Preparation and application of highly tumor-specific and efficient killing engineered virus

Abstract

The present application relates to a kind of highly tumor specificity and preparation and application of high-efficiency killing engineering virus.Specifically, the present application relates to a kind of recombinant oncolytic virus based on HSV-1 modification, mainly includes: in the coding region of ICP6 gene of wild type HSV-1 Insert a diphtheria toxin A subunit (DT-A) expression frame driven by tumor-specific promoter (such as Survivin), to realize the specific recognition and high-efficiency direct killing to tumor cells, and cooperate with the red blood cell treated by cationic polymer to realize liver-targeted delivery.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the preparation and application of a highly tumor-specific and highly efficient killing engineered virus. Background Technology

[0002] With the continued rise in global cancer incidence, cancer has become one of the major diseases threatening human health. Hepatocellular carcinoma (HCC) is characterized by high incidence and mortality rates, and most patients are diagnosed at an advanced stage, missing the optimal treatment window. Although strategies such as surgery, targeted therapy, and immunotherapy have made some progress, their efficacy is limited, recurrence and metastasis are common, and significant individual differences exist. Currently, there are no approved oncolytic virus products specifically for liver cancer, and the treatment options for liver cancer still do not meet the needs.

[0003] Oncolytic virus therapy, as an important direction in tumor biotherapy, has developed rapidly in recent years, with six oncolytic virus products approved for marketing globally, including Ancori, T-VEC, Nadofaragene firadenovec, and Delytact. Among them, T-VEC, launched in 2015, and Delytact, launched in 2021, represent second-generation oncolytic viruses based on genetic engineering optimization. They are both derived from HSV-1 (Herpes Simplex Virus-1), utilizing a non-essential region in the HSV-1 genome that can accommodate approximately 30 kb of exogenous sequences to express immunomodulatory factors to enhance anti-tumor responses.

[0004] Currently, the main strategies employed in oncolytic virus modification include expressing cytokines and chemokines to promote anti-tumor immunity. Examples include T-VEC oncolytic virus expressing GM-CSF and VG161 oncolytic virus carrying IL12, IL15 / 15RA (IL15 and the α subunit of the IL15 receptor), and PD-L1 blockade. However, the therapeutic mechanism of these products primarily relies on promoting immune activation rather than directly enhancing tumor cell killing. In HCC, the tumor microenvironment exhibits significant immunosuppressive characteristics, including T cell dysfunction, immunosuppressive cells, and cytokine enrichment, making it difficult for oncolytic viruses that rely solely on immune activation to achieve ideal therapeutic effects. Furthermore, existing oncolytic viruses use non-specific CMV promoters to drive exogenous gene expression, lacking tumor cell selectivity and direct tumor cell killing capabilities.

[0005] Therefore, there is an urgent need in this field to develop an engineered virus with high tumor specificity and efficient tumor killing ability. Summary of the Invention

[0006] The purpose of this invention is to provide an engineered virus with high tumor specificity and efficient tumor killing ability.

[0007] The first aspect of the present invention provides a recombinant oncolytic virus, which is obtained by genetically engineering wild-type herpes simplex virus type I (HSV-1), wherein the genome of wild-type HSV-1 contains ICP34.5, TK, ICP6, ICP34.5 and UL47 genes arranged sequentially; the modification includes: inserting an exogenous expression cassette into the coding region of the ICP6 gene, wherein the exogenous expression cassette contains a tumor-specific promoter and a cytotoxic protein coding sequence driven therefrom.

[0008] In another preferred embodiment, the KOS strain of wild-type HSV-1 has the ATCC number VR-1493.

[0009] In another preferred embodiment, the inserted exogenous expression cassette can cause the ICP6 gene to become inactive.

[0010] In another preferred embodiment, the tumor-specific promoter is selected from the group consisting of Survivin, TERT, CEA, E2F-1, AFP, Nestin promoter, or a combination thereof.

[0011] In another preferred embodiment, the tumor-specific promoter is the Survivin promoter.

[0012] In another preferred embodiment, the cytotoxic protein is selected from Pseudomonas aeruginosa exotoxin A (PEA) or diphtheria toxin (DT), with diphtheria toxin being preferred.

[0013] In another preferred embodiment, the cytotoxic protein coding sequence encodes the diphtheria toxin A subunit (DT-A).

[0014] In another preferred embodiment, the structure of the exogenous expression cassette from the 5' end to the 3' end is as follows: tumor-specific promoter - cytotoxic protein coding sequence - first polyadenylated nucleotide signal sequence - constitutive promoter - reporter gene coding sequence - second polyadenylated nucleotide signal sequence.

[0015] In another preferred embodiment, the constitutive promoter is selected from the group consisting of CMV promoters.

[0016] In another preferred embodiment, the reporter gene coding sequence encodes green fluorescent protein (GFP), red fluorescent protein (RFP), and β-galactosidase (lacZ).

[0017] In another preferred embodiment, the first polyadenylated signal sequence and the second polyadenylated signal sequence are each independently selected from the group consisting of bovine growth hormone polyadenylated signal sequence (BGH pA) or simian vacuolating virus 40 (SV40) Late poly(A).

[0018] In another preferred embodiment, both the first polyadenylated signal sequence and the second polyadenylated signal sequence are bovine growth hormone polyadenylated signal sequences (BGH pA).

[0019] In another preferred embodiment, the exogenous expression cassette is inserted into the ICP6 gene via homologous recombination or CRISPR-Cas9-mediated gene editing.

[0020] In another preferred embodiment, the exogenous expression box includes the diphtheria toxin A subunit (DT-A) with the sequence shown in SEQ ID NO: 1.

[0021] In another preferred embodiment, the insertion refers to inserting the exogenous expression cassette into position 1506 of the sequence in the ICP6 gene (Genebank number NC_075687.1).

[0022] In another preferred embodiment, the recombinant oncolytic virus comprises Pseudomonas aeruginosa exotoxin A (PEA) with the sequence shown in SEQ ID NO: 2.

[0023] In a second aspect of the invention, a pharmaceutical composition is provided comprising the recombinant oncolytic virus described in the first aspect of the invention as an active ingredient.

[0024] In another preferred embodiment, the recombinant oncolytic virus is expressed at a concentration of 1 × 10⁻⁶. 3 PFU up to 1×10 10 PFU dosage administration.

[0025] In a third aspect of the invention, a targeted delivery system is provided for delivering the recombinant oncolytic virus according to the first aspect of the invention, the system comprising: erythrocytes treated with a cationic polymer, and the recombinant oncolytic virus adsorbed on the surface of the erythrocytes.

