M2 type macrophage affinity peptide as well as preparation and application thereof

Abstract

The invention belongs to the field of biological medicines, and particularly relates to affinity peptides targeting CD47 and M2 type macrophages. The amino acid sequence of the M2 type macrophage targeting peptide is as shown in SEQ ID NO: 2. The invention also relates to preparation and application of the protein. The preparation comprises the following steps: forming a dual-targeting peptide and a transmembrane fusion protein; the molecules are expressed and synthesized by using nucleic acid molecules, and particularly a polypeptide expression and nano delivery system based on an engineered cell membrane is designed. The molecule provided by the invention can be compatible with CD47 and M2 type macrophage affinity peptide, and after a nano-carrier is designed to be combined with an STING agonist, M2 type macrophages are reprogrammed, so that the anti-tumor immune response is further enhanced.

Description

Technical Background

[0001] Tumor immunotherapy, which activates the body's own immune system to kill tumor cells, has made significant progress in recent years, including strategies such as immune checkpoint inhibitors, CAR-T cell therapy, tumor vaccines, and immune enhancers. These methods have demonstrated good efficacy in various cancers by enhancing the immune system's anti-tumor capabilities.

[0002] Tumor-associated macrophages (TAMs) are an important component of the tumor microenvironment and can be divided into pro-inflammatory M1 macrophages and anti-inflammatory M2 macrophages. M1 macrophages engulf tumor cells by secreting antimicrobial molecules and pro-inflammatory cytokines, while M2 macrophages promote tumor development, progression, and distant metastasis through various mechanisms. Among strategies for regulating TAMs, inhibiting macrophage recruitment and promoting macrophage apoptosis can effectively suppress tumor growth; however, discontinuing drug administration promotes an increase in the number of M2 macrophages, tumor angiogenesis, and accelerates death in tumor-bearing mice. Studies have shown that blocking CD47 / SIRPα interaction and reprogramming M2 macrophages to regulate TAMs can enhance anti-tumor effects and demonstrate promising potential.

[0003] Activation of the cyclic guanosine monophosphate-adenosine synthase and interferon gene-stimulating factor (cGAS-STING) signaling pathway in tumor cells upregulates type I IFN or other inflammatory genes, thereby inhibiting the occurrence and development of early tumors. The antitumor effects of STING agonists have been confirmed, but their drawbacks, such as lack of targeting, poor cell membrane penetration, low bioavailability, and high toxicity, remain unresolved. Metal-organic frameworks (MOFs), due to their ultra-high specific surface area, porosity, and flexible modifiability, provide an ideal platform for drug delivery research, especially suitable for the efficient adsorption and delivery of STING agonists.

[0004] The applicant has conducted extensive research on affinity peptides targeting CD47 and M2 macrophages. It is possible to construct a drug delivery system carrying STING agonists by recombining the above peptides to exert a synergistic anti-tumor effect. Engineered cell membranes have broad application prospects and can be used to construct vectors for delivering related drugs. However, constructing a reliable system requires much exploration. For example, tandem peptide expression systems need to continuously optimize their base sequences using recombinant DNA and gene editing technologies. It is necessary to select suitable expression vectors and host cells to facilitate the screening of host cells containing expression vectors and the correct expression of peptides. At the same time, sufficient in vitro cell experiments and in vivo animal model experiments are required to study the drug delivery effect. Summary of the Invention

[0005] In view of this, the applicant has invented an affinity peptide that targets CD47 and M2 macrophages, providing a polypeptide expression system that can be expressed on various cell membranes to prepare engineered cell membranes, and simultaneously targets CD47-positive tumor cells and M2 macrophages. This invention designs and optimizes the polypeptide coupling sequence, translates the amino acid sequence of the polypeptide into a base sequence according to the genetic codon preference, and specifically optimizes the base sequence, so that it can be expressed on the desired cell membrane through plasmid transfection; this invention also provides a drug delivery system that also carries a STING agonist.

