Lysosome mediated protein degradation agent based on circular RNA aptamer and preparation method of lysosome mediated protein degradation agent

Abstract

The invention discloses a lysosome mediated protein degradation agent based on a circular RNA (Ribonucleic Acid) aptamer and a preparation method of the lysosome mediated protein degradation agent. The annular RNA aptamer is composed of a transferrin receptor RNA aptamer, an RNA aptamer specifically bound with target protein, a fluorescent RNA aptamer bound with a small molecule dye, and RNA ribozyme with two ends capable of spontaneously forming a ring in a human body, wherein the RNA aptamer is composed of a transferrin receptor RNA aptamer, an RNA aptamer specifically bound with target protein, a fluorescent RNA aptamer bound with a small molecule dye, and an RNA ribozyme with two ends capable of spontaneously forming a ring in the human body. The lysosome mediated protein degradation agent based on the circular RNA aptamer has good stability and low biotoxicity, can efficiently degrade target protein, provides a new platform for precise regulation and control and targeted therapy of cells, and has a potential application prospect.

Description

Technical Field

[0001] This invention belongs to the field of protein degrading agents, and relates to a lysosome-mediated protein degrading agent based on circular RNA aptamers and its preparation method. Background Technology

[0002] The endosome-lysosome pathway is a highly conserved degradation mechanism within cells, primarily responsible for internalizing and removing extracellular substances, cell membrane surface proteins, and harmful intracellular components. Lysosomes mainly function as cleaners within cells, rich in various hydrolytic enzymes, and are the primary site for clearance and degradation. Lysosomes can effectively remove damaged or senescent organelles, misfolded proteins or nucleic acids, and other biomolecules, as well as some endogenous or exogenous intracellular toxins. Therefore, substances entering lysosomes via the endosome-lysosome pathway are degraded by acidic hydrolytic enzymes within the lysosome.

[0003] Protein-targeted degradation (TPD) technology can selectively remove undrugable or disease-related proteins by using bispecific protein degraders. Although there are currently a variety of protein degradation methods, such as lysosome-targeting chimera (LYTAC) ([1]Banik SM, Pedram K, Wisnovsky S. etal., Lysosome-targeting chimaeras for degradation of extracellular proteins. Nature 2020, 584, 291-297.), autophagy-targeting chimeras (AUTACs) and proteolytic-targeting chimeras (PROTACs) ([2]Békés M., Langley DR, Crews CM, PROTAC targeted proteindegraders: the past is prologue. Nat. Rev. Drug Discov. 2022 21, 181-200.), these are limited by cell permeability or need to be delivered into cells, which may lead to many adverse side effects and reduce efficacy, such as excessive cytotoxicity. Gene-encoded RNA possesses the advantages of precise and predictable base pairing and flexible programmable design characteristics. It can be transcribed and directly generated in cells and has been widely used in non-invasive monitoring of proteins, RNA, and small molecules. However, the development and application of gene-encoded RNA in the field of targeted protein degradation still lags far behind its development in biosensing. Recent studies have shown that artificial non-coding RNAs composed of target protein aptamers and E3 ubiquitin ligase binding sequences can be expressed in living cells via vectors to degrade a variety of oncogenes ([3] Cao C., Wang X., Li J., etal., Engineering artificial non-coding RNAs for targeted protein degradation. Nat. Chem. Biol. 2025 21, 393-401.). However, linear non-coding RNAs have poor stability, which greatly limits their efficiency and duration of protein degradation. Therefore, the development of new low-toxicity, stable lysosome-mediated protein degradation agents is of great significance. Summary of the Invention

[0004] The purpose of this invention is to provide a lysosome-mediated protein degrader based on a circular RNA aptamer and its preparation method. This lysosome-mediated targeted protein degrader has advantages such as high efficiency, stability, and low cytotoxicity. This invention involves cloning the gene encoding the aptamer into a plasmid vector, then delivering it into cells. After the circular RNA aptamer is autonomously expressed in vivo, it is delivered to the lysosome via transferrin receptor-mediated endocytosis. Various proteolytic enzymes within the lysosome then degrade the target protein, thereby achieving targeted therapy.

