Heliper plasmid for high-yield recombinant adeno-associated virus and application of helper plasmid
By adjusting the recombinant sequence and promoter position in the helper plasmid, a dual plasmid transfection system was constructed, which solved the problem of high production cost of recombinant adeno-associated virus in the prior art, and achieved high-yield and low-cost AAV production, which is suitable for gene therapy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-13
- Publication Date
- 2026-04-03
AI Technical Summary
The production cost of recombinant adeno-associated virus (rAAV) in the current technology is high, mainly due to low yield, which makes it difficult to meet the needs of high-dose disease treatment. In addition, the AAV production titer of existing helper plasmids is low, which limits the widespread application of gene therapy.
Design a high-yield helper plasmid for recombinant adeno-associated virus, comprising Rep and Cap protein coding sequences, E2A, E4, and VA RNA sequences, and a promoter sequence, wherein the promoter is located downstream of the Rep and Cap protein coding sequences. Construct a two-plasmid transfection system to replace the traditional three-plasmid method, simplifying the operation and reducing costs.
It significantly increased the yield of AAV per cell by approximately 4.2-11.2 times, reduced production costs, and demonstrated viral titers comparable to the three-plasmid system in large-scale production, making it suitable for GMP-level AAV production systems.
Smart Images

Figure CN121780618A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to an auxiliary plasmid for high-yield recombinant adeno-associated virus and its applications. Background Technology
[0002] In recent years, rAAV-based gene therapy has attracted widespread attention due to its advantages such as low pathogenicity and low immunogenicity, making it a favored gene therapy delivery vector. rAAV-based vectors can target both dividing and non-dividing cells, including the retina, liver, heart, muscle, and central nervous system (CNS), to achieve long-term expression of therapeutic genes. To date, more than 200 clinical trials have been conducted to treat various diseases, such as hemophilia, Parkinson's disease, wet age-related macular degeneration, mucopolysaccharidosis (MPS), and Barton's disease. Despite the success of rAAV-based gene therapy in clinical trials, high manufacturing costs remain a bottleneck in the field due to low yields and high dosage requirements for certain disease indications, thus limiting patient access to these promising products. This, in turn, intensifies the need to reduce AAV production costs and establish flexible, GMP-compliant AAV production systems.
[0003] Transient transfection of human embryonic kidney (HEK)293 cells with plasmids is a common strategy for the preparation of adeno-associated virus (AAV) vectors, offering advantages such as short production cycles, ease of operation, and high flexibility. The three-plasmid transfection method is currently the most commonly used method for producing recombinant adeno-associated virus (rAAV). This method uses three plasmids to co-transfect HEK293 cells: an AAV genome plasmid containing a target gene (GOI) expression cassette with inverted terminal repeats (ITRs) at both ends; a packaging plasmid providing the Rep and Cap protein coding sequences for AAV; and an auxiliary plasmid containing the adenovirus E2A, E4, and VA RNA genes.
[0004] In 1998, Grimm et al. reported combining the packaging plasmid and helper plasmid from a three-plasmid system onto a single plasmid, specifically the AAV rep / cap and Ad helper genes, within a single helper plasmid pDG. However, the titer of AAV production using this helper plasmid was low, only about 1E+07 IU / mL. Recently, modifications to this prototype backbone, replacing the ampicillin gene with a kanamycin resistance gene, have resulted in another helper plasmid called pQT, which is more compliant with GMP production standards. Using a dual-plasmid system instead of a triple-plasmid system for AAV preparation simplifies the transfection process and reduces the number of components required for AAV production, lowering plasmid production costs and thus saving significant costs in GMP-compliant rAAV production. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide an auxiliary plasmid for high-yield recombinant adeno-associated virus and its application.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0007] In a first aspect, the present invention provides a helper plasmid for high-yield recombinant adeno-associated virus, comprising a backbone plasmid and a recombinant sequence; the recombinant sequence comprising:
[0008] Rep and Cap protein coding sequences, E2A, E4, and VA RNA sequences, and at least one promoter sequence;
[0009] The promoter sequence is located downstream of the Rep and Cap protein coding sequences.
[0010] After transfection of cells with the helper plasmid of the present invention, compared with the pRCHelper helper vector driven by the promoter alone, the helper plasmid with the promoter placed downstream of the Rep and Cap protein coding sequences can increase AAV production by about 4.2-11.2 times, which can significantly improve AAV production in single cells.
[0011] In a preferred embodiment of the auxiliary plasmid described in this invention, the recombinant sequence further includes at least one DA' sequence.