[0006] Specifically, the present invention includes the following aspects: Firstly, this invention screens for affinity peptides for CD47. Previous studies of this invention screened for peptide inhibitors in high-throughput phage display libraries for CD47 and identified affinity peptides through in vitro affinity and blocking experiments.

[0007] The amino acid sequence of the CD47 affinity peptide selected in this invention is shown in SEQ ID NO:1. The configuration of each amino acid of the CD47 peptide can be L-type or the amino acid sequence of the head fragment of the peptide can be aWSATWSNYWRh, aWSATWSNYWrh, awsATWSNYwrh or aWSATWSNYwrh, for example, the peptide is aWSATWSNYwrhPLG. In this field, lowercase letters represent the corresponding amino acid as D-type. Unless otherwise specified, the configuration of each amino acid in this article is L-type (although glycine is not divided into D and L types, in order to simplify the description of the configuration of each amino acid, this patent also arbitrarily defines glycine as D-type or L-type).

[0008] The peptides selected in this invention can significantly enhance the phagocytosis and clearance of tumor cells by macrophages, effectively inhibit tumor growth, and enhance CD8. + T cell-mediated anti-tumor response.

[0009] Secondly, the present invention screens for targeting peptides targeting M2 macrophages. Preferably, the amino acid sequence of the peptide used is shown in SEQ ID NO:2.

[0010] Thirdly, the present invention provides a dual-targeting peptide that connects the above-mentioned peptide segments, wherein the N-terminal fragment is a CD47 affinity peptide of the first aspect and the C-terminus is fused with an M2 macrophage targeting peptide of the second aspect, that is, the CD47 affinity peptide and the M2 macrophage targeting peptide are fused together, and the CD47 affinity peptide is set as the head sequence of the dual-targeting peptide, which is fused in the art without affecting the activity of the linked active peptide (here referring to the CD47 affinity peptide).

[0011] An example of the dual-targeting peptide is that the C-terminus of the CD47 affinity peptide is directly linked to the N-terminus of the M2 macrophage targeting peptide by forming a peptide bond, i.e., the amino acid sequence is AWSATWSNYWRHPLGLAG YEQDPWGVKWWY (the first 1-6 amino acids of the head fragment can be D-type). This dual-targeting peptide can be cleaved by matrix metalloproteinases in tumor tissue into two peptide segments with sequences SEQ ID NO:1 and SEQ ID NO:2, respectively. These two fragmented derivative peptides can still exert their targeting effects, targeting CD47-positive tumor cells (the affinity peptide of sequence 1 exerts its effect) and M2 macrophages (the peptide of sequence 2 exerts its effect), respectively.

[0012] Fourthly, for the purpose of carrying any of the peptides described in the prior aspects using a biological membrane, the present invention provides a transmembrane fusion protein formed by carrying any of the peptides described in the prior aspects using a membrane protein. The membrane protein can be an external membrane protein, an internal membrane protein, or a lipid-anchored protein, or a functional transmembrane and intracellular region fragment thereof, such as a transmembrane and intracellular region fragment of the Gi24 protein. The Gi24 protein is the platelet receptor, also known as B7-H5 and stress-induced secretory protein-1 (Sisp-1). The Gi24 transmembrane and intracellular region fragment used in the present invention can be a transmembrane and intracellular protein composed of 36 amino acids, and the sequence can be as shown in SEQ ID NO:3. The encoded base sequence can be 108 bp long, and the sequence can be as shown in SEQ ID NO:6. Specifically, it can be derived from the pEGFP-N1-PD1 vector of Wang Shengdian's laboratory at the Institute of Biophysics, Chinese Academy of Sciences.

[0013] The membrane protein can be coupled to the peptide via a flexible linker. In the art, a flexible linker is a linker that does not affect the activity of the coupled peptide. It is usually a peptide, such as (GGGS)nC, (GGGGS)n, (GGSC)n or (GGG)n, where n=1-10.

[0014] Optionally, the tail of the transmembrane fusion protein is provided with a His tag for detecting whether the peptide expression system has been successfully expressed. The His tag is preferably 10 His amino acids, and its encoding base sequence is preferably CACCATCACCACCATCATCACCACCATCAC.