[0026] In another preferred embodiment, the cationic polymer is selected from the group consisting of polyamide-amine dendritic polymers.

[0027] In another preferred embodiment, the cationic polymer is selected from the group consisting of polyamide-amine (PAMAM), polyethyleneimine (PEI), polylysine (PLL), or combinations thereof.

[0028] In another preferred embodiment, the cationic polymer is a fourth-generation polyamide-amine (PAMAM-G4).

[0029] In another preferred embodiment, the red blood cells are autologous red blood cells.

[0030] In another preferred embodiment, the recombinant oncolytic virus is loaded onto the surface of the erythrocyte membrane treated with the cationic polymer via electrostatic adsorption.

[0031] In another preferred embodiment, the targeted delivery system is used to deliver the recombinant oncolytic virus described above to a target organ.

[0032] In another preferred embodiment, the target organ is selected from the group consisting of liver, intestine, lung, or brain.

[0033] In another preferred embodiment, in the targeted delivery system, viral particles can be detected on the surface of more than 90% (preferably more than 95%) of red blood cells by flow cytometry.

[0034] In a fourth aspect of the invention, the use of the recombinant oncolytic virus according to the first aspect of the invention, the pharmaceutical composition according to the second aspect of the invention, or the targeted delivery system according to the third aspect of the invention in the preparation of a medicament for treating cancer is provided.

[0035] In another preferred embodiment, the cancer is selected from the group consisting of: liver cancer, colorectal cancer, glioma, lung cancer, colon cancer, prostate cancer, thyroid cancer, breast cancer, brain cancer, head and neck cancer, esophageal cancer, skin cancer, thymic cancer, stomach cancer, colon cancer, ovarian cancer, uterine cancer, bladder cancer, rectal cancer, gallbladder cancer, bile duct cancer, pancreatic cancer, non-small cell lung cancer, bone cancer, intraocular melanoma, perianal cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, small intestine cancer, endocrine gland cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, chronic leukemia, acute leukemia, lymphocytic lymphoma, kidney cancer, ureteral cancer, renal cell carcinoma, renal pelvis cancer, central nervous system tumors, primary central nervous system lymphoma, spinal cord tumors, pituitary adenomas, or combinations thereof.

[0036] In another preferred embodiment, the cancer is selected from the group consisting of liver cancer, colorectal cancer, glioma, or lung cancer.

[0037] In a fifth aspect of the present invention, a method for preparing a recombinant oncolytic virus is provided, comprising the following steps: inserting an exogenous expression cassette into the ICP6 gene site of the wild-type HSV-1 genome, the exogenous expression cassette containing a tumor-specific promoter and a cytotoxic protein coding sequence driven by the promoter, thereby obtaining a recombinant oncolytic virus.

[0038] In another preferred embodiment, the structure of the exogenous expression cassette from the 5' end to the 3' end is as follows: tumor-specific promoter - cytotoxic protein coding sequence - first polyadenylated nucleotide signal sequence - constitutive promoter - reporter gene coding sequence - second polyadenylated nucleotide signal sequence.

[0039] In another preferred embodiment, the exogenous expression box includes the diphtheria toxin A subunit (DT-A) with the sequence shown in SEQ ID NO: 1.

[0040] In a sixth aspect of the present invention, a method for preparing the targeted delivery system described in the third aspect of the present invention is provided, comprising the steps of:

[0041] (a) Obtaining red blood cells from the target individual;

[0042] (b) The red blood cells were co-incubated with a cationic polymer to obtain treated red blood cells with a positively charged surface;

[0043] (c) The treated red blood cells are co-incubated with the recombinant oncolytic virus described in the first aspect of the present invention, so that the virus particles are adsorbed onto the surface of the red blood cells, thereby obtaining the targeted delivery system.

[0044] In another preferred embodiment, in step (b), the cationic polymer is PAMAM-G4, the incubation concentration is 10-100 μg / mL, and the incubation time is 2-24 hours.

[0045] In another preferred embodiment, in step (c), the incubation ratio of the recombinant oncolytic virus to red blood cells is 1 × 10⁻⁶. 6 -1×10 8 PFU virus particles / 10 6 One red blood cell.

[0046] In a seventh aspect of the invention, a method for treating cancer is provided, comprising administering to a subject in need a therapeutically effective amount of the recombinant oncolytic virus according to the first aspect of the invention, the pharmaceutical composition according to the second aspect of the invention, or the targeted delivery system according to the third aspect of the invention.

[0047] In another preferred embodiment, the administration method is selected from the group consisting of: intravenous injection, intraperitoneal injection, or intratumoral injection.

[0048] In another preferred embodiment, the oncolytic virus is expressed at a concentration of 1 × 10⁻⁶. 3 PFU up to 1×10 10 PFU dosage administration.

[0049] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0050] Figure 1 The diagram shown is a schematic representation of the structure of the tumor cell-specific, highly efficient oncolytic virus G001 and the control virus G001c that is inactivated by ICP6 in an embodiment of the present invention.

[0051] Figure 2 The image shown is a graph illustrating the results of detecting the expression of Survivin, TERT, and CEA in tumor tissues in an embodiment of the present invention.

[0052] Figure 3 The figure shown is a graph of the expression results of ICP0, GFP and DT-A proteins detected at different time points after A548 cells were infected with G001 in an embodiment of the present invention.

[0053] Figure 4 The figure shown is a result of G001 having a stronger killing effect on different tumor cells in an embodiment of the present invention.

[0054] Figure 5 The figure shown is a result of the G001 virus significantly increasing the expression level of the apoptosis marker protein CleavedPARP in an embodiment of the present invention.

[0055] Figure 6 The diagram shows how G001 significantly reduced tumor volume in mice in an embodiment of the present invention. A. Schematic diagram of tumorigenesis and oncolytic virus inoculation time in mice; B. Tumor volume on day 19; C. Tumor weight on day 19; D. Tumor volume growth curve.

[0056] Figure 7 The diagram shown illustrates the preparation and injection of a liver-targeting erythrocyte vector carrying oncolytic virus particles, as described in an embodiment of the present invention.

[0057] Figure 8 The image shown is a result diagram showing that, in an embodiment of the present invention, virus particles are mainly loaded on the surface of red blood cell membranes.

[0058] Figure 9 The figure shown is a result diagram of red blood cells loaded with oncolytic virus particles in an embodiment of the present invention.

[0059] Figure 10 The image shown is a graph illustrating the enrichment of red blood cells carrying G001 virus particles in different organs after intravenous injection in an embodiment of the present invention.