[0012] In a preferred embodiment of the auxiliary plasmid described in this invention, the DA' sequence is located downstream of the Rep and Cap protein coding sequences.
[0013] In a preferred embodiment of the auxiliary plasmid described in this invention, the recombinant sequence includes any one of the following from the 5' to 3' direction:
[0014] i. The Rep and Cap protein coding sequences, the E2A, E4, and VA RNA sequences, and the promoter sequence;
[0015] ii. The Rep and Cap protein coding sequences, the E2A, E4, and VA RNA sequences, the DA' sequence, and the promoter sequence;
[0016] iii. The E2A, E4, and VA RNA sequences, the Rep and Cap protein coding sequences, the DA' sequence, and the promoter sequence;
[0017] iv. The Rep and Cap protein coding sequences, the promoter sequences, and the E2A, E4, and VA RNA sequences;
[0018] v. The Rep and Cap protein coding sequences, the DA' sequence, the promoter sequence, and the E2A, E4, and VARNA sequences;
[0019] vi. The Rep and Cap protein coding sequences, the promoter sequence, the E2A, E4, and VA RNA sequences, and the DA' sequence;
[0020] vii. The Rep and Cap protein coding sequences, the DA' sequence, the E2A, E4, and VA RNA sequences, and the promoter sequence;
[0021] viii. The Rep and Cap protein coding sequences, the DA' sequence, the E2A, E4, and VA RNA sequences, the DA' sequence, and the promoter sequence;
[0022] ix, the Rep and Cap protein coding sequences, the DA' sequence, the promoter sequence, the E2A, E4, and VARNA sequences, the DA' sequence, and the promoter sequence.
[0023] In a preferred embodiment of the auxiliary plasmid described in this invention, the promoter is the P5 promoter, the nucleotide sequence of which is shown in SEQ ID NO: 2.
[0024] As a preferred embodiment of the auxiliary plasmid described in this invention, the DA' sequence is shown in SEQ ID NO: 3.
[0025] In a preferred embodiment of the auxiliary plasmid described in this invention, the Rep is derived from adeno-associated virus type 2, and its nucleotide sequence is shown in SEQ ID NO: 4; the Cap is derived from adeno-associated virus type 9, and its nucleotide sequence is shown in SEQ ID NO: 5.
[0026] In a preferred embodiment of the auxiliary plasmid described in this invention, the E2A, E4, and VA RNAs are derived from adenovirus; preferably, the nucleotide sequence of the E2A is shown in SEQ ID NO: 6, the nucleotide sequence of the E4 is shown in SEQ ID NO: 7, and the nucleotide sequence of the VA RNA is shown in SEQ ID NO: 8.
[0027] Secondly, the present invention provides a plasmid set for high-yield recombinant adeno-associated virus, including the aforementioned helper plasmid and AAV plasmid.
[0028] Preferably, the AAV plasmid is an AAV plasmid of a fluorescent protein driven by the CAG promoter. More preferably, the AAV plasmid is a pAAV.CAG.EGFP vector.
[0029] Thirdly, the present invention provides a high-yield production system for recombinant adeno-associated virus, obtained by transforming host cells with the above-mentioned plasmid group.
[0030] Preferably, the host cell is HeLa, HEK293, or insect Sf9 cell.
[0031] Fourthly, the present invention provides a method for producing high-yield recombinant adeno-associated virus using the aforementioned production system.
[0032] Fifthly, the present invention applies the above-mentioned auxiliary plasmid, the above-mentioned plasmid group, and the above-mentioned production system in AAV production.
[0033] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0034] The helper plasmid provided by this invention increases rAAV virus yield. The plasmid comprises a backbone plasmid and a recombinant sequence; the recombinant sequence includes: Rep and Cap protein-coding sequences, E2A, E4, and VA RNA sequences, and at least one promoter sequence; the promoter sequence is located downstream of the Rep and Cap protein-coding sequences. After transfection of cells with the helper plasmid of this invention, compared with the single promoter-driven pRCHelper helper vector, the helper plasmid with the promoter placed downstream of the Rep and Cap protein-coding sequences increases AAV yield by approximately 4.2-11.2 times, significantly improving AAV yield per cell. It can be applied to large-scale AAV production. Attached Figure Description
[0035] Figure 1 This is a schematic diagram of the structural elements of the plasmid framework in Example 1.