[0015] Optionally, the transmembrane fusion protein may further include a signal peptide at the N-segment of the peptide in any prior aspect to guide the membrane localization of the core peptide of the present invention. The two may be directly fused without a linker. The signal peptide may be a Murine IL-2 signal peptide, and its amino acid sequence may be MYSMQLASCVTLTLVLLVNS, preferably its base sequence is ATGTACAGCATGCAGCTCGCATCCTGTGTCACATTGACACTTGTGCTCCTTGTCAACAGC.

[0016] Fifthly, the present invention provides a nucleic acid molecule containing a sequence encoding any of the molecules described in the prior aspects, such as the SEQ ID NO:4 sequence encoding a CD47 affinity peptide, the SEQ ID NO:5 sequence encoding an M2 macrophage targeting peptide, the SEQ ID NO:6 sequence encoding the Gi24 transmembrane region and intracellular region, the gene sequence GGGGGTGGAGGCTCT encoding a linker, the gene sequence CACCATCACCACCATCATCACCACCATCAC encoding a His tag, and the gene sequence ATGTACAGCATGCAGCTCGCATCCTGTGTCACATTGACACTTGTGCTCCTTGTCAACAGC encoding a signal peptide.

[0017] Sixthly, the present invention provides a plasmid vector for the above-mentioned nucleic acid molecules. To construct the plasmid vector of the present invention, a KozaK sequence and a stop codon TAA can be tandemly connected to the 5' end of the CD47 affinity peptide encoding gene and the 3' end of the M2 macrophage targeting peptide encoding gene, respectively. For ease of connection, Xho I and EcoR can be tandemly connected to the 5' end of the CD47 affinity peptide encoding gene and the 3' end of the M2 macrophage targeting peptide encoding gene. I. Restriction enzyme sites are used to obtain the tandem sequence of bases required for constructing the plasmid vector, specifically: CTCGAG-GCCACC-ATGTACAGCATGCAGCTCGCATCCTGTGTCACATTGACACTTGTGCTCCTTGTCAACAGC-GCCTGGTCAGCAACTTGGAGCAATTACTGGAGGCACCCCTTGGGACTCGCCGGCTACGAGCAGGACCCCTGGGGAGTCAAATGGTGGTAC-GGGGGTGGAGGCTCT-GATCCCATCAGGGCTGCAGCCCTGGCTACGGGTGCCTGCATCGTAGGAATCCTCTGCCTCCCCCTCATCCTGCTCCTGGTCTACAAGCAAAGGCAGGCAGCAGATCCACACCATCACCACCATCATCACCACCATCAC-TAA-GAATTC; the plasmid backbone can be... pLVX- puro .

[0018] Preferably, the base tandem sequence described in the sixth aspect is restricted using Xho I and EcoRI restriction enzymes. pLVX-puro The plasmid was double-digested and ligated to obtain a polypeptide expression plasmid vector.

[0019] In a seventh aspect, the present invention provides a method for preparing any of the peptides described in the prior aspect, or the transmembrane fusion protein described in the fourth aspect, comprising amino acid expression using any of the nucleic acid molecules described in the fifth aspect or the plasmid vector or base tandem sequence described in the sixth aspect, and / or solid-phase synthesis.

[0020] Eighthly, the present invention provides a drug-carrying nanocarrier comprising a biomembrane carrying any of the peptides described in the prior aspects or the transmembrane fusion protein described in the fourth aspect. If the biomembrane is an engineered cell membrane, the cell membrane may be derived from M1 macrophages. As an example, the present invention transfects plasmids into RAW264.7 cells, i.e. mouse monocytes and macrophages, by using lentivirus packaging. After successful peptide expression is detected by confocal microscopy, flow cytometry and western blot, the cells are treated with 50 ng / mL IFN-γ and 100 ng / mL LPS for 24 h to induce M1 macrophages. The cell membrane is extracted using a cell membrane extraction kit to obtain an engineered M1 macrophage membrane (PMM) expressing the dual-targeting peptides described in the present invention.

