KASP molecular marker primers related to upland cotton plant height character and application of KASP molecular marker primers
By developing KASP molecular marker primers associated with plant height in upland cotton and combining them with genome-wide association analysis, the problem of improving plant height in traditional cotton breeding was solved, achieving efficient and precise molecular marker-assisted breeding, and improving breeding efficiency and the speed of variety improvement.
Patent Information
- Application Number
- CN202610084307.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-22
- Publication Date
- 2026-04-03
AI Technical Summary
Traditional cotton breeding relies on phenotypic selection, which is greatly affected by environmental factors and makes it difficult to quickly improve the plant height of machine-harvested cotton varieties. Existing molecular markers such as SSR and RFLP have insufficient polymorphism or cumbersome detection procedures, and the application of KASP technology in improving cotton plant height traits is relatively limited.
A set of KASP molecular marker primers associated with plant height of upland cotton were developed. Combined with genome-wide association analysis, three SNP markers closely linked to key candidate sites for plant height and their corresponding molecular marker primers were developed. Genotypes can be directly determined by fluorescence signals, which is suitable for high-throughput sample screening.
It achieves precise location of key gene regions for plant height, has a high success rate in genotyping, shortens the breeding cycle, improves the breeding efficiency of machine-harvested cotton varieties, and is suitable for early precision selection.
Smart Images

Figure CN121780758A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular genetic breeding technology, specifically to a set of KASP molecular marker primers related to the plant height trait of upland cotton and their applications. Background Technology
[0002] cotton( Gossypium Cotton (spp.) is an important economic crop worldwide. Xinjiang, as China's largest cotton-producing region, accounts for over 80% of the country's planting area and over 90% of its output. With the increasing mechanization of cotton production, machine-harvested cotton has placed strict requirements on plant height—excessive plant height easily leads to lodging, while insufficient height affects biomass accumulation and yield. Developing cotton varieties with suitable plant height is key to achieving high and stable yields and mechanized harvesting.
[0003] Traditional cotton breeding relies on phenotypic selection, is highly susceptible to environmental factors, and has a long cycle, making it difficult to meet the needs of rapid improvement of machine-harvested cotton varieties. Molecular marker-assisted breeding technology can significantly improve breeding efficiency by screening early genotypes using molecular markers closely linked to the target trait. Currently, molecular markers used for cotton plant height research include SSR and RFLP, but they have significant limitations: SSR markers have suffered from reduced genomic diversity and insufficient polymorphism due to long-term artificial selection in upland cotton; RFLP marker detection procedures are cumbersome and have limited interpretability. SNP markers have the advantages of large numbers, wide distribution, and high detection throughput, while KASP (competitive allele-specific PCR) technology, as the mainstream SNP genotyping method, has the characteristics of high genotyping success rate and high accuracy, and has been widely used in crop breeding. However, the development of targeted markers for improving the plant height trait in upland cotton is still relatively scarce.
[0004] It should be noted that the information disclosed in the background section above is only used to enhance the understanding of the background of this disclosure, and therefore may include information that does not constitute prior art known to those skilled in the art. Summary of the Invention
[0005] The purpose of this invention is to provide a molecular marker primer that can identify the plant height trait of upland cotton, thus providing an effective means for the identification and improvement of the plant height trait of upland cotton.
[0006] To achieve the above objectives, this invention provides a set of KASP molecular marker primers related to the plant height trait of upland cotton. These primers are developed from SNP sites PH2, PH4, or PH5. The primer sequences for PH2 are shown in SEQ ID NO. 4, 5, and 6; the primer sequences for PH4 are shown in SEQ ID NO. 10, 11, and 12; and the primer sequences for PH5 are shown in SEQ ID NO. 13, 14, and 15.
[0007] The KASP molecular marker primers provided by this invention can be used in the preparation of kits for detecting and identifying plant height traits in upland cotton.
[0008] The present invention also provides a kit for detecting and identifying the plant height trait of upland cotton, the kit containing the above-mentioned KASP molecular marker primers.
[0009] The molecular marker primers or kits provided by this invention can be used in molecular marker-assisted breeding of upland cotton, especially for the detection and identification of plant height traits in upland cotton.
[0010] This invention also provides a method for identifying the plant height trait of upland cotton, comprising the following steps: S1. Extract genomic DNA from the upland cotton material to be tested; S2. Perform KASP amplification using the primers described above; S3. Determine plant height phenotype by fluorescence signal.
[0011] Preferably, the KASP amplification program in the above method is as follows: pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, annealing at 78℃ for 10 s, extension at 65℃ for 1 min, for a total of 10 cycles; denaturation at 94℃ for 20 s, annealing and extension at 57℃ for 1 min, for a total of 30 cycles. When the fluorescence signal of the detection result is a FAM fluorescence signal, it indicates that the upland cotton to be tested has a dwarf phenotype; when the fluorescence signal is a HEX fluorescence signal, it indicates that the upland cotton to be tested has a tall phenotype.
