Application of OsLOX14 gene in regulation and control of cold tolerance in seedling stage

Abstract

The invention discloses application of an OsLOX14 gene to regulation and control of cold tolerance in a seedling stage. The invention provides a protein OsLOX14, or a substance for down-regulating, weakening or reducing the expression of a coding nucleic acid of the protein OsLOX14, or a substance for down-regulating, weakening or reducing the activity or content of the protein OsLOX14 in any one of the following applications: B1) regulating and controlling the cold resistance of plants; the experiment proves that compared with wild Nipponbare, the knockout strain obtained by knocking out the OsLOX14 gene shows a low cold-resistant character, so that it is proved that the OsLOX14 protein and the coding gene thereof regulate the cold-resistant character of the plant.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and relates to... OsLOX14 Application of gene regulation in seedling cold resistance. Background Technology

[0002] Low-temperature stress is a widespread environmental stress that severely impacts the growth, production, and geographical distribution of economic crops. Rice, originating in tropical and subtropical regions, is highly sensitive to low temperatures throughout its growth cycle. Chill damage during the seedling stage can lead to chlorosis, stunting, reduced tillering, wilting, and even death. Low temperatures during the booting stage result in poor differentiation of rice branches and spikelets, reduced grains per panicle, and a significant decrease in seed setting rate, ultimately leading to large-scale yield reductions. With the continued deterioration of the global climate and the frequent occurrence of extreme weather events such as low temperatures, the growth, development, and yield of rice are greatly affected. Therefore, discovering new cold-resistant genes is of great significance for breeding and improving new cold-resistant rice varieties.

[0003] Lipoxygenases (LOX) are a class of dioxygenases containing non-heme iron. They catalyze the dioxygenation reaction of polyunsaturated fatty acids containing cis-1,4-pentadiene structures, generating corresponding hydroperoxides containing conjugated double bonds. No other enzymes have been found to be present. OsLOX14 Reports on gene regulation of cold resistance in rice. Summary of the Invention

[0004] The technical problem solved by this invention is to discover new cold-resistant genes for breeding and improving new cold-resistant rice varieties. To solve the above-mentioned technical problem, the first aspect of this invention provides the protein OsLOX14, or a substance that downregulates, weakens, or reduces the expression of the nucleic acid encoding said protein OsLOX14, or a substance that downregulates, weakens, or reduces the activity or content of said protein OsLOX14, in any of the following ways: B1) Regulate plant cold resistance; B2) Plant breeding; The protein OsLOX14 is either A1), A2), A3), or A4): A1) Proteins that include the amino acid residues shown in Sequence 1; A2) A plant-derived protein with the same biological function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein shown in A1). Proteins that share 80% or more of the same amino acid sequence as those defined in A3 and A1, are derived from plants, and have the same biological function; A4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins shown in A1)-A3).

[0005] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0006] In the above-mentioned proteins, the tag is a protein tag, which refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, Myc tag, GST tag, and / or SUMO tag, etc.

[0007] The protein shown in A1 above may be composed of amino acid residues as shown in sequence 1.

[0008] The protein shown in A2) above, wherein the substitution and / or deletion and / or addition of one or more amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0009] The coding gene of the protein shown in A2) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in Sequence 2 or Sequence 3, and / or by performing a missense mutation of one or more base pairs, and / or by attaching a tag coding sequence to its 5′ end and / or 3′ end.

[0010] For the protein shown in A3) above, identity refers to the identity of the amino acid sequence. The identity of amino acid sequences can be determined using identity search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0011] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0012] The nucleic acid encoding the protein OsLOX14 is any one of the following: a1) The coding region (CDS) includes the DNA molecule shown in sequence 2 or sequence 3; a2) The nucleotide sequence includes the DNA molecule shown in sequence 2 or sequence 3; a3) having 75% or more identity with the nucleotide sequence defined by a1) or a2), and being a DNA molecule derived from a plant that encodes the protein OsLOX14 described in the first aspect; a4) hybridization under strict conditions with the nucleotide sequence defined by a1) or a2) of a DNA molecule derived from a plant and encoding the protein OsLOX14 described in the first aspect.

[0013] In the nucleic acid molecules mentioned above, a1) can be a DNA molecule with the coding region shown in sequence 2 or sequence 3.