[0021] The engineered cell membrane constructed in this invention highly expresses the dual-targeting peptide described in this invention. After entering tumor tissue, the dual-targeting peptide is cleaved by matrix metalloproteinase 2, releasing the CD47 targeting peptide, which actively targets the highly expressed CD47 on tumor cells and blocks the CD47 / SIRPα pathway, restoring the phagocytic function of macrophages. At the same time, the M2 macrophage targeting peptide is exposed and specifically targets M2 macrophages.

[0022] In this embodiment, the present invention utilizes engineered M1 macrophage membranes to construct nanocarriers.

[0023] Preferably, the drug-carrying nanocarrier of the present invention is further provided with a delivery material for a second active molecule, which can be selected from MOF metal-organic frameworks, such as ZrMOF metal-organic frameworks; the delivery material can be encapsulated by a biological membrane.

[0024] In a ninth aspect, the present invention provides a drug delivery system using the above-described nanocarrier, the system being loaded with a second active molecule, a STING agonist, such as 2',3'-cGAMP, which is referred to as ZrMOF / C when loaded with a ZrMOF metal-organic framework.

[0025] Preferably, the present invention utilizes a metal-organic framework (ZrMOF / C) loaded with a STING agonist and an engineered cell membrane (PPM) to construct a nanocarrier, specifically involving the co-extrusion of PMM and ZrMOF / C to prepare a nanocarrier (ZrMOF / C@PMM) encapsulated by an engineered M1 macrophage membrane.

[0026] In a tenth aspect, the present invention provides a pharmaceutical composition or kit comprising any of the molecules described in the prior aspects.

[0027] Furthermore, the present invention discloses that the molecule is used for at least one of the following purposes: 1) It has an affinity for CD47 molecules highly expressed by tumor cells. CD47 is an important inhibitory signaling molecule for phagocytosis, thereby targeting and blocking the CD47 / Sirpα pathway. 2) Used in vitro and in vivo to target CD47 molecules to enhance the immune response induced by antigens, including in combination with other drugs and radiotherapy techniques; 3) Used to target M2 macrophages in tumor tissue; 4) Used for in vitro and in vivo delivery of various antigens; 5) Used for in vitro and in vivo delivery of various drugs, such as the combination therapy with STING agonists as demonstrated in this invention, to exert a synergistic therapeutic effect.

[0028] 6) Used for anti-tumor purposes, including solid tumors such as breast tumors and colorectal tumors.

[0029] 7) Treatment of autoimmune diseases; Beneficial effects of this invention: This invention designs a peptide expression system that expresses dual-targeting peptides specifically targeting tumor cells and M2 macrophages. The system expresses high-affinity dual-targeting peptides on engineered cell membranes, which are cleaved upon entering tumor tissue to yield derived peptides. These derived peptides successfully block the CD47 / SIRPα pathway, relieving the signal that inhibits macrophage phagocytosis. Simultaneously, a nanocarrier combined with a STING agonist is designed to mediate the phagocytosis of the nanocarrier by M2 macrophages through targeted action, activating the STING signaling pathway. This synergistically reprograms M2 macrophages with engineered M1 macrophage membranes, further enhancing the anti-tumor immune response and providing a synergistic therapeutic effect when combined with radiotherapy. This invention exhibits high targeting, stability, and biocompatibility, significantly enhancing the efficacy of tumor immunotherapy, particularly suitable for treating various solid tumors, and possesses broad clinical application potential, promising to provide cancer patients with more precise and effective treatment options. Attached Figure Description