[0036] Figure 2 This is a schematic diagram of the experimental design for studying the functions of P5 and DA' in the embodiment;
[0037] Figure 3 This is a comparison of the viral titer of the lysate of each plasmid group detected in the examples with that of the control vector;
[0038] Figure 4 A statistical chart showing the titers of AAV produced by two plasmids and AAV produced by three plasmids. Detailed Implementation
[0039] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
[0040] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0041] Example 1: Construction of helper plasmid pRCHelper
[0042] By designing combinations of placement positions for various DA', P5 promoters, Rep, Cap, E2A, E4, and VA RNAs, different candidate helper plasmids were constructed based on a backbone vector using conventional molecular cloning methods. Figure 1 (See Table 1), and then compare the toxin production titers of each auxiliary vector in the dual plasmid transfection system in parallel.
[0043] Table 1 Information on plasmid AJ
[0044]
[0045]
[0046] Among them, plasmid backbone (such as Figure 1 The sequence is shown in SEQ ID NO: 1; the P5 promoter sequence is shown in SEQ ID NO: 2; the DA' sequence is shown in SEQ ID NO: 3; Rep is from adeno-associated virus type 2, and its sequence is shown in SEQ ID NO: 4; Cap is from adeno-associated virus type 9, and its sequence is shown in SEQ ID NO: 5; E2A, E4, and VA RNA are from adenovirus, and the E2A sequence is shown in SEQ ID NO: 6, the E4 sequence is shown in SEQ ID NO: 7, and the VA RNA sequence is shown in SEQ ID NO: 8.
[0047] Figure 2 The construction process of helper plasmids A to J is as follows:
[0048] (1) Using plasmids containing the RepCap gene as templates, the RepCap gene sequence, DA' sequence, P5 sequence and RNA gene sequence containing E2A / E4 / VA were amplified respectively.
[0049] The PCR reaction system is shown in Table 2:
[0050] Table 2 PCR reaction system
[0051]
[0052] The primer sequences used for plasmid A are shown below:
[0053] Forward primer 1: ATGGCTGCCGATGGTTATC;
[0054] Reverse primer 1: acgtaatccgtagatgtacctgg;
[0055] Forward primer 2: aggtacatctacggattacgtAAGCCGAATTCTGCAGATATCC;
[0056] Reverse primer 2: gtgacctctaatacaggacctAGCTCCCCCGATACCGTC;
[0057] Forward primer 3: aggtcctgtattagaggtcacg;
[0058] Reverse primer 3: ACCATCGGCAGCCATacctgatttaaatcatttattgttcaaagatg.
[0059] The primer sequences used for plasmid B are shown below:
[0060] Forward primer 1: aggtacatctacggattacgtTGCAGGACTAGAGGTCCTG;
[0061] Reverse primer 1: AGCTCCCCCGATACCGTC;
[0062] Forward primer 2: CGATCGACGAGGTCGACGGTATC;
[0063] Reverse primer 2: acgtaatccgtagatgtacctgg.
[0064] The primer sequences used for plasmid C are shown below:
[0065] Forward primer 1: CCCCCTCGATCGAGGATGCCGGGGTTTTACGAGAT; Reverse primer 1: CCTCCACCAGATCACCATC;
[0066] Forward primer 2: aggtacatctacggattacgtACCTGCAAGGAACCCCTAGT;
[0067] Reverse primer 2: gagtgggtaccggatccGTTCAACTGAAACGAATCAACCG; Forward primer 3: ggatccggtacccaactcca;
[0068] Reverse primer 3: acgtaatccgtagatgtacctgg.
[0069] The primer sequences used for plasmid D are shown below:
[0070] Forward primer 1: aggtacatctacggattacgtCGATCGAGGTCGACGGTATC;
[0071] Reverse primer 1: gagtgggtaccggatccAAAACCCTGGCGTTACCCAA;
[0072] Forward primer 2: ggatccggtacccaactcca;
[0073] Reverse primer 2: acgtaatccgtagatgtacctgg.
[0074] The primer sequences used for plasmid E are shown below:
[0075] Forward primer 1:
[0076] CGAAGGGCGAATTCGTTTGCAGGACTAGAGGTCCTGTATTAG; Reverse primer 1: gggtaaataatcacccgagagt;
[0077] Forward primer 2: aggtacatctacggattacgtTTCCAGTCGGGAAACCTGTC;
[0078] Reverse primer 2: gagtgggtaccggatccACTTTATGCTTCCGGCTCGT;
[0079] Forward primer 3: ggatccggtacccaactcca;
[0080] Reverse primer 3: acgtaatccgtagatgtacctgg.