[0014] In the nucleic acid molecules mentioned above, a2) can be a DNA molecule with the nucleotide sequence shown in Sequence 2 or Sequence 3.

[0015] Specifically, sequence 3 in a1) above is genomic DNA; sequence 2 in a1) above is cDNA.

[0016] In the above text, the breeding indicator is cold resistance. The plant breeding is for cultivating cold-resistant plants.

[0017] In the above text, the regulation of plant cold resistance refers to reducing plant cold resistance.

[0018] In the above text, the downregulation, weakening, or reduction of the expression of the coding nucleic acid of the protein OsLOX14, or the downregulation, weakening, or reduction of the activity or content of the protein OsLOX14, can be achieved by gene knockout or gene silencing.

[0019] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0020] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0021] In the above text, the substance that downregulates, weakens, or reduces the expression of the nucleic acid encoding the protein OsLOX14 is any of the following biological materials: C1) Downregulate or weaken or reduce the expression of nucleic acid molecules encoding the protein OsLOX14; C2) An expression cassette containing the nucleic acid molecule described in C1); C3) A recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2); C4) A recombinant microorganism containing the nucleic acid molecule described in C1), or a recombinant microorganism containing the expression cassette described in C2), or a recombinant microorganism containing the recombinant vector described in C3); C5) A transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2); C6) Transgenic plant tissue containing the nucleic acid molecules described in C1), or transgenic plant tissue containing the expression cassette described in C2); C7) A transgenic plant organ containing the nucleic acid molecule described in C1), or a transgenic plant organ containing the expression cassette described in C2).

[0022] In the foregoing, the expression cassette containing nucleic acid molecules refers to DNA capable of expressing the proteins described above in host cells. The expression cassette may also include single-stranded or double-stranded nucleic acid molecules containing all the regulatory sequences necessary for expressing any of the aforementioned proteins. The regulatory sequences, under compatible conditions, guide the coding sequence to express any of the aforementioned proteins in suitable host cells. The regulatory sequences include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal sequences, and transcription terminators. At a minimum, the regulatory sequences must include a promoter and termination signals for transcription and translation. To introduce specific restriction enzyme sites into the vector for linking the regulatory sequences to the coding region of the nucleic acid sequence encoding the protein, a regulator-linked regulatory sequence may be provided. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence that mediates protein expression. The promoter may be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutated, truncated, and heterozygous promoters, and may be derived from genes encoding extracellular or intracellular proteins that are homologous or heterologous to those of the host cell. The regulatory sequence can also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell and thus terminate transcription. The termination sequence is operatively attached to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that can function in the selected host cell can be used in this invention. The regulatory sequence can also be a suitable leader sequence, i.e., an untranslated region of mRNA that is crucial for translation in the host cell. The leader sequence is operatively attached to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that can function in the selected host cell can be used in this invention. The regulatory sequence can also be a signal peptide coding region, which encodes an amino acid sequence attached to the amino terminus of a protein that guides the encoded protein into the cellular secretory pathway. Signal peptide coding regions that guide the expressed protein into the secretory pathway of the host cell can be used in this invention. Adding a regulatory sequence that can regulate protein expression according to the growth status of the host cell may also be necessary. Examples of regulatory sequences are those that respond to chemical or physical stimuli (including in the presence of regulatory compounds), thereby opening or closing gene expression. Other examples of regulatory sequences are those that can amplify genes. In these examples, the nucleic acid sequence encoding the protein should be operatively linked to the regulatory sequence.

[0023] Recombinant expression vectors containing the protein-coding gene expression cassettes can be constructed using existing plant expression vectors.