[0030] Figure 1 This is a schematic diagram of a polypeptide expression system. The signal peptide in the diagram is the aforementioned Murine IL-2 fragment, G4S is the linker GGGGS, and the transmembrane and intracellular sequences are shown in SEQ ID NO:3. The histidine tag consists of 10 His amino acids. Figure 2 Example figure showing the results of in vitro CD47 targeting experiments of PMM and its encapsulated nanocarriers in the 4T1 cell line; Figure 3 Example figure showing the results of in vitro CD47 targeting experiments of PMM and its encapsulated nanocarriers in CT26 cell line; Figure 4 Example figure of in vitro experimental results (IL-6) showing the activation of STING signaling by PMM and its encapsulated nanocarrier in M2 macrophages. Figure 5 Example of in vitro experimental results (TNF-α) of reprogramming M2 macrophages using PMM and its encapsulated nanocarrier. Figure 6 Figure showing the results of in vivo targeting experiments using PMM-encapsulated nanocarriers; Figure 7 The image shows the anti-tumor growth results of PMM and its encapsulated nanocarriers in the CT26 xenograft model. Figure 8 Figure showing the anti-tumor metastasis results of PMM and its encapsulated nanocarriers in the 4T1 orthotopic lung metastasis model; The significance analysis markers in each figure are indicated by *. P <0.05, ** indicates P <0.01, *** indicates P <0.001. Detailed Implementation

[0031] The embodiments of the present invention will be described in detail below with reference to the examples. However, the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention.

[0032] Unless otherwise specified, the reagents, biological materials, culture media and solutions used below are all commonly used items in the field, available to the public or commercially available.

[0033] 1. Construction and expression of a dual-targeting peptide expression system: a) The optimized sequence of the dual-targeting peptide is AWSATWSNYWRHPLGLAG YEQDPWGVKWWY; b) Based on genetic codon bias, the amino acid sequence of the peptide is translated into a base sequence and optimized, and the peptide expression system is designed as follows: Figure 1As shown—the essential regulatory elements for membrane protein expression, whether or not through the GGGGS linker, are tandemly linked: signal peptide, transmembrane and intracellular regions, KozaK sequence, stop codon, Xho I and EcoRI restriction enzyme sites, etc. The specific DNA base sequence after tandem linking is: CTCGAG-GCCACC-ATGTACAGCATGCAGCTCGCATCCTGTGTCACATTGACACTTGTGCTCCTTGTCAACAGC-GCCTGGTCAGCAACTTGGAGCAATTACTGGAGGCACCCCTTGGGACTCGCCGCTACGAGCAGGACCCCTGGGGAGTCAAATGGTGGTAC-GGGGGTGGAGGCTCT-GATCCCATCAGGGCTGCAGCCCTGGCTACGGGTGCCTGCATCGTAGGAATCCTCTGCCTCCCCCTCATCCTGCTCCTGGTCTACAAGCAAAGGCAGGCAGGCAGCAGATCCACACCATCACCACCATCATCACCACCATCAC-TAA-GAATTC, after Xho... I and EcoRI restriction enzyme double digestion clone into pLVX-puro Plasmid, obtain the target plasmid; c) The obtained target plasmid was packaged into a lentivirus. The cell line used was the human kidney epithelial cell line HEK-293-T, and the helper plasmid was... psPAX2 plasmids and pMD2.G Plasmids, used to assist in transfection of the target plasmid; d) Transfect the target plasmid packaged with lentivirus into RAW264.7 mouse monocytes / macrophages; e) Confocal, flow cytometry, and Western blot analysis were used to determine whether the peptide system was successfully expressed.

[0034] Experimental results show that the polypeptide expression sequence is as follows: Figure 1 As shown, after transfecting the plasmid into RAW264.7 cells, His... 10 Tag, flow cytometry, confocal microscopy, and Western blot results showed that the dual-targeting peptide was successfully expressed on the cell membrane, proving that the peptide expression system was successfully used.

[0035] 2. Construction of nanocarriers: a) RAW264.7 cell lines expressing dual-targeting peptides from Experiment 1 above were induced to become M1 macrophages by treating them with 50 ng / mL interferon-gamma (IFN-γ) and 100 ng / mL lipopolysaccharide (LPS) for 24 h. The cell membranes of the M1 macrophages carrying the dual-targeting peptides were extracted using a cell membrane extraction kit to obtain engineered M1 macrophage membranes (PMM). (b) ZrOCl2, H2TCPP, and benzoic acid (BA) were dissolved in DMF to synthesize a metal-organic framework (ZrMOF). ZrMOF was then used to adsorb the STING agonist 2',3'-cGAMP, resulting in a STING agonist-loaded metal-organic framework (ZrMOF / C). The encapsulation efficiency and drug loading of the STING agonist 2',3'-cGAMP were measured. High-performance liquid chromatography (HPLC) results showed that ZrMOF exhibited high encapsulation efficiency for 2',3'-cGAMP at mass ratios of 50:1, 100:1, and 200:1. Considering the relationship between encapsulation efficiency and drug loading, this invention ultimately selected a mass ratio of ZrMOF:2',3'-cGAMP = 50:1 for the preparation of the nanocarrier.