[0060] Figure 11 The diagram shown is a flowchart and results of the detection of liver-targeted G001 significantly prolonging the survival of mice with orthotopic hepatocellular carcinoma in an embodiment of the present invention.

[0061] Figure 12 The diagram shows the distribution of G001 in different organs in an embodiment of the present invention.

[0062] the term

[0063] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0064] As used herein, the terms “including” or “containing” include “comprising,” “mainly composed of,” “substantially composed of,” and “composed of”; “mainly composed of,” “substantially composed of,” and “composed of” are subordinate concepts of “containing,” “having,” or “including.”

[0065] As used herein, the term "HSV-1" refers to Herpes Simplex Virus type 1. The oncolytic virus described in this invention is genetically engineered based on this viral backbone.

[0066] As used herein, the term "wild-type HSV-1 genome structure" refers to the specific viral genome background targeted by this invention. In this application, it specifically refers to a region in the genome from the 5' end to the 3' end that sequentially contains the ICP34.5 gene, the TK gene (thymidine kinase gene), the ICP6 gene (ribonucleotide reductase large subunit gene), another ICP34.5 gene, and the UL47 gene. This structure provides a clear reference for locating the insertion site.

[0067] As used herein, the term "ICP6 gene" refers to the large subunit gene of ribonucleotide reductase in HSV-1, a non-essential viral gene commonly used as an insertion site for exogenous genes. In this invention, "insertion in the ICP6 gene" means inserting an exogenous expression cassette within the coding sequence of the gene or at a location that can inactivate its function.

[0068] As used herein, the term "exogenous expression cassette" refers to an artificially constructed DNA sequence inserted into the viral genome using genetic engineering techniques. In this invention, it specifically refers to a combination of elements in a particular order, one specific structure of which, from the 5' end to the 3' end, consists of: a tumor-specific promoter, a cytotoxic protein coding sequence (e.g., Toxin), a first polyadenylated nucleotide signal sequence (e.g., BGH pA), a constitutive promoter (e.g., the CMV promoter), a reporter gene coding sequence (e.g., GFP), and a second polyadenylated nucleotide signal sequence (e.g., BGH pA).

[0069] As used herein, the term "BGH pA" refers to the bovine growth hormone polyadenylation signal sequence. It is used to ensure the effective termination and polyadenylation of the transcripts of its upstream genes.

[0070] As used in this article, the term "promoter" refers to a DNA sequence that guides the initiation of gene transcription.

[0071] As used herein, the term "tumor-specific promoter" refers to a promoter whose transcriptional activity is significantly higher in tumor cells than in normal cells. Specific examples in this invention include, but are not limited to: the Survivin gene promoter, the TERT (telomerase reverse transcriptase) gene promoter, and the CEA (carcinoembryonic antigen) gene promoter.

[0072] As used herein, the term "constitutive promoter" refers to a promoter that exhibits sustained and stable transcriptional activity in multiple cell types. In this invention, a specific example is the early CMV (cytomegalovirus) promoter.

[0073] As used herein, the term "cytotoxic protein" refers to a protein that, when expressed within a cell, can cause cell death. In this invention, a specific example is the diphtheria toxin A subunit.

[0074] As used in this article, the terms "effect protein" and "diphtheria toxin A subunit" and "(DT-A)" are used interchangeably.

[0075] As used herein, the term "reporter gene" refers to a gene whose expression product is easily detected or observed, used to indicate whether a foreign gene has been successfully expressed or located. In this invention, a specific example is a gene encoding green fluorescent protein (GFP).

[0076] As used herein, the term "cationic polymer" refers to a positively charged polymeric material that can bind to negatively charged biomolecules (such as viral capsids and cell membranes) through electrostatic interactions. In this invention, a specific example is polyamide-amine (PAMAM), particularly its fourth-generation derivative (PAMAM-G4), but the term also encompasses other dendritic or hyperbranched cationic polymers with similar functions (such as polyethyleneimine PEI).

[0077] As used herein, the terms “delivery carrier material”, “cationic polymer”, and “PAMAM-G4” are used interchangeably.

[0078] As used herein, the term "treated red blood cells" refers to red blood cells separated from an organism (self) that have undergone physical or chemical treatment (such as incubation with cationic polymers) to alter their morphology, surface charge, or function, thereby acquiring new properties (such as being specifically captured by the liver).

[0079] As used in this article, the terms "cold" tumor and "hot" tumor refer to the common classification of the tumor immune microenvironment in this field. Among them, "cold tumor" refers to tumors that lack tumor-infiltrating lymphocytes and have strong immunosuppression; "hot tumor" refers to tumors that are rich in immune cells and have strong immune activity.

[0080] As used herein, the term "pharmaceuticalally acceptable carrier" refers to an excipient, diluent, or excipient used in pharmaceutical preparations that is non-toxic, non-irritating to the body, and does not have harmful interactions with the active ingredient.

[0081] As used herein, the term “therapeutic effective dose” refers to a dose of an active ingredient (such as a recombinant oncolytic virus) that is sufficient to improve or treat a target disease (such as a tumor) without causing unacceptable side effects.

[0082] The oncolytic virus of the present invention

[0083] Currently, the six approved oncolytic virus products and the oncolytic viruses under development all use the CMV promoter derived from cytomegalovirus. The CMV promoter has high expression efficiency but lacks tumor cell specificity, and can efficiently express exogenous genes in both tumor and non-tumor cells.

[0084] To enhance the ability of oncolytic viruses to be specifically expressed in tumor cells, this invention integrates the tumor cell-specific promoter Survivin into the genome of herpes simplex virus type I (HSV-1). Survivin belongs to the inhibitor of apoptosis protein (IAP) family, is highly expressed in tumor cells, and is rarely expressed in terminally differentiated cells.

[0085] To enhance the cytotoxic effect of oncolytic viruses on tumor cells, this invention inserts the catalytic subunit A (DT-A) of the diphtheria toxin (DT) gene into the HSV-1 genome. Diphtheria toxin is a bacterial toxin produced by Corynebacterium diphtheriae, which causes cell death by inhibiting protein synthesis. The fusion protein of DT and IL-2 (trade name Ontak) has been approved for the treatment of T-cell lymphoma, but its extracellular use has certain side effects. The diphtheria toxin in this study is expressed only in infected cells and is not secreted extracellularly, thus greatly reducing side effects.