[0024] When preparing an expression vector, a nucleic acid molecule encoding any of the aforementioned proteins can be housed within the vector for operative linking to a suitable expression regulatory sequence. The recombinant expression vector can be any vector (e.g., plasmid or virus) that facilitates recombinant DNA manipulation and expression of the nucleic acid sequence. The choice of vector typically depends on its compatibility with the host cell to which it will be introduced. The vector can be a linear or closed circular plasmid. The vector can be a self-replicating vector (i.e., a complete structure existing outside the chromosome that can replicate independently of the chromosome), such as a plasmid, extrachromosomal element, microchromosome, or artificial chromosome. The vector can contain any mechanism that ensures self-replication. Alternatively, the vector is a vector that, when introduced into a host cell, will integrate into the genome and replicate along with the integrated chromosome. Furthermore, a single vector or plasmid, or two or more vectors or plasmids, or transposons, can be used, or the vector may contain the entire DNA to be introduced into the host cell genome. The vector contains one or more selection markers that facilitate the selection of transformed cells. A selection marker is a gene whose product confers resistance to biocides or viruses, resistance to heavy metals, or confers protrophic phenotypes, etc. Examples of bacterial selection markers include the dal gene of Bacillus subtilis or Bacillus licheniformis, or resistance markers for antibiotics such as ampicillin, kanamycin, chloramphenicol, or tetracycline. The vector contains elements that enable stable integration into the host cell genome or ensure autonomous replication of the vector independently of the cell genome. In the case of autonomous replication, the vector may also contain an origin of replication, enabling autonomous replication in the target host cell. The origin of replication may carry a mutation that makes it temperature-sensitive in the host cell. More than one copy of the nucleic acid molecule encoding any of the aforementioned proteins of the present invention can be inserted into the host cell to increase the yield of the gene product. This copy number increase can be achieved by inserting at least one additional copy of the nucleic acid molecule into the host cell genome, or by inserting an amplifiable selection marker along with the nucleic acid molecule, and by culturing cells in the presence of a suitable selection reagent to select cells containing the amplified copy of the selective marker gene, thereby containing the additional copy of the nucleic acid molecule. The operations used to connect the above-mentioned elements to construct the recombinant expression vector of the present invention are well known to those skilled in the art (see, for example, Sambrook et al., Molecular Cloning Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989).

[0025] The term "operable link" is defined in this paper as a conformation in which a regulatory sequence is located at the appropriate position of the coding sequence relative to the DNA sequence so that the regulatory sequence guides the expression of the protein.

[0026] In the above-mentioned biological materials, the recombinant microorganisms may specifically be yeast, bacteria, algae, or fungi.

[0027] In the application described above, the nucleic acid molecule shown in C1) is the DNA molecule shown in sequence 6.

[0028] In a second aspect, the present invention provides a method for reducing plant cold resistance, comprising the following steps: reducing the content or activity of the protein OsLOX14 described in the first aspect in the recipient plant, thereby reducing plant cold resistance.

[0029] As described above, the recipient plant contains the nucleic acid molecule encoding the protein OsLOX14 as described in the first aspect.

[0030] Thirdly, the present invention provides a method for reducing plant cold resistance, comprising the following steps: reducing the expression of nucleic acid molecules encoding the protein OsLOX14 described in the first aspect in the recipient plant, thereby reducing plant cold resistance.

[0031] Fourthly, the present invention provides a method for reducing plant cold resistance, comprising the following steps: gene editing of the nucleic acid molecule encoding the protein OsLOX14 described in the first aspect in the recipient plant, causing its translation to terminate prematurely, thereby reducing the plant's cold resistance.

[0032] Fifthly, the present invention provides a method for cultivating plants with low cold resistance, comprising the following steps: reducing the content or activity of the protein OsLOX14 described in the first aspect in the recipient plant to obtain a transgenic plant, which is the target plant.

[0033] In a sixth aspect, the present invention provides a method for cultivating plants with low cold tolerance, comprising the following steps: reducing the expression of nucleic acid molecules encoding the protein OsLOX14 described in the first aspect in a recipient plant to obtain a transgenic plant, which is the target plant.

[0034] In a seventh aspect, the present invention provides a method for cultivating plants with low cold resistance, comprising the following steps: gene editing of the nucleic acid molecule encoding the protein OsLOX14 described in the first aspect in the recipient plant, causing its translation to terminate prematurely, thereby obtaining a transgenic plant, which is the target plant.

[0035] In the above text, the plant referred to is either N1, N2, or N3. N1) Monocotyledonous or dicotyledonous plants; N2) Gramineae plants; N3) Rice.

[0036] The rice mentioned above can be japonica rice, specifically Nipponbare.