[0036] c) PMM and ZrMOF / C were co-extruded to prepare engineered M1 macrophage membrane-encapsulated nanocarriers (ZrMOF / C@PMM).

[0037] d) To better detect the targeting activity of the PMM-engineered cell membrane constructed by the peptide expression system, this invention also constructed experimental control groups compared to ZrMOF / C@PMM: a drug-loaded nanocarrier encapsulated only by the original M1 macrophage membrane that was not engineered (not transferred into the dual-targeting peptide expression system) (ZrMOF / C@RAW), and a nanocarrier encapsulated by ZrMOF in an engineered M1 macrophage membrane that was not loaded with STING agonist (ZrMOF@PMM).

[0038] d) Characterize the potential, particle size, stability, cell membrane integrity, matrix metalloproteinase MMP2 enzyme responsiveness, and morphology of the nanocarrier to ensure successful preparation of the nanocarrier.

[0039] Experimental results showed that the hydrodynamic particle sizes of ZrMOF / C and ZrMOF / C@PMM were 190.6 ± 1.87 nm and 205.5 ± 1.46 nm, respectively, and their hydrodynamic potentials were 16.34 ± 0.88 mV and -18.4 ± 0.2 mV, respectively. ZrMOF / C contains four elements: N, O, P, and Zr, indicating that ZrMOF successfully adsorbed 2', 3'-cGAMP. SDS-PAGE gel analysis showed that the protein bands in the cell lysate and the nanocarrier were identical, indicating that the integrity of cell membrane proteins could be maintained during the nanocarrier preparation process. ZrMOF / C@PMM exhibited a good response to matrix metalloproteinase MMP2, and its surface dual-targeting peptides could be cleaved by MMP2 into two peptide segments, SEQ ID NO:1 and SEQ ID NO:2 (i.e., the two affinity peptides described in this invention). Transmission electron microscopy results showed that ZrMOF / C@PMM exhibited a distinct core-shell structure. ZrMOF / C@PMM remained stable for 4 days in PBS (phosphate-buffered saline, pH 7.2), while ZrMOF / C remained stable for only 2 days, indicating that cell membrane encapsulation increases the stability of the vector. A series of characterizations demonstrates the successful construction of ZrMOF / C@PMM, which can be used for subsequent activity validation.

[0040] 3. In vitro CD47 affinity assay: a) Obtain mouse bone marrow cells and adjust the cell density to 1×10⁻⁶. 6 Add 20 ng / mL of mouse macrophage colony-stimulating factor M-CSF to cells / mL; b) After 3 days, change half of the medium, discard the non-adherent cells, and add the corresponding concentration of the above-mentioned cytokines. After culturing for 7 days, use the culture for experiments. c) 4×10 5 The mouse breast cancer cell line 4T1 and the mouse colon cancer cell line CT26 were co-incubated with PBS or fluorescently labeled nanocarriers for 30 mins. The PBS phosphate buffer treatment group served as a blank control group. After co-incubation, the cells were collected and observed by flow cytometry and confocal microscopy.

[0041] Flow cytometry and confocal microscopy results revealed that the fluorescence signals of the two tumor cell lines treated with PMM (including ZrMOF / C@PMM and ZrMOF@PMM) were significantly higher than those of other treatment groups. This indicates that the engineered cell membrane PMM can target the highly expressed CD47 on the tumor cell membrane through externally exposed CD47 affinity peptides, blocking the CD47 / SIRPα immune escape pathway of tumor cells, restoring macrophage phagocytic function, and simultaneously demonstrating the successful expression of the polypeptide expression system designed in this invention. The flow cytometry results for the 4T1 cell line are as follows... Figure 2 As shown, the CT26 cell line... Figure 3 As shown.