[0005] The technical solution for achieving the objective of this invention is as follows:

[0006] This lysosome-mediated protein degrader, based on a circular RNA aptamer, is an RNA nanostructure composed of five functionalized RNA sequences linked by a linker: from 5' to 3', it consists of a 5' ribozyme, Linker A1, an RNA aptamer Tr14 targeting the transferrin receptor on the endosomal surface, Linker A2, a fluorescent RNA aptamer that binds to a small dye, Linker A3, an RNA aptamer that specifically binds to the target protein, Linker A4, and the 3' ribozyme. Linker A1, Linker A2, Linker A3, and Linker... A4 acts as an insulator to prevent functionalized RNA sequences from interfering with each other; the transferrin receptor aptamer Tr14 consists of two sets of complementary base pairs and a stem-loop structure that can form a specific binding structure with the transferrin receptor; the fluorescent RNA aptamer that binds to small molecule dyes consists of a pair of complementary base pairs and a stem-loop structure that can form a specific binding structure with small molecule dyes; the RNA aptamer that specifically binds to the target protein consists of a set of complementary base pairs and a loop structure that can form a specific binding structure with the target protein.

[0007] Furthermore, the partial complementary pairing of the two chains Linker A1 and Linker A4 helps to form a ring structure.

[0008] Furthermore, the target protein is a protein that can be degraded by acidic hydrolases in lysosomes, such as a highly expressed or mutated protein that can lead to abnormal tumor proliferation. In a specific embodiment of the present invention, the p53 mutant protein p53-R175H is taken as an example.

[0009] Furthermore, small molecule dyes include, but are not limited to, HBC dyes.

[0010] Furthermore, the 5' ribozyme consists of four sets of complementary base pairs and a base sequence capable of forming four stem-loop structures. The entire ribozyme is detached after transcription. In a specific embodiment of the present invention, the 5' ribozyme uses complementary base pairs at positions 1-3 and 14-16, positions 17-19 and 51-53, positions 25-26 and 43-44, and positions 29-30 and 39-40. The remaining portion forms four stem-loop structures, which are detached after transcription. The specific sequence is: GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACCGCCU (SEQ ID No. 1).

[0011] Furthermore, the 3' ribozyme contains two sets of complementary base pairs, with the remaining portion forming a circular structure. In a specific embodiment of the present invention, the 14th to 17th bases of the 3' ribozyme sequence are complementary to the 26th to 29th bases, and the 36th to 40th bases are complementary to the 49th to 53rd bases, with the remaining portion forming a circular structure. The specific sequence is: AACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCACGC (SEQ ID No. 2).

[0012] Furthermore, the sequence of Linker A1 is AACCAUGCCGACUGAUGGCAG (SEQ ID No. 3), which serves as an isolation mechanism and promotes ring formation; the sequence of Linker A2 is GUACAUUCUAGAUACGC (SEQ ID No. 4); the sequence of Linker A3 is AAAAAAAAA; and the sequence of Linker A4 is CUGCCAUCAGUCGGCGUGGACUGUAG (SEQ ID No. 5), which also serves as an isolation mechanism and promotes ring formation. Moreover, the bases at positions 4 to 21 of Linker A1 are complementary to the bases at positions 1 to 18 of Linker A4, and this part of the structure is conducive to the formation of a ring structure by the entire chain.