[0081] The primer sequences used for plasmid F are shown below:
[0082] Forward primer 1: aggtacatctacggattacgtTTCCAGTCGGGAAACCTGTC;
[0083] Reverse primer 1: gagtgggtaccggatccACTTTATGCTTCCGGCTCGT;
[0084] Forward primer 2: ggatccggtacccaactcca;
[0085] Reverse primer 2: acgtaatccgtagatgtacctgg.
[0086] The primer sequences used for plasmid G are shown below:
[0087] Forward primer 1: ggatccggtacccaactcca;
[0088] Reverse primer 1: GTCCTGCAGCCTCAGTGA;
[0089] Forward primer 2: ACTGAGGCTGCAGGACGTGGAGCTCCAGCTTTTGTT; Reverse primer 2: GTTCAACTGAAACGAATCAACCG;
[0090] Forward primer 3:
[0091] CGGTTGATTCGTTTCAGTTGAACTGCAGGACTAGAGGTCCTG;
[0092] Reverse primer 3: gagtgggtaccggatccGGATATCTGCAGAATTCGGCTT. The primer sequences used for plasmid H are shown below:
[0093] Forward primer 1: aggtacatctacggattacgtGCAGGACTAGAGGTCCTGTATTAG; Reverse primer 1: gagtgggtaccggatccGCCTCAGTGAGCGAGC;
[0094] Forward primer 2: ggatccggtacccaactcca;
[0095] Reverse primer 2: acgtaatccgtagatgtacctgg.
[0096] The primer sequences used for plasmid I are shown below:
[0097] Forward primer 1: CGGTTGATTCGTTTCAGTTGAAC;
[0098] Reverse primer 1: gagtgggtaccggatccGCCTCAGTGAGCGAGC;
[0099] Forward primer 2: ggatccggtacccaactcca;
[0100] Reverse primer 2: GTTCAACTGAAACGAATCAACCG.
[0101] The primer sequences used for plasmid J are shown below:
[0102] Forward primer 1: CGGTTGATTCGTTTCAGTTGAAC;
[0103] Reverse primer 1: tggagttgggtaccggatccCTGCAGAATTCGGCTTGG;
[0104] Forward primer 2: ggatccggtacccaactcca;
[0105] Reverse primer 2: GTTCAACTGAAACGAATCAACCG.
[0106] PCR reaction conditions are shown in Table 3:
[0107] Table 3 PCR reaction conditions
[0108]
[0109] (2) The PCR amplified bands were detected by agarose gel electrophoresis, and the target fragment was recovered using a gel recovery kit.
[0110] (3) Use the Seamless Cloning Kit to perform multi-fragment ligation.
[0111] The seamless cloning reaction system is shown in Table 4:
[0112] Table 4 Reaction System
[0113] Reactive components Volume (μL) 2×Assembly Mix 5 Linearized vector 1 Inserts n Nuclease-free Water to 10
[0114] The reaction conditions were 50℃ for 1 hour.
[0115] The reaction product was transformed into *E. coli*, plated on kanamycin-resistant plates, and colonies were picked the following day for colony PCR identification. Positive clones were sent to Guangzhou Genewiz Biotechnology Co., Ltd. for sequencing to select the correct plasmids. Example 2: Production of AAV by dual plasmid transfection
[0116] (1) Seedling 293T cells (293T, derived from...) CRL-3216TM cells were cultured in 3E+05 to 6-well plates in high-glucose DMEM medium containing 10% newborn calf serum and 1% Penicillin / Streptomycin at 37°C in a 5% CO2 cell culture incubator for about 48 hours. The cell density at the time of transfection was about 60-70%.
[0117] (2) Add the pRCHelper helper vector AJ constructed in Example 1 and the AAV plasmid pAAV.CAG.EGFP vector of fluorescent protein driven by CAG promoter to 0.5 mL DMEM at a ratio of 1 μg: 0.5 μg, then add 3 μL of PEI (1 μg / μL), vortex to mix, let stand at room temperature for 10 minutes, then add to 1.5 mL transfection medium and vortex to mix.
[0118] The pRC plasmid, pHelper plasmid, and AAV plasmid pAAV.CAG.EGFP vector of the CAG promoter-driven fluorescent protein control group were added to 0.5 mL of DMEM at a ratio of 0.5 μg:0.5 μg:0.5 μg. Then, 3 μL of PEI (1 μg / μL) was added, vortexed, and incubated at room temperature for 10 minutes before being added to 1.5 mL of transfection medium and vortexed.