[0042] 4. In vitro M2 macrophage targeting and activity assays: a) The macrophages expressing PMM were first co-incubated with matrix metalloproteinase MMP2 at 37°C for 3 h to cleave the CD47 affinity peptide. The cell membranes were then used for nanocarrier preparation (although the affinity peptide was partially cleaved, for consistency, the experimental groups with ZrMOF-coated membranes were still referred to as ZrMOF / C@PMM and ZrMOF@PMM, as in other experiments in this paper); 5 × 10 5 M2 macrophages were co-incubated with 100 μg / mL nanocarriers for each group (with PBS and 2', 3'-cGAMP control groups also included), and the activity of each group was detected.

[0043] b) qRT-PCR was used to detect the expression levels of interferon-β (IFN-β), interleukin-6 (IL-6), chemokine ligand 10 (CXCL10), interleukin-12 (IL-12), tumor necrosis factor-α (TNF-α), inducible nitric oxide synthase (iNOS), and leukocyte differentiation antigen 86 (CD86) mRNA levels, and to analyze the activation status of the STING signaling pathway and the reprogramming efficiency of M2 macrophages.

[0044] The experimental results show that: qRT-PCR results showed that IFN-β levels in the ZrMOF / C@PMM treatment group were upregulated by 11.9-fold, 12.9-fold, and 2.4-fold compared to the ZrMOF / C, ZrMOF / C@RAW, and 2', 3'-cGAMP groups, respectively. CXCL10 levels were upregulated by 38.1-fold, 91.9-fold, and 71.3-fold, respectively. IL-6 levels were upregulated by 82.7-fold, 114.8-fold, and 140.6-fold, respectively. These results indicate that ZrMOF / C@PMM can effectively target M2 macrophages and efficiently activate the STING signaling pathway in M2 macrophages. The results using IL-6 as an example are shown in the figure below. Figure 4 As shown in the figure. Furthermore, ZrMOF / C@PMM significantly upregulated the expression levels of TNF-α, iNOS, IL-12, and CD86 mRNA, indicating that ZrMOF / C@PMM can effectively target M2 macrophages and reprogram them into M1 macrophages. The results using TNF-α as an example are shown in the figure below. Figure 5 As shown above, the results also effectively demonstrate that the dual-targeting peptide described in this invention can be cleaved by matrix metalloproteinase MMP2 to expose the M2-targeting peptide, and that the M2-targeting peptide involved in this invention has highly efficient targeting.

[0045] 5. In vivo targeted experiments: a) 2×10 5CT26 cells were subcutaneously in mice, and tumors were allowed to grow to 80 mm in size. 3 about; b) The fluorescent dye (DiR) labeled nanocarrier was injected into mice via the tail vein; c) Small animal in vivo imaging to collect fluorescence signals from tumor tissue at different time points to analyze the tumor targeting of nanocarriers.

[0046] Experimental results are as follows Figure 6 As shown, compared with RAW macrophage membranes that do not express the dual-targeting peptides described in this invention, ZrMOF@PMM and ZrMOF / C@PMM can efficiently target tumor cells in vivo. In addition to tumor tissue, there is no significant difference in the distribution of other organs (heart, liver, spleen, lung, and kidney) in different treatment groups, indicating that the PMM-engineered cell membrane expressing the peptides described in this invention can significantly improve the tumor targeting of nanocarriers.

[0047] 6. In vivo antitumor activity experiment a) CT26 xenograft model: 2×10 5 CT26 was injected subcutaneously into the back of mice, and the tumors were allowed to grow to 50-100 mm in size. 3 Mice were randomly divided into groups based on tumor volume. On the day of grouping, mice were treated with 200 μg of nanocarriers, and the treatment was repeated every 3 days for a total of 5 treatments. The tumor volume and body weight of the mice were recorded, and the tumor growth curves of the mice were plotted.