[0037] The experiments of this invention demonstrate that knockout OsLOX14Compared to wild-type Nipponbare, the knockout lines obtained from the gene showed lower cold hardiness. This demonstrates that the OsLOX14 protein and its encoding gene regulate cold hardiness in plants. Attached Figure Description

[0038] Figure 1 for OsLOX14 Identification of mutation types and seedling cold tolerance in transgenic lines; A represents Nipponbare (NIP) background. OsLOX14 Knockout line sequencing identification results; B is the knockout line in the NIP background. lox14-1, lox14-2 Phenotypic results of wild-type NIP before and after cold treatment; C represents the survival rate statistics of the strains in Figure B after four weeks of recovery; data are the mean ± standard deviation of three biological replicates, with n=24 per replicate, bar=5 cm, and Student's t test used for significance testing, * indicates P<0.05, ** indicates P<0.01. Detailed Implementation

[0039] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0040] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0041] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0042] Information on the carrier and culture medium in the following examples: CRISPR / Cas vector BGK03: Hangzhou Baige Biotechnology Co., Ltd., product catalog number BGK03.

[0043] Contains "sgRNA- U6 The plasmid for the "promoter" was constructed in our laboratory.

[0044] N6D2 medium is prepared by mixing 300 mg / L hydrolyzed casein, 500 mg / L proline, 500 mg / L glutamine, 30 g / L sucrose, 2 mg / L 2,4-D and solid MS medium components.

[0045] N6D2S1 medium: Mix 25 mg / L hygromycin, 600 mg / L cephalosporin and N6D2 medium components to obtain the medium.

[0046] N6D2S2 medium: Mix 50 mg / L hygromycin, 300 mg / L cephalosporin and N6D2 medium components to obtain the medium.

[0047] Differentiation medium A: Mix 300 mg / L hydrolyzed casein, 50 mg / L hygromycin, 1 mg / L 6-BA, 0.5 mg / L KT, 0.2 mg / L ZT, 0.25 mg / L NAA, 30 g / L sucrose, 30 g / L sorbitol and N6D2 medium components to obtain the medium.

[0048] Differentiation medium B: Mix 300 mg / L hydrolyzed casein, 50 mg / L hygromycin, 1 mg / L 6-BA, 0.5 mg / L KT, 0.2 mg / L ZT, 0.5 mg / L NAA, 30 g / L sucrose, 20 g / L sorbitol and N6D2 medium components to obtain the medium.

[0049] Rooting and seedling strengthening medium: Mix 1 mg / L paclobutrazol, 0.5 mg / L NAA and solid 1 / 2 MS medium components to obtain the medium.

[0050] The solute formulation of Kimura B culture medium is shown in Table 1, with a pH of 5.8 and dH2O as the solvent.

[0051] Table 1 shows the formulation of Kimura B culture medium.

[0052] The experimental methods in the following examples are as follows: 1. Plant DNA extraction Cut a 2 cm leaf and add 100 μL of TPS extraction solution (12.1 g / L Tris-HCl, 3.72 g / L EDTA, 74 g / L KCl, pH 8.0); add a 5 mm steel ball and shake at 30 rpm for 3 min in a tissue homogenizer; extract an appropriate amount of extract into a new PCR plate, add 4 volumes of ddH2O, mix well and set aside.

[0053] 2. Extraction and reverse transcription of total RNA from plants The Beijing Zhuangmeng Plant RNA Extraction Kit is used for RNA extraction, and the Beijing Yisheng Reverse Transcription Kit is used for reverse transcription: A suitable amount of plant tissue is rapidly cut and placed in a 2 mL centrifuge tube, then flash-frozen in liquid nitrogen. The tissue is then thoroughly ground in a cryogenic grinder, and 1 mL of pre-chilled lysis buffer R is added. After vortexing, 200 μL of chloroform is added, and the mixture is vortexed again. The mixture is centrifuged at 12000 rpm for 5 min. At this point, the supernatant separates into three layers, with RNA in the upper aqueous phase. The upper aqueous phase is transferred to a new EP tube, and 0.5 times the volume of ethanol is added, followed by mixing. The mixture is then transferred to an adsorption column (placed in a collection tube), centrifuged at 12000 rpm for 1 min, and the filtrate is removed. 500 μL of washing buffer PW is added, and the mixture is centrifuged at 12000 rpm for 1 min, and the filtrate is removed. This washing process is repeated once. The adsorption column is then placed in a collection tube and centrifuged at 12000 rpm for 2 min to remove residual liquid. The adsorption column is then placed in a new EP tube, and 50 μL of ddH2O (RNAase-free) is added, and the mixture is centrifuged at 12000 rpm for 1 min. Collect RNA at 1 min; add an appropriate amount of RNA according to the extracted RNA concentration, add 1 μL gDNA digester and 2 μL 5×gDNA digester buffer, and add ddH2O (RNAase-free) to make up to 10 μL, mix well; react at 42℃ for 2 min; add 10 μL 2×SuperMix plus, mix well; react at 25℃ for 5 min, react at 42℃ for 30 min, and react at 85℃ for 5 min.

