Zn-Mn bimetallic ZIF material and preparation method and application thereof

Abstract

The invention relates to a ZnMn bimetallic ZIF material for RNA delivery and a preparation method and application thereof. The ZnMn bimetallic ZIF material disclosed by the invention has natural immunity and mucosal immunity activation capability, can play a role in preventing and / or treating respiratory virus infection in a manner such as intranasal immunity, can efficiently load RNA, has excellent cell membrane penetration performance and controllable RNA release characteristic as an RNA carrier, and can be used for preparing a medicine for treating respiratory virus infection. Non-targeted delivery of RNA molecules can be realized through different administration modes such as intraperitoneal injection, nasal dripping and pulmonary delivery. Therefore, the Zn-Mn bimetallic ZIF material disclosed by the invention has a wide application prospect in the fields of respiratory virus prevention and treatment, gene therapy drugs, vaccine development and the like.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of RNA delivery carriers, in particular to a Zn-Mn bimetallic ZIF material and a preparation method and application thereof. BACKGROUND

[0002] With the rapid development of biotechnology and gene therapy field, RNA molecules such as messenger RNA (mRNA) and small interfering RNA (siRNA) have shown great potential in disease treatment, vaccine development and other biomedical applications. RNA therapy can achieve precise treatment by regulating gene expression, and has made breakthrough progress in the fields of tumor treatment, genetic diseases, infectious diseases and the like. However, the inherent structural fragility of RNA molecules (such as easy to be degraded by ribonuclease), the difficulty of cell membrane penetration caused by negative charge, the rapid clearance in vivo and the like seriously restrict the clinical application effect. Studies have shown that the half-life of unprotected RNA molecules in physiological environment is usually less than 1 hour, which greatly limits the therapeutic effect. Therefore, developing efficient, safe and stable RNA delivery system has become a key scientific problem to be solved in the current gene therapy field.

[0003] At present, lipid nanoparticles (LNPs) are one of the most mature RNA delivery carriers, however, LNPs still face many challenges in practical application: (1) lack of targeting specificity, it is difficult to achieve precise delivery; (2) immunogenicity: long-term use may cause immune response, leading to decreased treatment effect; (3) stability problem: easy to aggregate or degrade during storage and transportation, affecting batch consistency; (4) complex production process: quality control is difficult in large-scale production, and the cost is high. These limitations have prompted researchers to continuously explore new delivery systems.

[0004] In recent years, metal-organic framework materials (MOFs) have attracted widespread attention in the field of drug delivery due to their unique structural characteristics. MOFs are self-assembled by metal ions or metal clusters and organic ligands through coordination bonds, and have the characteristics of high specific surface area, high porosity, adjustable pore size, good chemical stability and easy functional modification, which enable them to efficiently load drug molecules and achieve targeted delivery and controlled release through surface modification.

[0005] Zeolitic imidazolate frameworks (ZIFs) as an important branch of the MOFs family have attracted much attention due to their unique advantages: (1) mild synthesis conditions: usually prepared at room temperature or near physiological conditions; (2) pH responsiveness: can be quickly degraded in an acidic environment, which is conducive to realizing endosome escape; (3) biocompatibility: the degradation products are mainly metal ions and organic ligands, which have low toxicity; (4) structural designability: the performance can be optimized by adjusting the metal nodes and organic ligands. However, the traditional single-metal ZIF materials still have problems in RNA delivery, such as limited drug loading efficiency and difficult accurate control of release kinetics, and at present, there is an urgent need for a new ZIF material that can efficiently load RNA molecules and controllably release RNA. SUMMARY

[0006] In view of the above problems or needs in the prior art, the purpose of the present application is to provide a Zn Mn bimetallic ZIF material, a preparation method thereof and application.

[0007] The Zn Mn bimetallic ZIF material not only has natural immune and mucosal immune activation ability, can play a role in preventing and / or treating respiratory viral infection through, for example, nasal immunization, but also can efficiently load RNA, has good cell membrane penetration ability and controllable RNA release characteristics as an RNA carrier, and can be realized by different administration methods such as intraperitoneal injection, nasal instillation and pulmonary delivery to achieve non-targeted delivery.