[0048] b) 4T1 orthotopic lung metastasis model: 5×10 4 4T1 cells were seeded into the fourth mammary pad of mice, and the tumor volume was increased to 50-100 mm. 3 Mice were randomly assigned to groups based on tumor volume. On the day of grouping, mice were treated with 200 μg of nanocarrier every 3 days for a total of 8 treatments. During the treatment, the tumor volume and body weight of the mice were recorded, and the tumor growth curves were plotted. On the 33rd day of tumor bearing, the mice were sacrificed, their lungs were harvested, and the number of lung metastases was counted.

[0049] Both tumor models exhibited the presence of matrix metalloproteinase MMP2 in their tumor tissues, meeting the in vivo experimental conditions described in this invention. Experimental results showed that in the CT26 xenograft model, there was no statistically significant difference in tumor volume between the 2',3'-cGAMP treatment group and the PBS group. Both ZrMOF@PMM and ZrMOF / C@PMM significantly inhibited tumor growth, with ZrMOF / C@PMM showing a more significant therapeutic effect. The 4T1 model also showed similar results in tumor volume, with the CT26 model's results shown in the figure below. Figure 7As shown in the figure. Furthermore, in the 4T1 orthotopic lung metastasis model, typical photographs of mouse lung tissue treated with ZrMOF / C@PMM and other controls show that the number of lung metastatic nodules was significantly reduced in both ZrMOF@PMM and ZrMOF / C@PMM groups, with a more significant reduction in the ZrMOF / C@PMM group. This indicates that ZrMOF / C@PMM can effectively inhibit 4T1 orthotopic lung cancer metastasis. The results are shown in the figure. Figure 8 As shown above, the results collectively demonstrate the synergistic therapeutic effect of simultaneously blocking the CD47 / Sirpα pathway and activating the STING signaling pathway as described in this invention. In both tumor models, there were no significant differences in body weight among the groups of mice, and blood routine and liver function indicators were all within the normal range. HE staining showed no significant damage to major organs, indicating that the nanocarrier did not exhibit significant toxicity in mice.

Claims

1. A peptide with an amino acid sequence as shown in SEQ ID NO:

2.

2. A transmembrane fusion peptide formed by carrying the peptide of claim 1 by a membrane protein, the fusion peptide being able to target M2 macrophages, wherein the membrane protein may be coupled to the peptide of claim 1 by a flexible linker, the linker being (GGGS)nC, (GGGGS)n, (GGSC)n or (GGG)n, where n=1-10.

3. The transmembrane fusion peptide as described in the preceding claim, characterized in that, The membrane protein is a transmembrane region and intracellular region fragment of the Gi24 protein, with a preferred sequence as shown in SEQ ID NO:

3.

4. The transmembrane fusion peptide as described in claim 2, characterized in that, The transmembrane fusion peptide has a His tag at its tail, preferably consisting of 10 His amino acids.

5. The transmembrane fusion peptide as claimed in any of the prior claims, characterized in that, The transmembrane fusion peptide contains the peptide segment shown in SEQ ID NO:1, wherein the configuration of each amino acid in the peptide segment is L-type or the amino acid sequence of positions 1-12 of the peptide segment is aWSATWSNYWRh, aWSATWSNYWrh, awsATWSNYwrh or aWSATWSNYwrh, and lowercase letters represent that the corresponding amino acid is D-type.

6. The transmembrane fusion peptide as described in the preceding claim, characterized in that, The peptide segment is located at the N-terminus of the peptide of claim 1 in the transmembrane fusion peptide, preferably the two are directly linked by a peptide bond.

7. Use of the peptide described in any of the prior claims to prepare an M2 macrophage-targeting drug.

8. A nucleic acid molecule containing a nucleotide sequence encoding any of the peptides claimed in the prior claims.

9. The nucleic acid molecule as described in the preceding claim, characterized in that, It contains any of the segments selected from SEQ ID NOs:4-6.

10. A method for preparing the peptide of any of the prior claims, comprising polypeptide expression and / or solid-phase synthesis using the nucleic acid molecule of any of the prior claims.

Images