[0086] In this study, we constructed an HSV-1 oncolytic virus (G001) with highly cytotoxic DT-A expressed under a tumor cell-specific Survivin promoter. Unlike all immune-enhancing viruses, G001 can specifically and efficiently kill tumor cells directly; more importantly, this ability is independent of the immune environment, thus exhibiting the same killing effect on both "cold" and "hot" tumors.

[0087] Infected cell protein 0 (ICP0)

[0088] ICP0 of herpes simplex virus type 1 is a transcriptional regulator whose main functions are transactivation and suppression of host defense. Transactivation means that ICP0 can strongly activate gene transcription in both the virus and host cells. Suppression of host defense means that ICP0 can interfere with the host cell's innate immune response and promote protein degradation, thereby creating a more favorable environment for viral replication and gene expression. Detection of ICP0 indicates successful viral infection.

[0089] Infecting cell protein 6 (ICP6)

[0090] ICP6, the large subunit of the virus's own ribonucleotide reductase (RNR), is crucial for efficient viral replication in normal cells. As an immediate-early gene, it plays a role in the early stages of viral infection. Its function is to catalyze the deoxyribonucleotide deoxygenation of ribonucleotides (such as ADP, GDP, CDP, and UDP) to generate the corresponding deoxyribonucleotides (such as dADP, dGDP, dCDP, and dUDP). These deoxyribonucleotides are the basic raw materials (substrates) for DNA synthesis. Viruses rapidly replicate their genome within the host cell nucleus, requiring a large number of dNTPs. Although host cells have their own RNRs, their production rate may not be sufficient to meet the demands of explosive viral replication. Therefore, the presence of ICP6 allows it to play a major role in efficient viral replication. Scientists can use genetic engineering techniques to delete or functionally disrupt the ICP6 gene (for example, the oncolytic virus T-VEC is modified based on this principle). In normal cells, viruses lacking ICP6 cannot replicate effectively due to a lack of sufficient dNTPs. However, in cancer cells, abnormally active metabolic and signaling pathways (such as the Ras pathway) result in high levels of intracellular dNTPs, which are sufficient to "compensate" for the lack of viral RNR, allowing the virus to replicate extensively within cancer cells.

[0091] Diphtheria toxin A fragment (DT-A)

[0092] DT-A, derived from Corynebacterium diphtheriae, is a highly potent cytotoxin that irreversibly inhibits protein synthesis, leading to cell death. DT-A catalyzes the ADP-ribosylation of elongation factor-2 (EF-2), inactivating it. Since EF-2 is essential for protein synthesis, its inhibition causes rapid cell death. Distinguishing it from the B fragment: The complete diphtheria toxin requires the B fragment to bind to cell surface receptors and assist the A fragment in entering the cell. However, in experiments, only the A fragment (DT-A) is typically used because it cannot enter the cell independently. It exerts its toxic effect only inside cells that have successfully expressed DT-A. DT-A is often used as a "suicide gene" or "ablation gene." Expressing DT-A in a viral vector aims to specifically kill virus-infected cells. This is extremely useful in studying the function of specific cell types, constructing disease models, or eliminating harmful cells in gene therapy.

[0093] Polyamidoamine-treated erythrocytes as oncolytic virus liver delivery vectors

[0094] Polyamidoamine (PAMAM), a class of macromolecules with a three-dimensional dendritic structure, can be functionalized through simple chemical coupling (such as grafting anti-inflammatory and antioxidant active molecules), and its morphology can be induced to change through interfacial interactions with erythrocytes. Furthermore, the safety of the material can be further improved through structural optimization (such as selecting the low-toxicity fourth-generation PAMAM-G4). Currently, cationic polymers are mainly used as drug delivery carriers. This invention combines cationic polymers, erythrocytes, and oncolytic viruses to establish a deformed erythrocyte-coupled oncolytic virus liver-targeted delivery system for the treatment of liver cancer, potentially providing a safe and efficient new tumor treatment method for clinical use.

[0095] The molecular weight of PAMAM-G4 of this invention is 14214.17, and its linear molecular formula is C0. 622 H 1248 N 250 O 124。

[0096] The method for preparing oncolytic virus of the present invention

[0097] This invention provides a method and application for treating tumors using HSV-1 oncolytic virus with diphtheria toxin expression driven by the tumor-specific promoter Survivin. It aims to improve the specificity and efficiency of tumor cell killing with novel HSV-1 oncolytic virus to solve the current problem of insufficient specificity and killing power of oncolytic viruses.

[0098] To achieve the above objectives, the present invention employs the following specific technical solutions:

[0099] like Figure 1 As shown, firstly, the diphtheria toxin A subunit (DT-A) controlled by the Survivin promoter was cloned into the pCDNA3.1 vector, followed by a GFP clone controlled by the CMV promoter downstream of it. Homologous sequences of the HSV-1 ICP6 gene (ATCC number VR-1493 for the wild-type HSV-1 KOS strain) were added to the front and back ends of both expression constructs, respectively. The complete expression cassette was then inserted into the HSV-1 ICP6 gene using CRISPR-Cas9 technology.

[0100] By screening and purifying viruses carrying diphtheria toxin and GFP using GFP fluorescent spots, a novel oncolytic virus, G001, was obtained, whose diphtheria toxin expression is controlled by the Survivin promoter.

[0101] To obtain a control virus with the same ICP6 inactivation, this invention also uses CRISPR-Cas9 technology to insert a GFP gene containing only the CMV promoter into the same ICP6 site. Viruses carrying only GFP are screened and purified using GFP fluorescent spots, ultimately yielding the control virus G001c, which expresses GFP under the control of the CMV promoter and is ICP6 inactivated.

[0102] Compared with the prior art, the main advantages of the present invention include:

[0103] (1) The oncolytic virus prepared by the present invention can enhance its ability to specifically express exogenous genes in tumor cells.

[0104] (2) The present invention provides a novel HSV-1 oncolytic virus (G001) that uses a strategy of driving the expression of highly efficient killing factors through a tumor-specific promoter, so that the virus can accurately identify cancer cells and effectively kill tumor cells in both "cold" and "hot" tumor immune microenvironments.

[0105] (3) The novel HSV-1 oncolytic virus (G001) provided by the present invention not only improves the specific killing ability of tumor cells, but also reduces the non-specific killing of normal cells, thereby achieving higher anti-tumor efficiency and better safety.

[0106] (4) The present invention is based on a direct killing strategy with the introduction and specific expression of a potent exogenous toxin (DT-A) as its core. Detailed Implementation

[0107] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. Unless otherwise specified, all experimental materials and reagents involved in this invention are commercially available.