[0054] 3. PCR amplification The reaction system is as follows: 10 μL of premixed Mix (Nanjing Novizan Biotechnology Co., Ltd., 2 × Phanta Max Master Mix (Dye Plus), catalog number: P525-03), 0.6 μL of 10 μM primers, appropriate amount of template, and ddH2O to make up to 20 μL.

[0055] The reaction procedure is as follows: 1. 95℃ for 3 min; 2. 95℃ for 30 s; 3. 50℃-60℃ for 30 s; 4. 72℃ for an appropriate time; 5. 72℃ for 10 min; Steps 2 to 4 of the reaction procedure are set to 30-35 cycles.

[0056] 4. Edge-cutting and edge-connecting method for carrier construction The reaction system is as follows: Carrier 100-200 ng PCR amplification of DNA 10-20 ng Reaction buffer (Anza10× buffer Invitrogen, catalog number: IVGN2014) 1 μL BsaI (Eco31I) 0.5 μL T4 ligase 2.5 μL Add ddH2O to bring the volume to 10 μL Cutting and connecting reaction procedure: 37℃ for 5 min 20℃ for 5 min 10 cycles 37℃ for 5 min 5. Nucleic acid purification and recovery The following steps were performed using the OMEGA (USA) gel extraction kit: After nucleic acid electrophoresis, the gel containing the target band was cut using a gel cutter. An appropriate amount of Binding Buffer was added, and the gel was dissolved at 55°C. The completely dissolved gel solution was transferred to an adsorption column (placed in a collection tube) and centrifuged at 12000 rpm for 1 min. The filtrate was removed, and 300 μL of Binding Buffer was added. The column was centrifuged at 12000 rpm for 1 min, and the filtrate was removed. 500 μL of Wash Buffer was added, and the column was centrifuged at 12000 rpm for 1 min, and the filtrate was removed. This washing process was repeated once. The adsorption column was placed back into the collection tube and centrifuged at 12000 rpm for 2 min to thoroughly remove any residual liquid. The adsorption column was then placed in a new EP tube, and approximately 50 μL of ddH2O was added. The column was centrifuged at 12000 rpm for 1 min, and the nucleic acid solution was collected.

[0057] 6. Enzyme digestion reaction The enzyme digestion system consisted of 10 μL nucleic acid, 5 μL digestion buffer, 2 μL enzyme, and ddH2O to bring the total volume to 50 μL. Digestion was carried out at 37°C for 2 hours. The digested products were purified and recovered by agarose gel electrophoresis. 7. Recombination of connections The vector construction strategy adopted the Gibson assembly method, referring to the instructions of the recombinant ligation kit from Beijing TransGen Biotech Co., Ltd.: primers were designed and synthesized according to the recombinant ligation method, and the target band was amplified by PCR, followed by gel extraction and purification; the vector plasmid was linearized by specific restriction endonucleases and purified by gel extraction; the purified PCR product and the linearized vector plasmid were recombinantly ligated using the recombinant ligation kit from Beijing TransGen Biotech Co., Ltd.; the ligation product was transformed into DH5α competent cells, plated on LB medium with the appropriate resistance, and incubated at 37°C; the correctly sequenced strains were selected and stored for later use.

[0058] The OsLOX14 protein in Nipponbare rice in the following examples is shown in Sequence 1 of the sequence listing. The open reading frame encoding the OsLOX14 protein in the cDNA of Nipponbare rice is shown in Sequence 2 of the sequence listing. The gene encoding the OsLOX14 protein in the genomic DNA of Nipponbare rice is shown in Sequence 3 of the sequence listing.