[0012] The present invention has the following advantages: This invention combines genome-wide association analysis (GWAS) with KASP technology to develop three SNP markers and corresponding molecular marker primers closely linked to the key candidate locus GhPH-D7 for plant height in upland cotton. These markers and primers offer the following advantages: First, they are highly specific, precisely locating in the region of the key plant height gene and showing a significant association with the plant height trait; second, they have high genotyping efficiency, achieving a 100% success rate, far superior to traditional SSR markers; third, they are easy to use, allowing direct genotyping via fluorescence signals, making them suitable for high-throughput sample screening; and fourth, they are highly practical, enabling precise selection in the early stages of breeding, shortening the breeding cycle, and improving the efficiency of machine-harvested cotton variety development.
[0013] The markers and marker primers provided by this invention offer an efficient tool for the molecular improvement of plant height traits in upland cotton, which is of great significance for promoting the mechanization and large-scale development of the cotton industry. Attached Figure Description
[0014] Figure 1 Location and genotyping of the KASP molecular marker at the SNP site PH7.
[0015] Figure 2The location and genotyping of the KASP molecular marker for the SNP site PH1.
[0016] Figure 3 Location and genotyping of the KASP molecular marker for the SNP site PH2.
[0017] Figure 4 The location and genotyping of the KASP molecular marker for the SNP site PH3.
[0018] Figure 5 Location and genotyping of the KASP molecular marker at the SNP site PH4.
[0019] Figure 6 Location and genotyping of the KASP molecular marker at the SNP site PH5.
[0020] Figure 7 The location and genotyping of the KASP molecular marker at the SNP site PH6.
[0021] Figure 8 The results of the identification of 15 cotton varieties using three developed KASP molecular marker primers are presented. Detailed Implementation
[0022] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0023] Note: Unless otherwise specified, the experimental methods in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0024] Example 1: Development of KASP molecular marker primers 1. Material selection and genomic DNA extraction 190 upland cotton natural population materials were selected and planted in experimental fields in Shihezi and Korla. The design was carried out at two locations over two years, with each material replicated twice. In each replicate, 10 plants were randomly selected to measure the plant height at the flowering and boll-forming stage.
[0025] Harvest 0.1 g of fresh, young leaves and place them in a 2 mL centrifuge tube. Add a steel ball and 200 µL of extraction buffer, grind for 60 s, then add 800 µL of preheated DNA lysis buffer and incubate at 65°C for 30 min. Add 800 µL of chloroform and extract for 20 min, then centrifuge at 11000 rpm for 10 min. Collect the supernatant, add an equal volume of isopropanol to precipitate the DNA, wash twice with 75% ethanol, dissolve in ddH2O, and dilute to 5–50 ng / μL. -1 spare.
[0026] 2. SNP site screening and primer design Based on the TM-1 genome sequence (Cottongen database, version WHU-TM1_v1) and genomic DNA resequencing data, seven SNP sites were screened in the 9879757-9882796 bp interval on chromosome D07, where the GhPH-D7 site is located, and designated as PH1-PH7. KASP primers were designed using online tools. The SNP Primer on the online website http: / / www.snpway.com:8339 / snpprimer was used to design KASP primers. The primer design met the following conditions: amplified fragment length 60-200 bp, Tm value 57-61℃ with a Tm difference of <1℃ between primers, and GC content 30%-80%. The SNP site information and the developed KASP primers are shown below.
[0027] PH1: Physical location Chr-D07-9879757, haplotype 1 is GG, haplotype 2 is TT, KASP primers include the following: PH1-Fp1 (SEQ ID NO.1): GAAGGTGACCAAGTTCATGCTGCTTAGTCCTTTTAAAAAAAACTGATAG, matching haplotype 1, containing FAM connector sequence; PH1-Fp2 (SEQ ID NO.2): GAAGGTCGGAGTCAACGGATTGCTTAGTCCTTTTAAAAAAAACTGATAT, matching haplotype 2, including HEX connector sequence; PH1-R (SEQ ID NO.3): CATAACTGTCCCCTAGTCAACTGTT.
[0028] PH2: Physical location Chr-D07-9879835, haplotype 1 is TT, haplotype 2 is CC, KASP primers include the following: PH2-Fp1 (SEQ ID NO.4): GAAGGTGACCAAGTTCATGCTTTTCAGTGTTTGAGTTAAACTGAAATT, matching haplotype 1, containing FAM connector sequence; PH2-Fp2 (SEQ ID NO.5): GAAGGTCGGAGTCAACGGATTTTTCAGTGTTTGAGTTAAACTGAAATC, matching haplotype 2, including HEX connector sequence; PH2-R (SEQ ID NO.6): GTAAGGAGTGAGTATAGCTGGCTTC.