[0108] Experimental methods

[0109] 1. Virus modification

[0110] Take 4 x 10 4293T cells were seeded in 6-well plates. 24 hours later, donor plasmid (pCDNA3.1 carrying left and right homologous arms and the exogenous inserted gene) and LentiCRISPR v2 at a ratio of 1:1.2 (4 μg total) were transfected into the 293T cells, along with 10 μm of SCR7 inhibitor. Six hours after transfection, the medium was replaced with RPMI 1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (PS). 48 hours later, HSV-1 at an MOI of 0.1 was used for further processing. KOS The cells were infected, and two hours later the medium was replaced with RPMI 1640 medium containing 5% FBS and 1% PS. The cells were observed under a microscope, and when cytopathic effects reached 90%, the supernatant and cells were collected. After three freeze-thaw cycles, the cells were centrifuged at 4˚C and 4000 rpm for 10 minutes, and the supernatant was collected.

[0111] 2. Plaque purification of virus

[0112] A549 cells were seeded into 6-well plates. The viral stock solution was serially diluted 10-fold with empty medium containing RPMI 1640 (e.g., 1 x 10⁻⁶). -1 Up to 1 x 10 -6 Each dilution must be thoroughly mixed. Wash 100% confluence A549 cells once with PBS; add 1 mL of the above-mentioned different dilutions of virus solution to each well, discard the virus solution after 2 hours, and wash once with 500 µl PBS. Mix preheated 2% low-melting-point agarose solution and RPMI 1640 medium containing 4% FBS and 1% PS in a 1:1 ratio. After the mixed solution cools down, add it to a six-well plate (3 mL per well); invert the six-well plate and incubate at 37˚C. Observe the generation of fluorescent spots under a fluorescence microscope periodically. Use a yellow pipette tip to pick up the fluorescent areas and place them in an EP tube containing RPMI 1640 medium. Repeatedly pipet the agar until no precipitate is visible to the naked eye, then perform serial dilutions and repeat the plaque purification process. Repeat the above process 3-5 times. Virus purification is considered complete when no wild-type band is found in the PCR detection of the viral DNA insertion site.

[0113] 3. Viral amplification

[0114] A549 cells were passaged proportionally into T175 culture flasks. Once the cell density reached approximately 90%–95% confluence, the medium was replaced with RPMI 1640 medium containing 10% FBS and 1% penicillin antibiotics, and cultured at 37°C in a 5% CO2 incubator. On the day of virus amplification, cells were trypsinized and counted, and then inoculated with recombinant HSV-1 strain G001 at a multiplicity of infection (MOI) of 0.01. Cells were washed once with PBS before infection, and after adding the virus inoculum, incubated at 37°C in a 5% CO2 incubator for 2 h, gently shaking the culture flask every 30 min to promote virus adsorption. After adsorption, RPMI 1640 medium containing 5% FBS and 1% PS was added, and the cells were cultured for another 2–3 days. Cell culture supernatant was collected 2–3 days post-infection. After centrifugation to remove cells and debris, the supernatant was filtered through a 0.45 µm filter membrane to obtain free HSV-1 virus particles for subsequent experiments.

[0115] 4. Titer determination

[0116] A549 cells were seeded into 6-well plates and incubated at 37˚C until 100% confluence before infection. The viral stock solution was serially diluted 10-fold with RPMI 1640 medium (e.g., 1 x 10⁻⁶). -1 Up to 1 x 10 -6 Each dilution must be thoroughly mixed. Discard the culture medium in the 6-well plate and wash the cells with PBS; add 1 mL of the diluted virus solution to each well and incubate at 37˚C for 2 hours. After 2 hours, discard the virus solution, wash once with 500 µl PBS, and mix preheated 2% low-melting-point agarose solution and RPMI 1640 medium containing 4% FBS and 1% PS at a 1:1 ratio. After the mixed solution has cooled, add it to the 6-well plate (3 mL per well); invert the 6-well plate and incubate at 37˚C. After 5 days of incubation, add 3 mL of 4% paraformaldehyde fixative to each well for immobilization and incubate overnight at room temperature; discard the methanol fixative, add 3 mL of crystal violet solution, incubate overnight, and then wash the 6-well plate with water to calculate the number of viral plaques. The virus titer is calculated as PFU / mL = (number of countable plaques × dilution factor) / inoculum volume (mL).

[0117] 5. Preparation of fluorescein Cy5-labeled HSV virus particles

[0118] 5.1. Reagent preparation:

[0119] Synthesis buffer (pH 9.5 carbonate buffer): Prepare 0.5M sodium carbonate solution and sodium bicarbonate solution separately, mix Na2CO3: NaHCO3 = 3:7, and adjust the pH.

[0120] Dialysis buffer (pH 9.2 carbonate buffer): Prepare 0.5M sodium carbonate solution and sodium bicarbonate solution separately, mix Na2CO3: NaHCO3 = 1:9, and adjust the pH.

[0121] 5.2. Dissolve the virus particles in a mixture of 0.9% NaCl and synthesis buffer (v:v=9:1) and stir in an ice bath for 5-10 min.

[0122] 5.3. Administer 0.01 mg fluorescein / 10 7 Weigh the fluorescein into a 1.5 mL centrifuge tube, add the synthesis buffer to dissolve it, and then dropwise add the virus particle solution while it is being stirred. Continue stirring in the cold storage for 12-18 hours in the dark.

[0123] 5.4. Centrifuge the reaction mixture at 3000 rpm for 20 min to remove a small amount of precipitate, then place it in a 3 kDa pre-activated dialysis bag and dialyze overnight in dialysis buffer (cold storage). Then place it in PBS for continued dialysis (cold storage). Change the PBS every 2-3 hours and dialyze 3 times.

[0124] 5.5. The product collected from the dialysis bag is the fluorescein Cy5-labeled HSV virus particles. After material preparation, label the particles and store them at -80°C for later use.

[0125] Example 1: Identifying TERT and Survivin as specifically expressed in colorectal and liver cancer tumor cells

[0126] After collecting tumor tissue and adjacent normal tissue samples from patients with liver cancer and colorectal cancer, RNA was extracted from fresh cancer and adjacent normal tissues from the same patients and reverse transcribed into cDNA. The expression levels of Survivin, TERT, and CEA in liver cancer and adjacent normal tissues were detected using quantitative PCR.