[0059] Example 1: Transgenic rice with OsLOX14 knocked out I. Construction of the transgenic vector pCRISPR-OsLOX14 choose OsLOX14 The following two sequences are used as target sequences for the knockout vector: 5'- CGCAGACTCTGGCGCCGGCA -3' (Target 1, positions 80-99 of sequence 3) 5'-CGACCGACGACCTCCTTACG-3' (Target 2, sequence 3, positions 248-267) Single-stranded DNA molecule I (5'-GCAGGTCTCATGTGCGCAGACTCTGGCGCCGGCAGTTTTAGAGCTAGAAATAGCAAGTTA-3') and single-stranded DNA molecule II (5'-GCAGGTCTCTAAACCGTAAGGAGGTCGTCGGTCGGCCACGGATCATCTGCA-3') were synthesized.

[0060] Using single-stranded DNA molecules I and II as primers, and a plasmid containing the "sgRNA-U3 promoter" as a template, PCR amplification was performed to obtain a double-stranded DNA molecule of "target 1-sgRNA-U3-target 2". The DNA fragment was then recovered and purified and designated as a double-stranded DNA molecule with its nucleotide sequence as Sequence 6.

[0061] In the DNA molecule shown in Sequence 6, positions 15-34 are the target 1 binding region, positions 178-558 are sgRNA-OsU3, and positions 559-578 are the target 2 binding region (target 2 is reverse complementary).

[0062] The above-mentioned double-stranded DNA molecules were ligated to the CRISPR / Cas vector BGK03 using a cleavage-ligation method. The resulting ligation product was transformed into E. coli DH5α competent cells, and positive clones were obtained by screening with kanamycin-containing resistant plates.

[0063] Recombinant plasmids were extracted from positive clones and sequenced for verification. The correctly sequenced vector plasmid was named pCRISPR-OsLOX14.

[0064] pCRISPR-OsLOX14 is a vector obtained by inserting the DNA molecule shown in sequence 6 between the BsaI restriction sites of vector BGK03.

[0065] Based on the sequencing results, the structure of the recombinant plasmid pCRISPR-OsLOX14 is described as follows: The recombinant plasmid pCRISPR-OsLOX14 contains the coding sequence of sgRNA1 (sequence 4) that recognizes target 1 and the coding sequence of sgRNA2 (sequence 5) that recognizes target 2, expressing sgRNA1 and sgRNA2 respectively.

[0066] II. Obtaining Genetically Modified Rice 1. The above pCRISPR-OsLOX14 plasmid was chemically transformed into Agrobacterium EHA105. The engineered bacteria with positive clones were obtained by screening on resistant plates containing kanamycin and rifampicin, thus obtaining pCRISPR-OsLOX14 recombinant Agrobacterium.

[0067] The pCRISPR-OsLOX14 recombinant Agrobacterium was cultured to obtain bacterial culture.

[0068] 2. Place the sterilized seeds of Nipponbare japonica rice (hereinafter also known as wild-type rice) on callus induction medium N6D2 and incubate at 32°C with 24-hour light for about 6 days. Transfer the grown callus tissue to fresh callus induction medium N6D2 and continue to culture at 32°C with continuous light for 3 days.

[0069] 3. Cultivate the pCRISPR-OsLOX14 recombinant Agrobacterium obtained in step 1 until the OD value is about 0.5-0.8. Centrifuge the Agrobacterium at 6000 rpm for 10 minutes, discard the supernatant, and resuspend it in 30-40 ml of AAM (prepare fresh before use, add AS 1:1000 before use; the amount of AAM can be smaller to ensure a higher concentration of Agrobacterium). Place it on a shaker at 28℃ and 190 rpm for 30-40 minutes. Then, immerse the Japonica rice Nipponbare callus obtained in step 2 (if the callus is large, it can be cut into smaller pieces) in the bacterial solution for about 3 minutes (the time can be extended).

[0070] Then wash the infected callus 4-5 times with sterile water containing 300 mg / L cephalosporin, blot off excess water with sterile filter paper, and then transfer it to N6D2S1 medium and culture for 2 weeks.

[0071] 4. After completing step 3, take the callus tissue, transfer it to N6D2S2 medium and culture it for 2 weeks, then transfer it to a new N6D2S2 medium and culture it for 2 weeks.

[0072] 5. After completing step 4, take the vigorously growing callus tissue and transfer it to differentiation medium A for 7 days, then transfer it to differentiation medium B until regenerated seedlings emerge. Culture conditions: 12 hours light / 12 hours dark; light intensity 8000 lux; temperature 28℃ during light and 25℃ during darkness.