[0008] In order to achieve the above purpose, the present application provides the following technical scheme In a first aspect, the present application provides a Zn Mn bimetallic ZIF material, the Zn Mn bimetallic ZIF material comprises zinc ions, manganese ions and 2 methyl imidazole ligands, the Zn Mn bimetallic ZIF material has a chemical formula of Zn 0.836 Mn 0.164 (dmIm)2, wherein dmIm represents 2 methyl imidazole; And the Zn Mn bimetallic ZIF material is a spherical structure self-assembled by nanocrystalline grains, with imidazole as a bridging unit in the framework, each nanocrystalline grain is composed of a polyhedral cage structure combined by 6 four rings and 8 six rings, and in its molecular structure, each metal atom is connected with 4 2 methyl imidazole to form a tetrahedral configuration, wherein the atomic ratio of Zn:Mn is 5.1:1; In a feasible embodiment, the Zn The Mn bimetallic ZIF material has a particle size range of 119.9 214.9 nm, preferably 167.4 nm; In an implementable embodiment, the Zn The Mn bimetallic ZIF material has a ZETA potential of 11.3 13.8, preferably 12.5.

[0009] In a second aspect, the present application provides a Zn A method for preparing a Mn bimetallic ZIF material, the method comprising: reacting a solution comprising a zinc ion source, a manganese ion source and 2 methyl imidazole under oscillation, to obtain the Mn bimetallic ZIF material.

[0010] In an implementable embodiment, the zinc ion source is one or more of the soluble zinc salts selected from the group consisting of ZnSO4, Zn(NO3)2and ZnCl2, preferably ZnSO4. In an implementable embodiment, the manganese ion source is one or more of the soluble manganese salts selected from the group consisting of Mn(NO3)2, MnSO4and MnCl2, preferably Mn(NO3)2. In an implementable embodiment, the solution is an aqueous solution.

[0011] Preferably, in the aqueous solution, the concentration of the zinc ion source is 15 25 mM, preferably 20 mM; Preferably, in the aqueous solution, the concentration of the manganese ion source is 15 25 mM, preferably 20 mM; Preferably, in the aqueous solution, the concentration of the imidazole ligand is 60 100 mM, preferably 80 mM; Preferably, in the aqueous solution, the molar ratio of zinc ion, manganese ion and imidazole ligand, calculated based on zinc ion, manganese ion and imidazole group, is (0.8 1.2): (0.8 1.2): (3 5), preferably 1:1:4.

[0012] In an implementable embodiment, the temperature of the reaction is 20 30°C, preferably 23 28°C, more preferably 25 26°C; In an implementable embodiment, the time of the reaction is 5 10 min, preferably 5 8 min, more preferably 5 min.

[0013] In a preferred embodiment, the Zn The preparation method of the Mn bimetallic ZIF material comprises: mixing ZnSO4, Mn(NO3)2 and 2 The methyl imidazole is reacted in an aqueous solution under oscillation conditions; wherein, in the aqueous solution, the molar ratio of zinc ions, manganese ions and imidazole ligands is (0.8 1.2):(0.8 1.2):(3 5), preferably 1:1:4. As a preferred, the preparation sequence of the reaction system is: first adding ZnSO4, then adding Mn(NO3)2, and finally adding 2 Methyl imidazole.

[0014] In a third aspect, the present application provides a Zn Mn bimetallic ZIF material prepared by the preparation method of the second aspect.

[0015] In a fourth aspect, the present application provides the Zn Mn bimetallic ZIF material of the first aspect or the Zn Mn bimetallic ZIF material of the third aspect.

[0016] In a fifth aspect, the present application provides an RNA delivery system based on a ZIF material, which comprises: (I) the Zn Mn bimetallic ZIF material of the first aspect or the Zn Mn bimetallic ZIF material of the third aspect, and (II) RNA molecules loaded on the carrier.

[0017] In a sixth aspect, the present application provides a preparation method of the RNA delivery system of the fifth aspect, which comprises: mixing the Zn Mn bimetallic ZIF material of the first aspect or the Zn Mn bimetallic ZIF material of the third aspect with RNA, and reacting to make the RNA adsorbed on the Zn Mn bimetallic ZIF material.