[0013] Furthermore, the RNA aptamer Tr14, which targets the transferrin receptor on the endosome surface, has the sequence GGGGCUCAAUGCGUUCACGUUUAUUCACAUUUUUGAAUUGAGC (SEQ ID No. 6); the fluorescent RNA aptamer that binds to the small molecule dye is the aptamer Pepper, with the sequence GGUAUCCCCAAUCGUGGCGUGUCGGCCUGCUUCGGCAGGCACUGGCGCCGGGAUACC (SEQ ID No. 6). No. 7), the first eight bases GGUAUCCC and the last eight bases GGGAUACC at the 5' end are complementary, forming a stem-loop structure in the middle. This part can bind to small molecule dyes; the RNA aptamer that specifically binds to the target protein is aptamer p53m-RA. From the 5' end to the 3' end, the 7th to 14th bases are paired with the 18th to 25th bases, of which the 7th to 9th bases are complementary to the 23rd to 25th bases, the 13th to 14th bases are complementary to the 18th to 19th bases, and the rest are special non-standard pairings. The remaining part forms a loop structure. The specific sequence is AUUAGCGCAUUUUAACAUAGGGUGC (SEQ ID No. 8).

[0014] The specific steps of the preparation method of the above-mentioned lysosome-mediated protein degrader are as follows: synthesize a DNA fragment that can express the above-mentioned lysosome-mediated protein degrader and is modified with NheI and XbaI restriction sites at both ends, then clone it into the vector pcDNA3.1 (+), transport the positive clone vector into the cell, and autonomously express it in the cell to generate a linear RNA aptamer. In vivo, the RNA at both ends is hydrolyzed by ribozymes to generate 3'-cyclic phosphate and 5'-hydroxyl groups, and then circularized under the action of RTCB ligase to form a lysosome-mediated protein degrader.

[0015] Furthermore, the NheI restriction site sequence is GCTAGC, and the XbaI restriction site sequence is TCTAGA.

[0016] Furthermore, the RNA sequence transcribed in vivo from a DNA fragment capable of expressing the aforementioned lysosome-mediated protein degrading agent and modified at both ends with NheI and XbaI restriction sites is shown in SEQ ID No. 9.

[0017] Compared with the prior art, the present invention has the following advantages:

[0018] (1) In the lysosome-mediated protein degradation agent based on circular RNA aptamers of the present invention, the ribozymes modified at the 5' and 3' ends can spontaneously hydrolyze the RNA chain to produce 3'-cyclic phosphate and 5'-hydroxyl groups during transcription after the vector is transported into the cell. Then, under the action of RTCB ligase in vivo, they autonomously form a ring. Since circular RNA lacks 5' and 3' ends, it can resist nuclease hydrolysis, effectively avoid the defect of linear RNA being easily degraded, and has strong stability while improving degradation efficiency.

[0019] (2) The lysosome-mediated protein degradation agent based on circular RNA aptamers of the present invention actively guides the target protein into the endosome-lysosome pathway by linking the target protein to the endocytic receptor across the membrane, and the target protein is ultimately completely cleared by lysosomal enzymes, avoiding off-target toxicity and exhibiting higher stability and regulatory precision. The present invention provides a novel universal platform for targeted protein degradation in living cells, showing broad application prospects in the field of precision medicine. Attached Figure Description

[0020] Figure 1 A schematic diagram illustrating the structure and working mechanism of a lysosome-mediated protein degrader based on a circular RNA aptamer;

[0021] Figure 2 These are images showing the colocalization results of cells and lysosomes after different treatments in Examples 1-4;

[0022] Figure 3 The images show the results of the target proteins entering the lysosomes and being degraded after treatment under different conditions in Examples 1-4. Detailed Implementation

[0023] The present invention will now be described in further detail with reference to specific embodiments and accompanying drawings.