[0073] 6. After completing step 5, transfer the regenerated seedlings to the rooting and strengthening culture medium for cultivation. When the seedlings grow to about 10 cm, open the container sealing film, harden the seedlings for 2-3 days, and then transfer the seedlings to the artificial climate chamber for cultivation.

[0074] T0 generation CRISPR knockout transgenic rice was obtained.

[0075] T0 generation CRISPR knockout transgenic rice was used for PCR amplification of the target site and sequencing identification using primers "F+R". The genome contained... OsLOX14 Genes with significant mutations are identified as positive T0 generation CRISPR knockout transgenic rice. Positive T0 generation CRISPR knockout transgenic rice is further cultured to obtain T2 generation CRISPR knockout transgenic homozygous rice.

[0076] III. Identification of Genetically Modified Rice The T2 generation CRISPR knockout transgenic homozygous rice obtained from the above two NIP backgrounds was numbered as follows: lox14-1 , lox14-2 and lox14-3 Genomic DNA was extracted from leaves of the plant and used as a template. The target site was amplified by PCR using the following primer pair "F+R" and then sequenced for identification. Wild-type rice NIP was used as a control.

[0077] F: 5'-AGTATTTACACTACGGACAACCC-3'; R: 5'-AAGCCAGTCTCGATTAACCAT-3'; The results are as follows Figure 1 As shown in Figure A, T2 generation CRISPR knockout transgenic homozygous rice lox14-1 Compared to wild-type rice NIP, the genome has OsLOX14 The gene has mutated: in two homologous chromosomes, the nucleotide sequence is sequence 3. OsLOX14 The genomes of all genes underwent the following changes: a T base was inserted between positions 264 and 265 of sequence 3 (1 bp inserted at target site 2), causing a frameshift that prematurely terminated protein translation, thereby... OsLOX14 Gene knockout.

[0078] T2 generation CRISPR knockout transgenic homozygous rice lox14-2 Compared to wild-type rice NIP, the genome hasOsLOX14 The gene has mutated: in two homologous chromosomes, the nucleotide sequence is sequence 3. OsLOX14 The genomes of all genes underwent the following changes: deletion of TTAC bases from position 263 to 266 of sequence 3 (4 bp deletion at target site 2), which caused a frameshift, leading to premature termination of protein translation, thereby... OsLOX14 Gene knockout.

[0079] T2 generation CRISPR knockout transgenic homozygous rice lox14-3 Compared to wild-type rice NIP, the genome has OsLOX14 The gene has mutated: in two homologous chromosomes, the nucleotide sequence is sequence 3. OsLOX14 The genomes of all genes underwent the following changes: deletion of bases TT from position 263 to 264 of sequence 3 (2 bp deletion at target site 2), which caused a frameshift, leading to premature termination of protein translation, thereby... OsLOX14 Gene knockout.

[0080] The above results indicate that lox14-1 , lox14-2 , lox14-3 The positive CRISPR knockout transgenic rice is named CRISPR knockout. OsLOX14 Genetically modified rice.

[0081] IV. Cold treatment of genetically modified rice The parameters for alternating light and dark culture are as follows: light intensity is 120 μmol·m⁻¹. -2 ·s -1 The temperature is 28℃ / 25℃ (day / dark), and the photoperiod is 10 hours of light / 14 hours of darkness.

[0082] The rice seeds tested were the aforementioned T2 generation CRISPR knockout rice seeds. OsLOX14 Genetically modified rice lox14-1 and lox14-2 , and wild-type rice NIP.

[0083] The experiment was repeated three times and the average value was taken. The steps for each repetition were as follows: 1. Take 50 rice seeds to be tested, put them into kraft paper bags, and soak them in water at 37℃ for 48 hours.

[0084] 2. After completing step 1, germinate the seeds at 37℃ for 24 hours (keep the seeds moist during germination) to obtain germinated seeds.

[0085] 3. After completing step 2, take a 96-well plate, cut off part of the lower edge of each well, and then put one germinated seed with uniform growth into each well (embryo facing up, radicle facing down).

[0086] 4. After completing step 3, place the 96-well plate (containing the germinated seeds) on a plastic box containing Kimura B culture medium, immersing the germinated seeds in the Kimura B culture medium. Culture in alternating light and dark conditions for 2 weeks to obtain rice seedlings that have reached the three-leaf stage. During the alternating light and dark culture period, the Kimura B culture medium needs to be replaced every 7 days.