[0119] Remove the culture medium from the 6-well plate, add the transfection mixed culture medium, and then put it back into the 37°C cell culture incubator (5% CO2 concentration) for culture.
[0120] (3) After culturing for 72 hours, add 15 μL of cell lysis buffer, collect the cells and supernatant into a 2 mL centrifuge tube, lyse at 37°C and 250 rpm for 1 h, and centrifuge at 10000 g for 10 minutes to obtain the crude AAV extract.
[0121] Example 3: Determination of AAV titer
[0122] The titers of AVV produced by double plasmid transfection in each group in Example 2 were determined using the following methods:
[0123] The sequences of ITRs for all types of AAV vectors were specifically detected using primers FWD ITR (5'-GGAACCCCTAGTGATGGAGTT) and REV (5'-CGGCCTCAGTGAGCGA).
[0124] (1) Digest the sample with Dnase I
[0125] The composition of the reaction system is shown in Table 5:
[0126] Table 5 Reaction System
[0127] Reagent X1 Nuclease-free Water 15.8μL 10×DNase Buffer 2μL Dnase I,RNase free (70 U / μL) 0.2μl Sample 2μL
[0128] Take 5 μL of sample and dilute it 20-fold. Take the corresponding number of PCR tubes, aliquot 18 μL of digestion solution into each tube, add 2 μL of the diluted sample and 2 μL of plasmid standard (containing 4E+08AAV copies (Genome Copies, GC), as a DNase digestion control) to each tube, which is equivalent to a 10-fold dilution. Incubate at 37°C for 30 min. After digestion, take 5 μL of sample and add it to 95 μL of water, and dilute twice consecutively, for a total dilution of 80,000 times. The RefAAV (plasmid standard) is diluted a total of 4,000 times.
[0129] (2) SYBR Green qPCR
[0130] Preparation of standards: Take plasmid standards containing 2E+08 AAV copies / μL and perform six serial dilutions using 8μL + 72μL water. The first gradient concentration is 2E+08GC / μL, which is set to 8E+14GC / mL in the software to reflect the dilution gradient of the sample. Subsequent gradients are 8E+13GC / mL, 8E+12GC / mL, 8E+11GC / mL, 8E+10GC / mL, and 8E+09GC / mL, respectively.
[0131] The composition of the reaction system is shown in Table 6:
[0132] Table 6 Reaction System
[0133]
[0134] Calculate three replicate wells for each sample, prepare the corresponding volume of mixture, divide 18 μL into each well, and then add 2 μL of sample to each well.
[0135] (3) SYBR Green qPCR conditions
[0136] Pre-denaturation: 95℃ for 10 min
[0137] Cycle: 40 cycles: 95℃ for 15 seconds; 60℃ for 1 minute.
[0138] After converting all titer test results into a multiple relationship with the control vector P5+RC+Helper, as follows: Figure 3As shown in the figure. The results indicate that, compared to the pRCHelper helper vector "P5+RC+Helper" driven by the P5 promoter alone, the "RC+Helper+P5" helper vector, which places the P5 promoter after RC+Helper, increases AAV yield by approximately 4.2 times. Furthermore, the "RC+Helper+DA'+P5" and "RC+DA'+Helper+P5" helper vectors, which add a DA' sequence, increase AAV yield by approximately 11.2 times and 5.2 times, respectively. The "Helper+RC+DA'+P5" helper vector, which changes the positions of RC and Helper, increases AAV yield by approximately 8 times. The "RC+P5+Helper" helper vector, which places the P5 promoter between RC and Helper, increases AAV yield by approximately 3.5 times. Furthermore, the "RC+DA'+P5+Helper" and "RC+P5+Helper+DA'" helper vectors, which add a DA' sequence, increase yield by approximately 7.8 times and 6.9 times, respectively. The auxiliary vectors “RC+DA'+Helper+DA'+P5” and “RC+DA'+P5+Helper+DA'+P5”, which add two DA' sequences, can increase the yield by approximately 9.8 times and 11 times, respectively. These results indicate that the auxiliary plasmids constructed in Example 1 of this invention have the effect of increasing rAAV virus yield.