[0024] Example 1

[0025] 1. A lysosome-mediated protein degradation agent based on circular RNA aptamers, which is an RNA nanostructure composed of five functionalized RNA sequences linked by a linker: from the 5' end to the 3' end, the sequence is as follows: 5' ribozyme, Linker A1, RNA aptamer Tr14 targeting the transferrin receptor on the endosomal surface, Linker A2, fluorescent RNA aptamer that binds to a small molecule dye, Linker A3, RNA aptamer that specifically binds to the target protein, Linker A4, and 3' ribozyme. The 5' end RNA ribozyme has the following base sequence: 5'-GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACCGCCU-3' (SEQ ID No. 1); the 3' end ribozyme has the following base sequence: 5'-AACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCACGC-3' (SEQ ID No. 2); Linker A1 has the following base sequence: AACCAUGCCGACUGAUGGCAG (SEQ ID No. 3), which acts as an isolator and promotes loop formation; Linker A2 has the following base sequence: GUACAUUCUAGAUACGC (SEQ ID No. 4); Linker A3 has the following base sequence: AAAAAAAAA; Linker A4 has the following base sequence: CUGCCAUCAGUCGGCGUGGACUGUAG (SEQ ID No. 3). No. 5); The base sequence of the RNA aptamer Tr14, which targets the transferrin receptor on the endosome surface, is: 5'-GGGGCUCAAUGCGUUCACGUUUAUUCACAUUUUUGAAUUGAGC-3' (SEQ ID No. 6); The base sequence of the fluorescent RNA aptamer Pepper, which binds to a small molecule dye, is: 5'-GGUAUCCCCAAUCGUGGCGUGUCGGCCUGCUUCGGCAGGCACUGGCGCCGGGAUACC-3' (SEQ ID No. 7); The base sequence of the RNA aptamer p53m-RA, which specifically binds to the target protein p53-R175H, is: 5'-AUUAGCGCAUUUUAACAUAGGGUGC-3' (SEQ ID No. 8).

[0026] 2. The preparation of lysosome-mediated protein degrading agents based on circular RNA aptamers and their targeting of lysosomes via the endosomal pathway, such as... Figure 1 As shown, the details are as follows:

[0027] (1) Seeding dish: After digesting the adherent SK-BR-3 cells with trypsin, prepare them to a suitable cell density, and add 100 μL of cell suspension to each well of a four-well focusing dish. Culture for one day or observe the cells after they adhere to the wall the next day.

[0028] (2) Preparation of lysosome-mediated protein degrading agent: 100 ng of a DNA fragment (the RNA sequence after in vivo transcription is CRPD, SEQ ID No. 9) capable of expressing the above-mentioned lysosome-mediated protein degrading agent and modified with NheI and XbaI restriction sites at both ends was mixed with 5208 ng of plasmid vector pcDNA3.1 (+) with NheI and XbaI restriction sites exposed at both ends. The mixture was incubated at 16℃ for 12 h in a shaker at 200 rpm. The ligated plasmid vector was then transfected into bacteria. After successful ligation was verified by plating, bacteria were selected for amplification and expression. The bacteria were cultured overnight at 37℃ for 200 rpm. Finally, the fragment was extracted, purified, and sequenced successfully before use. The NheI restriction site was GCTAGC, and the XbaI restriction site was TCTAGA.

[0029] (3) Transfecting the cells with a plasmid that can express lysosome-mediated protein degradation agent: First, take 1000 ng of the plasmid vector that can express lysosome-mediated protein degradation agent and add 1 μL of FuGENE® HD. Then, make up to 100 μL with MEM medium and mix well. Incubate the mixture at room temperature for 15 min. Then, remove the medium from the dish containing the seeded cells and add the lysosome-mediated protein degradation agent solution prepared above. Then, incubate in a 37 ℃ constant temperature incubator for 24 h. All conditions are the same for the control group.

[0030] (4) Antibody incubation: After 24 h, the lysosome-mediated protein degradation agent solution was aspirated, washed 3 times with PBS, fixed with 4% paraformaldehyde for 10 minutes, and fixed with 0.2% Triton X-100 for 10 minutes. Then, the cells were pre-blocked in PBS containing 10% fetal bovine serum (FBS) and 5% (BSA) bovine serum albumin at 37 °C for 1 hour. The cells were then incubated with p53-R175H antibody at 37 °C for 1 hour. Finally, the cells were incubated with Flour Alexa 488 goat anti-rabbit IgG (green) at room temperature for 1 hour.