[0127] The results showed that the transcriptional level of the Survivin gene in liver cancer and colorectal cancer tumor tissues was on average 29 (9-111) times higher (p<0.0001) and 9 (2-27) times higher (p<0.01) in the corresponding adjacent tissues, respectively; the transcriptional level of the TERT gene in liver cancer was 56 (10-290) times higher (p<0.0001) than that in adjacent tissues, but weak transcriptional activity was only observed in a few colorectal cancer tissues and their adjacent tissues; the transcriptional level of CEA in colorectal cancer tissues was 7 (1-22) times higher (p<0.01) than that in adjacent tissues, but it was not detected in liver cancer tumor tissues and their adjacent tissues. Figure 2Importantly, all three cancer cell-associated genes (Survivin, TERT, and CEA) showed virtually no transcriptional activity in normal cells. These results indicate that the promoters of the Survivin and TERT genes exhibit very high transcriptional activity in liver tumor tissues, significantly higher than in adjacent normal tissues. The CEA gene promoter was only highly expressed in colorectal cancer tissues, and its expression was not significantly different from that in adjacent normal tissues; it lacked the high tumor cell specificity of the promoters of the Survivin and TERT genes.

[0128] Example 2: Preparation of oncolytic virus G001

[0129] This embodiment describes the preparation of an HSV-1 oncolytic virus that utilizes the tumor-specific promoter Survivin to drive diphtheria toxin expression. The specific preparation process is as follows:

[0130] like Figure 1 As shown, firstly, the diphtheria toxin A subunit (DT-A) controlled by the Survivin promoter (see...) Figure 1 The "Tumor-specific promoter-Toxin" was cloned into the pCDNA3.1 vector, and then GFP (see [link to CMV promoter]) under the control of the CMV promoter was added. Figure 1 The "CMV promoter-GFP" clone was placed downstream of it. Homologous sequences of the HSV-1 ICP6 gene were added to the front and back ends of the two expression constructs, respectively (as shown in the image). Figure 1 (As shown in "ICP6L" and "ICP6R"). The left homologous arm (851bp) (as shown in the image). Figure 1 The sequence of “ICP6L” is shown in SEQ ID NO: 3 below:

[0131] gggccagatatacgcgcgcccttgactccgattcgtcatcggatgactccctgcagatagatggccccgtgtgtcgcccgtggagcaatgacaccgcgcccctggatgtttgccccgggacccccggcccgggcgccgacgccggtggtccctcagcggtagacccacacgcaccgacgccaggggccggcgctggtcttgcggccgatcccgccgtggcccgggacgacgcggaggggctttcggacccccggccacgtctgggaacgggcacggcctaccccgtccccctggaactcacgcccgagaacgcggaggccgtggcgcgctttctgggagatgccgtgaaccgcgaacccgcgctcatgctggagtacttttgccggtgcgcccgcgaggaaaccaagcgtgtcccccccaggacattctgcagcccccctcgcctcacggaggacgactttgggcttctcaactacgcgctcgtggagatgcagcgcctgtgtctggacgttcctccggtcctgccgaacgcatacatgccctattatctcagggagtatgtgacgcggctggtcaacgggttcaagccgctggtgagccggtccgctcgcctttaccgcatcctgggggttctggtgcacctgcggatccggacccgggaggcctcctttgaggagtggctgcgatccaaggaagtggccctggactttggcctgacggaaaggcttcgcgagcacgaagcccagctggtgatcctggcccaggctctggaccattacgactgtctgatccacagcacaccgcacacgctggtcgagcgggggctgcaatcggccctgaagtatgaggag(SEQ ID NO:3);

[0132] Right homology arm (1232 bp) (as shown in Figure 1 the "ICP6R" sequence in is set forth in SEQ ID NO: 4 as follows:

[0133]

[0134] The complete expression cassette described above was inserted into the ICP6 gene of HSV-1 using CRISPR-Cas9 technology.

[0135] ICP6-gRNA sequence: CACCGCGCTTTGGCGGGCACTACA (SEQ ID NO: 5).

[0136] By screening and purifying viruses carrying diphtheria toxin (DT-A) and GFP using GFP fluorescent spots, a novel oncolytic virus, G001, was obtained, whose diphtheria toxin expression is controlled by the Survivin promoter.

[0137] To obtain a control virus with the same ICP6 inactivation, this invention also uses CRISPR-Cas9 technology to insert a GFP gene containing only the CMV promoter into the same ICP6 site. Viruses carrying only GFP are screened and purified using GFP fluorescent spots, ultimately yielding the control virus G001c, which expresses GFP under the control of the CMV promoter and is ICP6 inactivated.

[0138] Example 3: Oncolytic virus G001 replicates and expresses toxin gene in cancer cells.

[0139] In this embodiment, G001 virus infection concentrations of 0.1 and 1 MOI were initially selected for experiments. However, at an infection concentration of 1 MOI, a large number of cells died at 24, 48, and 72 hours, and therefore the cells were not used for Western blotting. Therefore, a G001 virus infection concentration of 0.1 MOI was used for subsequent experiments.

[0140] Take 2x10 5 A549 cells were seeded into each well of a 6-well plate and infected with oncolytic virus G001 (0.1 MOI) 24 hours later. Cells were harvested at 24, 48, and 72 hours post-G001 infection, and the expression of ICP0, GFP, and DT-A was detected by proteoblotting. ICP0 is an important regulatory protein of HSV-1 virus, and its increase indicates an increased HSV-1 viral load; GFP, as a selection protein for exogenous insertion, shows increased exogenous protein expression; DT-A, the A subunit of diphtheria toxin, can kill cells, and its increase indicates that G001 successfully expressed the toxin, thereby killing tumor cells.

[0141] The results showed that the levels of ICP0, GFP, and DT-A proteins all increased with infection time, indicating that the newly constructed G001 could successfully infect and express the virus's own proteins (ICP0) and exogenous proteins (GFP and DT-A). Figure 3 ).

[0142] Example 4: G001 has a stronger tumor cell killing ability.

[0143] 30,000 colorectal cancer cells (HCT-8) or liver cancer cells (HCCLM3) were seeded per well into 96-well plates. PBS, G001c, and G001 were added 24 hours later. The MOI (Minimum Inoculation) was 0.0001, 0.001, 0.01, 0.1, 1, and 10. Cell viability was assessed using the CCK8 assay 48 hours after infection.

[0144] The results showed that in both colorectal cancer cells (HCT-8) and liver cancer cells (HCCLM3), the cell-killing ability of G001 was significantly higher than that of the control virus G001c. The cell-killing ability of G001 (IC50) was... 50 In HCCLM3 and HCT-8 cells, the levels of G001c were 9.2 times (p<0.0001) and 8.7 times (p<0.0001), respectively. Figure 4 ).