[0029] PH3: Physical location Chr-D07-9880393, haplotype 1 is CC, haplotype 2 is TT, KASP primers include the following: PH3-Fp1 (SEQ ID NO.7): GAAGGTGACCAAGTTCATGCTGCCATTTGAAAAATTTGACCG, matching haplotype 1, including FAM connector sequence; PH3-Fp2 (SEQ ID NO.8): GAAGGTCGGAGTCAACGGATTGCCATTTGAAAAATTTGACCA, matching haplotype 2, including HEX connector sequence; PH3-R (SEQ ID NO.9): ATGAACACGTCTCTGCTAACCTG.
[0030] PH4: Physical location Chr-D07-9882052, haplotype 1 is AA, haplotype 2 is GG, KASP primers include the following: PH4-Fp1 (SEQ ID NO.10): GAAGGTGACCAAGTTCATGCTTTTTTTAAGGGTAAACTATATGAGTAGCTAT, Matching haplotype 1, containing FAM connector sequence; PH4-Fp2 (SEQ ID NO.11): GAAGGTCGGAGTCAACGGATTTTTTTTAAGGGTAAACTATATGAGTAGCTAC, matching haplotype 2, including HEX connector sequence; PH4-R (SEQ ID NO.12): CAATTTTGTCTTTTTTGGTCACTAGA.
[0031] PH5: Physical location Chr-D07-9882796, haplotype 1 is GG, haplotype 2 is AA, KASP primers include the following: PH5-Fp1 (SEQ ID NO.13): GAAGGTGACCAAGTTCATGCTCCGCTTTCAAATTATATATAACCACG, matching haplotype 1, including FAM connector sequence; PH5-Fp2 (SEQ ID NO.14): GAAGGTCGGAGTCAACGGATTCCGCTTTCAAATTATATATAACCACA, matching haplotype 2, including HEX connector sequence; PH5-R (SEQ ID NO.15): CAAATAGTTAATATCATTAGCTTTTCAATTT.
[0032] PH6: Physical location Chr-D07-9881623, haplotype 1 is GG, haplotype 2 is AA, KASP primers include the following: PH6-Fp1 (SEQ ID NO.16): GAAGGTGACCAAGTTCATGCTGATTTCGGGTTCGAGGTTTTAG, matching haplotype 1, including FAM connector sequence; PH6-Fp2 (SEQ ID NO.17): GAAGGTCGGAGTCAACGGATTGATTTCGGGTTCGAGGTTTTAA, matching haplotype 2, including HEX connector sequence; PH6-R (SEQ ID NO.18): TAGACTACCAGGAAGAACAGCAAAC.
[0033] PH7: Physical location Chr20-9882350, haplotype 1 is TC TC, haplotype 2 is TT, KASP primers include the following: PH7-Fp1 (SEQ ID NO.19): GAAGGTGACCAAGTTCATGCTAATATTTTATTTAGATAATTGCTCCCC, Matching haplotype 1, including FAM connector sequence; PH7-Fp2 (SEQ ID NO.20): GAAGGTCGGAGTCAACGGATTCTAATATTTTATTTAGATAATTGCTCCCT, matching haplotype 2, including HEX connector sequence; PH7-R (SEQ ID NO.21): GATACAAACAAATAAACAACTTAGGGA.
[0034] Example 2: Genotyping and Association Verification of KASP Molecular Marker Primers Using 190 natural populations of upland cotton as the research subjects, KASP amplification was performed on the extracted genomic DNA using the developed primers. Three negative controls (ddH2O replaced DNA) were set up for each marker. The PCR reaction system was 10 μL, including 2.5 μL of 2×KASP MIX and 10 μmol·L⁻¹. -1 The first forward primer was 0.075 μL, 10 μmol·L⁻¹. -1 The second forward primer (0.075 μL), reverse primer (0.2 μL), and genomic DNA (2 μL) were used, with the remainder being ddH2O. The amplification program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 78℃ annealing for 10 s, and 65℃ extension for 1 min, for a total of 10 cycles; 94℃ denaturation for 20 s, 57℃ annealing and extension for 1 min, for a total of 30 cycles. After PCR amplification, fluorescence signals were read using a real-time PCR instrument at temperatures below 40℃. Alleles were distinguished by FAM and HEX fluorescence signals, and ROX dye was used to correct for signal differences between wells.