[0087] 5. After completing step 4, place the 96-well plate (on which rice seedlings that have grown to the three-leaf stage) in a low-temperature water bath for cold treatment. The water bath temperature is 4°C and the air temperature is 20°C. During the treatment, the water level is 3 cm above the growth point, and the cold treatment is carried out at 4°C for 80 hours.

[0088] 6. After completing step 5, the 96-well plate (with rice seedlings on it) is returned to the artificial climate chamber for recovery culture. After 4 weeks of recovery, the survival rate of different strains is counted (the survival rate is the number of surviving seedlings divided by the total number of seedlings).

[0089] T2 generation CRISPR knockout OsLOX14 Genetically modified rice lox14-1 and [[ID=3,4]]lox14-2 Seedling cold resistance assessment was conducted by cold treatment at 4℃ for 80 hours, followed by photographs taken 4 weeks after normal recovery. Figure 1 B), and count the survival rate to identify the knockout strains. lox14-1 The average survival rate was 72.2%. lox14-2 The average survival rate was 47.2%, while the survival rate of wild-type NIP was around 87.5%. Figure 1 C). Explanation of the NIP in japonica rice OsLOX14 After gene knockout, the cold resistance of seedlings changed significantly.

[0090] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The protein OsLOX14, or a substance that downregulates, weakens, or reduces the expression of the nucleic acid encoding said protein OsLOX14, or a substance that downregulates, weakens, or reduces the activity or content of said protein OsLOX14, is used in any of the following ways: B1) Regulate plant cold resistance; B2) Plant breeding; The protein OsLOX14 is either A1), A2), A3), or A4): A1) Proteins that include the amino acid residues shown in Sequence 1; A2) A plant-derived protein with the same biological function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein shown in A1). Proteins that share 80% or more of the same amino acid sequence as those defined in A3 and A1, are derived from plants, and have the same biological function; A4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins shown in A1)-A3).

2. The application according to claim 1, characterized in that: The substance that downregulates, weakens, or reduces the expression of the nucleic acid encoding the protein OsLOX14 is any of the following biological materials: C1) Downregulate or weaken or reduce the expression of nucleic acid molecules encoding the protein OsLOX14; C2) An expression cassette containing the nucleic acid molecule described in C1); C3) A recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2); C4) A recombinant microorganism containing the nucleic acid molecule described in C1), or a recombinant microorganism containing the expression cassette described in C2), or a recombinant microorganism containing the recombinant vector described in C3); C5) A transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2); C6) Transgenic plant tissue containing the nucleic acid molecules described in C1), or transgenic plant tissue containing the expression cassette described in C2); C7) A transgenic plant organ containing the nucleic acid molecule described in C1), or a transgenic plant organ containing the expression cassette described in C2).

3. The application according to claim 2, characterized in that: The nucleic acid molecule shown in C1 is the DNA molecule shown in sequence 6.

4. A method for reducing plant cold resistance, comprising the following steps: reducing the content or activity of the protein OsLOX14 as described in claim 1 in the recipient plant, thereby reducing plant cold resistance.

5. A method for reducing plant cold hardiness, comprising the steps of: reducing the expression of the nucleic acid molecule encoding the protein OsLOX14 as described in claim 2 in the recipient plant, thereby reducing plant cold hardiness.

6. A method for reducing plant cold hardiness, comprising the following steps: gene editing of the nucleic acid molecule encoding the protein OsLOX14 as described in claim 2 in the recipient plant, causing premature termination of its translation and reducing the plant's cold hardiness.

7. A method for cultivating plants with low cold tolerance, comprising the following steps: reducing the content or activity of the protein OsLOX14 described in claim 1 in a recipient plant to obtain a transgenic plant, which is the target plant.

8. A method for cultivating plants with low cold tolerance, comprising the following steps: reducing the expression of the nucleic acid molecule encoding the protein OsLOX14 as described in claim 2 in a recipient plant to obtain a transgenic plant, which is the target plant.

9. A method for cultivating plants with low cold tolerance, comprising the following steps: gene editing of the nucleic acid molecule encoding the protein OsLOX14 as described in claim 2 in the recipient plant, causing its translation to terminate prematurely, thereby obtaining a transgenic plant, which is the target plant.

Images