[0145] Example 5: G001 kills tumor cells through apoptosis

[0146] Colorectal cancer cells (HCT-8, HCT116, Widr, and SW480), liver cancer cells (MHCC97H, HepG2, and Huh7), and lung cancer cells (A549) were seeded at 1 x 10⁻⁶ cells / year. 6 Transfer to 6-well plates. 24 hours later, add PBS, G001c, and G001. The viral load (MOI) was 0.1. 48 hours after infection, the expression level of apoptosis-related protein (Cleaved PARP) was detected by Western blotting.

[0147] The results showed that, compared with the control virus G001c, G001 infection significantly increased the content of Cleaved PARP protein ( Figure 5 This indicates that cancer cell death is primarily mediated by apoptosis.

[0148] Example 6: G001 can significantly reduce the volume of tumors in mice.

[0149] like Figure 6 As shown in Figure A, in a mouse subcutaneous tumorigenesis model, HCT116 colorectal cancer cells were inoculated into the backs of nude mice, and the tumor volume was increased to approximately 50 mm. 3 On day 7, the mice were divided into three groups and injected intratumorally with PBS, G001c, and G001 (virus inoculation dose of 10). 7 PFU / time). The virus was injected intratumorally four times on days 10, 13, 16 and 19, and tumor growth was continuously monitored.

[0150] The results showed that in the uninoculated oncolytic virus group (PBS), tumors continued to grow over time; in the control virus group (G001c), tumor growth was significantly controlled, with only minimal growth throughout the observation period; in the oncolytic virus group (G001), the tumor volume continuously decreased over time. Figure 6 (BD). These results demonstrate that G001 possesses highly efficient tumor-killing capabilities.

[0151] Example 7: Virus particles can be effectively adsorbed onto the surface of erythrocyte membranes treated with PAMAM-G4.

[0152] To enable more effective and convenient treatment of liver tumors via intravenous administration, we have developed a special autologous red blood cell liver-targeted delivery system. Figure 7 Autologous erythrocytes were treated with the polycationic nanomaterial PAMAM-G4 to form deformed erythrocytes (the working concentration of PAMAM-G4 for erythrocyte treatment was 150 µg / mL, the incubation buffer was physiological saline, and the pH was 7.4). Utilizing the liver's mechanism of clearing damaged erythrocytes, these cells specifically targeted and accumulated in the liver. Furthermore, taking advantage of the negatively charged surface membrane protein of oncolytic viruses, these viruses were adsorbed onto the polycationic nanomaterial PAMAM-G4, thereby forming liver-targeting autologous erythrocytes carrying oncolytic viruses.

[0153] Red blood cells isolated from mouse autologous cells were treated with the polycationic material PAMAM-G4 for 24 hours, then co-incubated with oncolytic virus labeled with Cy5 fluorescein for 2 hours, and finally the free Cy5-labeled oncolytic virus was removed. Under a confocal microscope, it could be observed that the red fluorescently labeled virus particles were mainly attached to the surface of the red blood cell membrane. Figure 8 Flow cytometry analysis showed that fluorescence was detectable in 97% of erythrocytes. Figure 9 This demonstrates that oncolytic virus particles can be effectively loaded onto the surface of PAMAM-G4-treated erythrocytes.

[0154] Example 8: Red blood cells loaded with oncolytic virus can accumulate in the liver after intravenous injection.

[0155] After treating red blood cells with PAMAM-G4 in vitro and conjugating them with G001 virus particles carrying fluorescein, the cells were reinfused via tail vein injection into mice. Four hours after injection, various organs of the mice were collected for fluorescence imaging analysis.

[0156] The experimental procedure is as follows:

[0157] Blood was collected from the mouse orbital cavity and placed in blood collection tubes containing EDTA, with a blood volume of approximately 200 μL. The cells were centrifuged at 4000 rpm for 15 minutes. After centrifugation, the serum was removed, and the red blood cells were resuspended in PBS and centrifuged again. After centrifugation, the supernatant was removed, and the cells were collected at a rate of 10 μL per 100 μL. 7 Add 1 mL of 150 μg / mL PAMAM-G4 to the material diluted with physiological saline. After incubation at 37°C for 5 hours, observe red blood cell deformity under a microscope, then centrifuge at 4000 rpm for 15 minutes to remove uncoupled material. 7 Red blood cell coupling 1 x 10 9 Viral particles were diluted with physiological saline beforehand and added to deformed red blood cells, then incubated at 37°C for 2 hours. After incubation, unconjugated viral particles were removed by centrifugation at 4000 rpm for 15 minutes. The red blood cell-virus particle complex was resuspended in an appropriate amount of physiological saline.

[0158] The results showed that over 85% of the labeled virus was enriched in the liver, with only a small fraction detectable in the pancreas, kidneys, and intestines. Figure 10 This demonstrates that G001 can be efficiently and specifically delivered to the liver via intravenous injection using a processed red blood cell carrier.

[0159] Example 9: Liver-targeted G001 significantly prolongs survival time in mice with orthotopic hepatocellular carcinoma.

[0160] First, an orthotopic hepatocellular carcinoma mouse model was established by inoculating mouse hepatocellular carcinoma cells (H22) into the livers of C57BL / 6 mice. Fourteen days after the injection of hepatocellular carcinoma cells, autologous red blood cells carrying G001 oncolytic virus were injected into the mice via the tail vein.

[0161] The specific experimental procedure is as follows:

[0162] Blood was collected from the mouse orbital cavity and placed in blood collection tubes containing EDTA, with a blood volume of approximately 200 μL. The cells were centrifuged at 4000 rpm for 15 minutes. After centrifugation, the serum was removed, and the red blood cells were resuspended in PBS and centrifuged again. After centrifugation, the supernatant was removed, and the cells were collected at a rate of 10 μL per 100 μL. 7 Add 1 mL of 150 μg / mL PAMAM-G4 to the material diluted with physiological saline. After incubation at 37°C for 5 hours, observe red blood cell deformity under a microscope, then centrifuge at 4000 rpm for 15 minutes to remove uncoupled material. Take 10 mL of the pre-diluted physiological saline solution... 9 Virus particles, added to 10 7 The deformed red blood cells were incubated at 37°C for 2 hours. After incubation, the cells were centrifuged at 4000 rpm for 15 minutes to remove uncoupled viral particles. The red blood cell-virus particle complex was resuspended in an appropriate amount of physiological saline.

[0163] The results showed that mice injected with G001 carried by red blood cells had nearly twice the survival time of mice injected with G001 alone, while the survival time of mice injected with PBS or G001 was basically the same. Figure 11 This demonstrates that red blood cells carrying G001 can kill liver cancer cells more specifically and effectively, and significantly prolong the survival time of mice with orthotopic liver cancer.