[0031] Comparative Example 1

[0032] Comparative Example 1 is basically the same as Example 1, except that the transported protein-targeting degrader carrier is a protein-targeting degrader carrier that does not contain the base sequence of the transferrin receptor aptamer and is replaced by a meaningless sequence of the same length. The corresponding RNA sequence after in vivo transcription is CRPP (SEQ ID No. 10).

[0033] Comparative Example 2

[0034] Comparative Example 2 is basically the same as Example 1. This example is basically the same as Example 1, except that the transported vector is a protein-targeting degrader carrier that expresses the removal of the target protein part and is replaced by a meaningless sequence of the same length. The corresponding in vivo transcribed RNA sequence is CRPT (SEQ ID No. 11).

[0035] Table 1. Post-transcriptional RNA sequences in vivo

[0036] Name Nucleic acid sequence (5’-3’) CRPD (SEQ ID No.9) gccaucauuc gccgguccca agcccggaua aaaugggagg gggcgggaaaccgccuaacc augccgacug auggcaggga aguugccaug uguaucgggggcucaaugcg uucacguuua uucacauuuu ugaauugagc aacaaacaaagguaucccca aucguggcgu gucggccugc uucggcaggc acuggcgccgggauaccaaa cgauacucug augauccauu agcgcauuuu aacauagggugcggaucauu cauggcaacu gccaucaguc ggcguggacu guagaacacugccaaugccg gucccaagcc cggauaaaag uggaggguac aguccacgc CRPP (SEQ ID No.10) gccaucaguc gccgguccca agcccggaua aaaugggagg gggcgggaaaccgccuaacc augccgacug auggcaggga aguugccaug uguaucggaacuacauacau aaucuaucgu acuacaucac ugauaugcag aacaaacaaagguaucccca aucguggcgu gucggccugc uucggcaggc acuggcgccgggauaccaaa cgauacucug augauccauu agcgcauuuu aacauagggugcggaucauu cauggcaacu gccaucaguc ggcguggacu guagaacacugccaaugccg gucccaagcc cggauaaaag uggaggguac aguccacgc CRPT (SEQ ID No.11) gccaucaguc gccgguccca agcccggaua aaaugggagg gggcgggaaaccgccuaacc augccgacug auggcaggga aguugccaug uguaucgggggcucaaugcg uucacguuua uucacauuuu ugaauugagc aacaaacaaagguaucccca aucguggcgu gucggccugc uucggcaggc acuggcgccgggauaccaaa cgauacucug augauccaaa caaacaaaca aacaaacaaacaggaucauu cauggcaacu gccaucaguc ggcguggacu guagaacacugccaaugccg gucccaagcc cggauaaaag uggaggguac aguccacgc

[0037] Example 2

[0038] This embodiment is the same as the first three steps in Example 1. After transfection for 24 h, 1 μL of Lyso Tracker Blue is mixed with 1 mL of PBS solution. After mixing evenly, the culture medium in the confocal dish is aspirated and incubated with the dye mixture for 30 min.

[0039] Example 3

[0040] Cells and lysosomes treated in Examples 1-2 and Comparative Examples 1-2 were imaged. All cell experimental groups were labeled with 10 μM HBC 620 dye (red) and incubated at 37 °C for 10 min, and then imaged using a confocal microscope.

[0041] from Figure 2 The results of the laser confocal imaging experiment show that only the protein degrading agents expressed by the dual-target circular RNA aptamer, i.e., lysosome-mediated protein degraders, and the degraders with only the target protein portion removed (red) can enter the lysosome (blue).

[0042] from Figure 3 The results of the laser confocal imaging experiment show that after antibody incubation, only the lysosome-mediated protein-targeting degrader can degrade p53-R175H, as evidenced by a significant reduction in green fluorescence. However, the removal of the transferrin receptor aptamer and the removal of the protein-targeting aptamer did not result in a significant decrease in protein content, indicating that the lysosome-mediated protein-targeting degrader has a good degradation effect.