[0139] The optimal version of the "RC+Helper+DA'+P5" helper vector constructed above was used to produce AAV with two and three plasmids respectively, along with the preferred example "RC+DA'+P5" packaging vector in CN115197967A. The titer results were converted to a fold relationship with the three-plasmid group as the control, as follows: Figure 4 As shown in the figure. The results indicate that the rAAV virus yield of the two-plasmid "RC+Helper+DA'+P5" helper vector is higher than that of the three-plasmid "RC+DA'+P5" packaging vector. That is, the titer of AAV produced by the two-plasmid method of the present invention can reach or even exceed the titer of AAV produced by the three-plasmid method. In the examples, a helper plasmid of a specific serotype (Rep2Cap9) was used. Those skilled in the art should understand that the present invention is not limited to this specific serotype, but can be implemented using helper plasmids of other serotypes that are currently known and may be discovered in the future.
[0140] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A helper plasmid for high-yield recombinant adeno-associated virus, characterized in that, It includes a backbone plasmid and a recombinant sequence; the recombinant sequence includes: Rep and Cap protein coding sequences, E2A, E4, and VA RNA sequences, and at least one promoter sequence; The promoter sequence is located downstream of the Rep and Cap protein coding sequences.
2. The auxiliary plasmid according to claim 1, characterized in that, The recombinant sequence also includes at least one DA' sequence.
3. The auxiliary plasmid according to claim 2, characterized in that, The DA' sequence is located downstream of the Rep and Cap protein coding sequences.
4. The auxiliary plasmid according to claim 2, characterized in that, The recombinant sequence, from 5' to 3', includes any of the following combinations of sequences: i. The Rep and Cap protein coding sequences, the E2A, E4, and VA RNA sequences, and the promoter sequence; ii. The Rep and Cap protein coding sequences, the E2A, E4, and VA RNA sequences, the DA' sequence, and the promoter sequence; iii. The E2A, E4, and VA RNA sequences, the Rep and Cap protein coding sequences, the DA' sequence, and the promoter sequence; iv. The Rep and Cap protein coding sequences, the promoter sequences, and the E2A, E4, and VA RNA sequences; v. The Rep and Cap protein coding sequences, the DA' sequence, the promoter sequence, and the E2A, E4, and VA RNA sequences; vi. The Rep and Cap protein coding sequences, the promoter sequence, the E2A, E4, and VA RNA sequences, and the DA' sequence; vii. The Rep and Cap protein coding sequences, the DA' sequence, the E2A, E4, and VA RNA sequences, and the promoter sequence; viii. The Rep and Cap protein coding sequences, the DA' sequence, the E2A, E4, and VA RNA sequences, the DA' sequence, and the promoter sequence; ix, the Rep, Cap protein coding sequence, the DA' sequence, the promoter sequence, the E2A, E4, VA RNA sequence, the DA' sequence, and the promoter sequence.
5. The auxiliary plasmid according to any one of claims 1-4, characterized in that, The promoter is the P5 promoter.
6. The auxiliary plasmid according to claim 5, characterized in that, The nucleotide sequence of the P5 promoter is shown in SEQ ID NO:
2.
7. The auxiliary plasmid according to any one of claims 1-4, characterized in that, The Rep is derived from adeno-associated virus type 2, and the Cap is derived from adeno-associated virus type 9.
8. The auxiliary plasmid according to claim 7, characterized in that, The nucleotide sequence of the Rep is shown in SEQ ID NO:
4.
9. The auxiliary plasmid according to claim 7, characterized in that, The nucleotide sequence of the Cap is shown in SEQ ID NO:
5.
10. The auxiliary plasmid according to any one of claims 1-4, characterized in that, The E2A, E4, and VA RNAs are derived from adenovirus.
11. The auxiliary plasmid according to claim 10, characterized in that, The nucleotide sequence of E2A is shown in SEQ ID NO: 6, the nucleotide sequence of E4 is shown in SEQ ID NO: 7, and the nucleotide sequence of VA RNA is shown in SEQ ID NO:
8.
12. A plasmid genome for high-yield recombinant adeno-associated virus, characterized in that, Includes the helper plasmid and AAV plasmid as described in any one of claims 1-11.
13. A high-yield production system for recombinant adeno-associated virus, characterized in that, It is obtained by transforming host cells with the plasmid group described in claim 12.
14. A method for producing high-yield recombinant adeno-associated virus, characterized in that, Produced using the production system described in claim 13.
15. The application of the auxiliary plasmids of claims 1-11, the plasmid group of claim 12, and the production system of claim 13 in AAV production.
Citation Information
Patent Citations
Auxiliary plasmid for preparing recombinant adeno-associated virus and application of auxiliary plasmid
CN115197967A
Plasmid free AAV vector producing cell lines
US20220025396A1
Compositions and methods for efficient AAV vector production
WO2001049829A1
Helper plasmid for preparing recombinant adeno-associated virus and application thereof
WO2022213745A1