[0164] Example 10: Intravenous injection of liver-targeted G001 mainly enriched in liver tumor tissue.

[0165] Following intravenous injection of G001-carrying red blood cells, tumor tissue, adjacent normal tissue, and other organ tissues were collected from mice immediately upon death. DNA was extracted from different organ tissues, and the presence of the G001 oncolytic virus genome in different tissues was analyzed using qPCR.

[0166] The results showed that the viral load was similar and at a very low level in other organs and the non-tumor parts of the liver, while the viral load in the tumor tissue of the liver was more than ten million times higher than that in other organs and the non-tumor parts of the liver. Figure 12 This indicates that after intravenous injection of G001-carrying red blood cells, the oncolytic virus not only primarily accumulates in the liver but also replicates mainly within the liver tumor tissue. This demonstrates that the method of treating autologous red blood cells with PAMAM-G4 to carry G001 for intravenous injection possesses dual organ and tumor cell specificity, enabling more specific and efficient killing of tumor cells. Furthermore, since the oncolytic virus G001 is present in only trace amounts in other organs and non-tumor parts of the liver, side effects can be significantly reduced.

[0167] The sequence information involved in this invention is as follows:

[0168] SEQ ID NO: 1 (DT-A)

[0169] ATGGACTACAAGGACGACGATGATAAGGGCGCCGATGACGTGGTGGATTCTAGTAAGAGCTTTGTGATGGAAAATTTTAGCAGCTATCACGGCACCAAGCCTGGCTACGTGGACAGCATCCAGAAGGGCATCCAGAAGCCTAAGAGCGGCACCCAGGGCAACTACGACGACGACTGGAAGGGCTTCTACAGCACCGACAACAAGTACGACGCCGCCGGCTACAGCGTGGACAATGAGAACCCCCTGAGCGGCAAGGCCGGCGGCGTGGTGAAGGTGACTTACCCCGGCCTGACCAAGGTGCTGGCCCTGAAGGTGGATAACGCCGAGACCATTAAGAAGGAGCTGGGCCTGTCCCTGACCGAGCCCCTGATGGAGCAGGTGGGCACCGAGGAGTTCATCAAGAGATTCGGCGACGGCGCCAGCAGGGTGGTGCTGAGCCTGCCCTTCGCCGAGGGCAGCAGCAGCGTGGAGTACATCAACAACTGGGAGCAGGCCAAGGCCCTGAGCGTGGAGCTGGAGATCAACTTCGAGACCAGGGGCAAGAGAGGCCAGGACGCCATGTACGAGTACATGGCCCAGGCCTGTGCCGGCAACAGGGTGAGAAGATGA

[0170] SEQ ID NO:2 (PEA)

[0171]

[0172] SEQ ID NO:3 (ICP6L)

[0173] gggccagatatacgcgcgcccttgactccgattcgtcatcggatgactccctgcagatagatggccccgtgtgtcgcccgtggagcaatgacaccgcgcccctggatgtttgccccgggacccccggcccgggcgccgacgccggtggtccctcagcggtagacccacacgcaccgacgccaggggccggcgctggtcttgcggccgatcccgccgtggcccgggacgacgcggaggggctttcggacccccggccacgtctgggaacgggcacggcctaccccgtccccctggaactcacgcccgagaacgcggaggccgtggcgcgctttctgggagatgccgtgaaccgcgaacccgcgctcatgctggagtacttttgccggtgcgcccgcgaggaaaccaagcgtgtcccccccaggacattctgcagcccccctcgcctcacggaggacgactttgggcttctcaactacgcgctcgtggagatgcagcgcctgtgtctggacgttcctccggtcctgccgaacgcatacatgccctattatctcagggagtatgtgacgcggctggtcaacgggttcaagccgctggtgagccggtccgctcgcctttaccgcatcctgggggttctggtgcacctgcggatccggacccgggaggcctcctttgaggagtggctgcgatccaaggaagtggccctggactttggcctgacggaaaggcttcgcgagcacgaagcccagctggtgatcctggcccaggctctggaccattacgactgtctgatccacagcacaccgcacacgctggtcgagcgggggctgcaatcggccctgaagtatgaggag

[0174] SEQ ID NO:4 (ICP6R)

[0175]

[0176] SEQ ID NO: 5 (ICP6-gRNA)

[0177] CACCGCGCTTTGGCGGGCACTACA

[0178] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A recombinant oncolytic virus, characterized in that, The recombinant oncolytic virus was obtained by genetically engineering wild-type herpes simplex virus type I (HSV-1); wherein the genome of wild-type HSV-1 contains the genes ICP34.5, TK, ICP6, ICP34.5 and UL47 arranged in sequence; the modification includes: inserting an exogenous expression frame into the coding region of the ICP6 gene, the exogenous expression frame containing a tumor-specific promoter and a cytotoxic protein coding sequence driven by it; The tumor-specific promoter is the Survivin promoter, and the cytotoxic protein is the diphtheria toxin A subunit DT-A. The wild-type HSV-1 has the ATCC number VR-1493; The exogenous expression cassette includes the diphtheria toxin A subunit DT-A, as shown in SEQ ID NO:

1.

2. The recombinant oncolytic virus according to claim 1, characterized in that, The exogenous expression cassette is inserted into the ICP6 gene via homologous recombination or CRISPR-Cas9-mediated gene editing.

3. The recombinant oncolytic virus according to claim 1, characterized in that, The structure of the exogenous expression cassette, from the 5' end to the 3' end, is as follows: tumor-specific promoter - cytotoxic protein coding sequence - first polyadenylated nucleotide signal sequence - constitutive promoter - reporter gene coding sequence - second polyadenylated nucleotide signal sequence.

4. A pharmaceutical composition, characterized in that, It contains the recombinant oncolytic virus according to claim 1 as an active ingredient.

5. A targeted delivery system for delivering the recombinant oncolytic virus according to claim 1, characterized in that, The system comprises: red blood cells treated with a cationic polymer, and a recombinant oncolytic virus as described in claim 1 adsorbed onto the surface of the red blood cells.

6. The targeted delivery system according to claim 5, characterized in that, The cationic polymer is selected from the group consisting of polyamide-amine dendritic polymers.

7. Use of the recombinant oncolytic virus according to claim 1, the pharmaceutical composition according to claim 4, or the targeted delivery system according to claim 5 in the preparation of a medicament for treating liver cancer or colorectal cancer.

Images