[0018] As a preferred, the mass ratio of the Zn Mn bimetallic ZIF material to the RNA is (100000 1000): 1, more preferably (20000 1000): 1; As preferred, the adsorption reaction is carried out at 20 30℃, preferably 23 28℃, more preferably 25 26℃.

[0019] In a seventh aspect, the present application provides a preparation method of the RNA delivery system, which comprises: (1) mixing an aqueous solution of zinc ion source with an aqueous solution of manganese ion source to obtain a mixed solution I; (2) adding RNA into the mixed solution I and mixing to obtain a mixed solution II; (3) adding 2 methylimidazole into the mixed solution II and mixing, and reacting at 20 30℃ under oscillation for 5 10min; then, centrifuging, discarding the supernatant, resuspending with nuclease-free water, and obtaining the RNA delivery system.

[0020] In an implementable embodiment, the zinc ion source is one or more of soluble zinc salts selected from ZnSO4, Zn(NO3)2and ZnCl2, preferably ZnSO4; In an implementable embodiment, the manganese ion source is one or more of soluble manganese salts selected from Mn(NO3)2, MnSO4and MnCl2, preferably Mn(NO3)2; As preferred, in step (1), the aqueous solution of zinc ion source has a molar concentration of 15 25mM, preferably 20mM, and the aqueous solution of manganese ion source has a molar concentration of 15 25mM, preferably 20mM; As preferred, in step (2), 5 10μg of RNA is added into the mixed solution I; As preferred, in step (3), 60 100mM, preferably 80mM, of imidazole ligand is added into the mixed solution II.

[0021] As preferred, in step (3), the reaction is carried out at room temperature (i.e., 21 25℃) for 5min; and the centrifugation is at 1500-2500g for 5-15min, preferably at 2000g for 5-10min.

[0022] As preferred, in the preparation of the RNA delivery system, the Zn The mass ratio of the Mn bimetallic ZIF material to the loaded RNA is (100000 1000) : 1, more preferably (20000 1000) : 1.

[0023] In an eighth aspect, the present application provides the Zn Mn bimetallic ZIF material or the Zn Mn bimetallic ZIF material for use in the manufacture of a medicament for: (1) improving immunity to prevent respiratory viral infection; (2) treating respiratory viral infection.

[0024] In an implementable embodiment, the improving immunity is achieved by a method selected from: (1) activating innate immune response; (2) enhancing cellular immunity; (3) activating mucosal immune response.

[0025] In an implementable embodiment, the respiratory viral infection is influenza virus infection.

[0026] In a ninth aspect, the present application provides a method for preventing and / or treating respiratory viral infection, the method comprising: administering to a subject in need thereof a prophylactically and / or therapeutically effective amount of the Zn Mn bimetallic ZIF material or the Zn Mn bimetallic ZIF material.

[0027] In an implementable embodiment, the respiratory viral infection is influenza virus infection.

[0028] The "prophylactically and / or therapeutically effective amount" can vary depending on the subject of administration, the organ of the subject, the symptoms, the method of administration, etc., and can be determined according to the judgment of a doctor, taking into account the type of dosage form, the method of administration, the age and weight of the patient, the symptoms of the patient, etc.

[0029] Beneficial effects The present application successfully develops a novel bimetallic ZIF material by innovatively optimizing and designing the structure and surface function of ZIF skeleton, which not only has the ability to activate innate immunity and mucosal immunity and can play a role in preventing and / or treating respiratory viral infection through, for example, nasal immunization, but also exhibits significant technical advantages and application value in the field of RNA delivery. The Zn The Mn bimetallic ZIF material can efficiently load RNA, has excellent cell membrane penetration performance and controllable RNA release characteristics as an RNA carrier, and can realize non-targeted delivery of RNA molecules through different administration modes such as intraperitoneal injection, nose drop and lung delivery.

[0030] Therefore, the Zn The Mn bimetallic ZIF material has broad application prospects in the fields of respiratory virus prevention and treatment, gene therapy drugs and vaccine development. BRIEF DESCRIPTION OF DRAWINGS

[0031] One or more embodiments are illustrated by way of example in the figures that form a part of this patent document. This illustration, together with the specification, is not to be used to construe the embodiments because the drawings and specification represent example embodiments only. Herein the term "exemplary" is used to mean "serving as an example, instance, or illustration." Any implementation described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other implementations.