Claims

1. A lysosome-mediated protein degradation agent based on circular RNA aptamers, characterized in that, This is an RNA nanostructure composed of five functionalized RNA sequences linked by a linker: from 5' to 3', the sequences are: a 5' ribozyme, Linker A1, an RNA aptamer Tr14 targeting the transferrin receptor on the endosomal surface, Linker A2, a fluorescent RNA aptamer that binds to a small dye, Linker A3, an RNA aptamer that specifically binds to the target protein, Linker A4, and the 3' ribozyme. A4 acts as an insulator to prevent functionalized RNA sequences from interfering with each other; the transferrin receptor aptamer Tr14 consists of two sets of complementary base pairs and a stem-loop structure that can form a specific binding structure with the transferrin receptor; the fluorescent RNA aptamer that binds to small molecule dyes consists of a pair of complementary base pairs and a stem-loop structure that can form a specific binding structure with small molecule dyes; the RNA aptamer that specifically binds to the target protein consists of a set of complementary base pairs and a loop structure that can form a specific binding structure with the target protein.

2. The lysosome-mediated protein degradation agent according to claim 1, characterized in that, The Linker A1 and Linker A4 chains are partially complementary, and the target protein is a protein that can be degraded by acidic hydrolases in lysosomes.

3. The lysosome-mediated protein degradation agent according to claim 1, characterized in that, The target protein is the p53 mutant protein p53-R175H, and the small molecule dye is HBC dye.

4. The lysosome-mediated protein degradation agent according to claim 1, characterized in that, The 5' ribozyme consists of four sets of complementary base pairs and a base sequence that can form four stem-loop structures. The 3' ribozyme contains two sets of complementary base pairs, with the remaining part forming a loop structure.

5. The lysosome-mediated protein degradation agent according to claim 1, characterized in that, The 5' ribozyme's base sequence is GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACCGCCU.

6. The lysosome-mediated protein degradation agent according to claim 1, characterized in that, The 3' ribozyme has the following base sequence: AACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCACGC.

7. The lysosome-mediated protein degradation agent according to claim 1, characterized in that, The sequence of Linker A1 is AACCAUGCCGACUGAUGGCAG; the sequence of Linker A2 is GUACAUUCUAGAUACGC; the sequence of Linker A3 is AAAAAAAAA; and the sequence of Linker A4 is CUGCCAUCAGUCGGCGUGGACUGUAG.

8. The lysosome-mediated protein degradation agent according to claim 1, characterized in that, The RNA aptamer Tr14, which targets the transferrin receptor on the endosome surface, has the sequence GGGGCUCAAUGCGUUCACGUUUAUUCACAUUUUUGAAUUGAGC; the fluorescent RNA aptamer that binds to a small molecule dye is aptamer Pepper, with the sequence GGUAUCCCCAAUCGUGGCGUGUCGGCCUGCUUCGGCAGGCACUGGCGCCGGGAUACC; and the RNA aptamer that specifically binds to the target protein is aptamer p53m-RA, with the sequence AUUAGCGCAUUUUAACAUAGGGUGC.

9. The method for preparing the lysosome-mediated protein degradation agent according to any one of claims 1 to 8, characterized in that, The specific steps are as follows: synthesize a DNA fragment that can express a lysosome-mediated protein degrader and is modified with NheI and XbaI restriction sites at both ends, then clone it into the vector pcDNA3.1 (+), transport the positive clone vector into the cell, and autonomously express it in the cell to generate a linear RNA aptamer. In vivo, the RNA at both ends is hydrolyzed by ribozymes to generate 3'-cyclic phosphate and 5'-hydroxyl groups, which are then circulated under the action of RTCB ligase to form a lysosome-mediated protein degrader.

10. The preparation method according to claim 9, characterized in that, The NheI restriction site sequence is GCTAGC, and the XbaI restriction site sequence is TCTAGA; the RNA sequence after in vivo transcription of a DNA fragment that can express a lysosomal-mediated protein degrader and is modified with NheI and XbaI restriction sites at both ends is shown in SEQ ID No. 9.

Images