specific antisense oligonucleotides that are complementary to IRF5 preRNA, premRNA, or mRNA and have a length of 18-21 nucleotides.

35. The pharmaceutical preparation, use, or method of any one of claims 26-28, wherein the IRF5 preparation, drug, or administration comprises one or more IRF5-specific antisense oligonucleotides complementary to the IRF5 transcript as shown in any one of Tables 1, 2, and 3.

36. The agent, use, or method according to any one of claims 26-28, wherein the agent used to inhibit or suppress IRF5 expression is YE6144 (S,E)-N1-(6-fluoro-3-(2-(6-morpholinopyridazine-3-yl)vinyl)-1H-indazol-5-yl)butane-1,2-diamine hydrochloride, an IRF5 dimerizing cell-penetrating peptide inhibitor, an NLS peptide mimic, or a bait peptide.

37. The pharmaceutical preparation, use, or method of any one of claims 26-28, wherein the TGF-β2 preparation, drug, or administration comprises one or more TGF-β2-specific antisense oligonucleotides that are complementary to the TGF-β2 transcript and have a length of 15-30 nucleotides.

38. The pharmaceutical preparation, use, or method according to any one of claims 26-28, wherein the TGF-β2 preparation, drug, or administration comprises one or more TGF-β2-specific antisense oligonucleotides that are complementary to TGF-β2 preRNA, premRNA, or mRNA and have a length of 18-21 nucleotides.

39. The pharmaceutical preparation, use, or method according to any one of claims 26-28, wherein the TGF-β2 preparation, drug, or administration comprises one or more TGF-β2-specific antisense oligonucleotides complementary to the TGF-β2 transcript as described in any one of Tables 4 and 5.

40. The agent, use, or method of any one of claims 26-28, wherein the agent, drug, or administration comprises the combination of CACACCTGATCAAATTTCTC SEQ ID NO: 1 and CGGCATGTCTATTTTGTA SEQ ID NO: 667, or C A C A C C T G A T C A A A T T T C T C SEQ ID NO: 657 and C G G C A T G T C T A T T T T G T A SEQ ID NO:

803.

41. The pharmaceutical preparation, use, or method according to any one of claims 26-28, wherein the antisense oligonucleotide is shown in any one of Tables 1, 2, 3, 4, and 5, and comprises one or more nucleotides, said one or more nucleotides being chemically modified to be a thiophosphate nucleoside linker, a methoxypropyl phosphate nucleoside linker, an aminophosphoside linker linked to a morpholine group, a 2'-OMe ribose group, a 2'-MOE methoxyethyl ribose group, a 2'-4'-restricted methoxyethyl bicyclic ribose group, a 2'-4'-restricted ethyl bicyclic ribose group, an LNA ribose group, a 2'-F ribose group, or a 5-methylcytosine base.

42. The agent, use, or method according to any one of claims 26-28, wherein the agent is conjugated with polyethylene glycol, lipid, or tribranched N-acetylgalactosamine.

43. The pharmaceutical preparation, use, or method according to any one of claims 26-28, comprising a carrier of sterile water for injection, saline, isotonic saline, phosphate-buffered saline, or combinations thereof.

44. The pharmaceutical preparation, use, or method of any one of claims 26-28, wherein the pharmaceutical preparation, drug, or application is substantially free of excipients.

45. The pharmaceutical preparation, use, or method according to any one of claims 26-28, wherein the pharmaceutical preparation, drug, or administration thereof in a carrier is stable at 37°C for at least 14 days.

46. ​​The agent, use, or method of any one of claims 26-28, wherein the agent, drug, or administration is combined with standard care treatment for cancer.

47. The agent, use, or method of any one of claims 26-28, wherein the agent for inhibiting or suppressing IRF5 expression and the agent for inhibiting or suppressing TGF-β2 expression may be administered in parallel, simultaneously, sequentially, or separately in time.

48. The pharmaceutical agent, use, or method of any one of claims 26-28, wherein the pharmaceutical agent is administered by infusion, injection, or continuous intracranial infusion.

49. The pharmaceutical preparation, use, or method of any one of claims 26-28, comprising any one or more other pharmaceutical products, said other pharmaceutical products including targeted cancer drugs, cancer growth inhibitors or EGFR inhibitors, erlotinib, gefitinib, afatinib, osimertinib, dacomitinib, and combinations thereof.

50. Any pharmaceutical agent, use, or method as described in any one of claims 26-28, including any one or more other pharmaceutical agents that are targeted cancer drugs, said targeted cancer drugs being selected from: bevacizumab, everolimus, bezotefantran, dabrafenib, trametinib, and combinations thereof.

51. The pharmaceutical preparation, use, or method according to any one of claims 26-28, comprising any one or more other pharmaceutical preparations that are cancer growth inhibitors, said cancer growth inhibitors being selected from: angiogenesis inhibitors, histone deacetylase inhibitors, hedgehog factor inhibitors, mTOR inhibitors, p53 inhibitors, PARP inhibitors, proteasome inhibitors, tyrosine kinase inhibitors, and combinations thereof.

52. The pharmaceutical preparation, use, or method of any one of claims 26-28, comprising any one or more additional pharmaceutical preparations selected from TMZ, radiation, and bevacizumab for the treatment of glioma; or comprising any one or more additional pharmaceutical preparations selected from any one of the following for the treatment of pancreatic cancer: paclitaxel, gemcitabine, 5FU, leucovorin, irinotecan liposome, FOLFOX, FOLFIRI, FOLFIRINOX, and nal-FIRINOX.

53. The agent, use, or method of any one of claims 26-28, wherein the agent, drug, or administration reduces mortality in subjects at 6, 12, 18, 24, 30, or 36 months.

54. The agent, use, or method of any one of claims 26-28, wherein the agent, drug, or administration improves the survival rate of the subject at 6, 12, 18, 24, 30, or 36 months.

55. A reagent kit comprising: The pharmaceutical preparation according to any one of claims 26-28; as well as Carrier.