[0035] After PCR, fluorescence signals were read using a real-time PCR instrument, and the genotypes of each material were determined by fluorescence signal typing. The amplification and analysis results of the KASP primers developed based on the seven SNP loci are shown below. Figures 1-7 As shown, A represents the physical location of each SNP locus on the chromosome; B represents the genotyping results of primers developed based on each SNP locus, where FAM fluorescence signal (blue dots in the genotyping diagram) indicates the genotype corresponding to the dwarf phenotype detected only; HEX fluorescence signal (red dots in the genotyping diagram) indicates the genotype corresponding to the tall phenotype detected only; gray dots represent negative controls; C represents the genotypic and phenotypic significance analysis results for each SNP locus. The results show that 6 out of 7 markers could be successfully genotyped (genotyping success rate 85.7%), while the PH7 marker primer could not complete the genotyping (see [link to relevant documentation]). Figure 1Furthermore, combining plant height phenotypic data from two locations over two years (Shihezi and Korla) (measured at the flowering and boll-forming stage, distance from cotyledon node to the top of the main stem), an association analysis was performed on the gene data of PH1-PH6. F-test and t-test analyses revealed a significant phenotypic association between the genotypes of PH1-PH5 and plant height (see [link to relevant documentation]). Figure 2-6 ), while no significant association was detected with PH6 (see Figure 7 Therefore, a total of 5 SNP sites and KASP molecular marker primer sets that were significantly associated with plant height (P<0.05) were screened out, namely PH1, PH2, PH3, PH4 and PH5.
[0036] Application example: Variety identification using KASP molecular marker primers Fifteen cotton experimental materials were selected, namely J206-5, Ganmian 215, Zhongmian N828, ZhongMB703, Xinshi K37, Xinchang 437, Huaxin 103, Xintamian 102, Xintamian 11, Yuanmian 5, Xinken M2061, Zheda 19, Zhongshengmian 16, MCR3915, and Tahe 2. Genotyping was performed using five KASP molecular marker primers selected above. The genotyping verification results are shown below. Figure 8 As shown, the results indicate that the PH2, PH4, and PH5 markers are stable and can be used as effective molecular markers for association analysis of plant height. Among the 15 varieties tested, the dominant haplotypes for plant height were J206-5, Ganmian 215, Zhongmian N828, ZhongMB703, Xinshi K437, Huaxin 103, Xintamian 11, Yuanmian 5, Xinkenmian 2061, Zheda 19, and Tahe 2, exhibiting a short plant height phenotype. Xinchang 437, Xintamian 102, Zhongshengmian 16, and MCR3915 exhibited a tall plant height phenotype. This suggests that J206-5 and Ganmian 215... In subsequent genetic improvement of upland cotton varieties such as Zhongmian N828, ZhongMB703, Xinshi K437, Huaxin 103, Xinta Mian 11, Yuanmian 5, Xinken Mian 2061, Zheda 19, and Tahe 2, molecular marker-assisted selection for plant height traits can be performed using three developed KASP markers: the TT genotype of PH2, the AA genotype of PH4, and the GG genotype of PH5. Identification with these genotypes indicates a dwarf plant height phenotype. These molecular markers and their primers can be used for screening and identifying plant height phenotypes in upland cotton, demonstrating their application value in assisted breeding.
[0037] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above. Therefore, the scope of protection of the present invention should be defined by the appended claims.
Claims
1. A set of KASP molecular marker primers associated with the plant height trait of upland cotton, characterized in that, The primers are developed from SNP sites PH2, PH4, or PH5. The primer sequences for PH2 are shown in SEQ ID NO.4, 5, and 6; the primer sequences for PH4 are shown in SEQ ID NO.10, 11, and 12; and the primer sequences for PH5 are shown in SEQ ID NO.13, 14, and 15.
2. The application of the KASP molecular marker primers as described in claim 1 in the preparation of a kit for detecting and identifying the plant height trait of upland cotton.
3. A kit for detecting and identifying the plant height trait of upland cotton, characterized in that, The kit contains the KASP molecular marker primers as described in claim 1.
4. The application of the molecular marker primers as described in claim 1 or the kit as described in claim 3 in molecular marker-assisted breeding of upland cotton.
5. The application according to claim 4, characterized in that, The application includes the detection and identification of plant height traits in upland cotton.
6. A method for identifying the plant height trait of upland cotton, characterized in that, Includes the following steps: S1. Extract genomic DNA from the upland cotton material to be tested; S2. Perform KASP amplification using the primers described in claim 1 or the kit described in claim 3; S3. Determine plant height phenotype by fluorescence signal.
7. The method according to claim 6, characterized in that, The KASP amplification program is as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 78℃ annealing for 10 s, 65℃ extension for 1 min, for a total of 10 cycles; 94℃ denaturation for 20 s, 57℃ annealing extension for 1 min, for a total of 30 cycles.
8. The method according to claim 6, characterized in that, When the fluorescence signal is FAM fluorescence signal, it indicates that the upland cotton to be tested has a short-stemmed phenotype; when the fluorescence signal is HEX fluorescence signal, it indicates that the upland cotton to be tested has a tall-stemmed phenotype.