[0032] Figure 1 Appearance of the precipitate formed in different reaction systems in Example 1 is shown.

[0033] Figure 2 Characterization of Zn / Mn Results of structural characteristics and element ratio of ZIF, wherein A is a transmission electron microscopy result, B is a scanning electron microscopy result, and C is an energy spectrum analysis result.

[0034] Figure 3 Elemental composition analysis characteristic spectrum of Zn / Mn ZIF material, wherein A is an overall characteristic spectrum, B is a Zn element peak graph, and C is a Mn element peak graph.

[0035] Figure 4 Elemental composition analysis characteristic spectrum of Zn / Mn ZIF nanoparticle size and potential characteristic identification results, wherein A is a nanoparticle size normal distribution graph, and B is a Zeta potential measurement result.

[0036] Figure 5 Elemental composition analysis characteristic spectrum of Zn / Mn Chemical bond characteristics and crystal structure characteristics of ZIF material, wherein A is a Fourier infrared spectrum graph, and B is an X-ray crystal diffraction spectrum.

[0037] Figure 6 Elemental composition analysis characteristic spectrum of Zn / Mn Specific surface area and pore size determination results of ZIF material, wherein A is N2 adsorption Desorption isotherm graph, B is specific surface area determination result graph, and C is pore volume determination result graph.

[0038] Figure 7Zn / Mn Heat map of cytokine expression difference in serum of mice inoculated with ZIF materials by different administration methods, and heat map of cytokine expression difference in lung tissue and nasal cavity tissue homogenate of mice inoculated by nasal administration.

[0039] Figure 8 Zn / Mn Graph of mucosal immune activation level determination results of mice inoculated with ZIF materials by nasal administration, in which A is IgM, mIgA, sIgA antibody expression in lung tissue, and B is IgM, mIgA, sIgA antibody expression in nasal mucosa.

[0040] Figure 9 Zn / Mn Graph of influenza virus inhibition results of mice inoculated with ZIF materials by nasal administration, in which A is influenza virus RNA replication ability difference graph in lung tissue, and B is influenza virus RNA replication ability difference graph in nasal cavity.

[0041] Figure 10 Zn / Mn Schematic diagram of ZIF materials adsorbing Cy5-labeled siRNA in different ways.

[0042] Figure 11 Zn / Mn Evaluation results of RNA packaging efficiency of ZIF materials adsorbing EGFP mRNA in different ways.

[0043] Figure 12 Zn / Mn Evaluation of EGFP mRNA expression in cells after transfection of Vero cells by ZIF loaded with EGFP mRNA.

[0044] Figure 13 Zn / Mn Results of mouse in vivo imaging of mice administered with ZIF by different administration routes. DETAILED DESCRIPTION

[0045] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and the present disclosure, and will not be interpreted in an overly literal or overly formal sense unless expressly so defined herein.

[0046] The practice of the present application will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art.

[0047] For the purposes of the present invention, certain technical terms are specifically defined below. Unless specifically defined elsewhere in this document, all technical terms as used herein have their ordinary meaning to one of ordinary skill in the art to which the present invention pertains.

[0048] The term "and / or" should be understood to mean either one of the items or any combination of the items in the list.

[0049] As used herein, the term "or" is to be interpreted as an inclusive or, meaning one or more of the items listed. Only terms clearly indicated to the contrary, such as "only one of or "exactly one of, will refer to the exclusion of one or more of the items listed.

[0050] The technical solutions in the embodiments of the present application will be described clearly and completely below. The described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present application.

[0051] The materials, reagents and the like used in the following examples can be obtained commercially unless otherwise specified. The examples were carried out according to conventional experimental conditions or according to the recommended conditions suggested by the manufacturer unless otherwise specified.

[0052] Example 1: Zn Preparation of Mn bimetallic zeolitic imidazolate framework material (hereinafter also referred to as Zn / Mn ZIF) RNase free H2O was used to prepare 50 mM ZnSO4solution, 1 M Mn(NO3)2solution and 1 M 2 Methylimidazole solution, respectively. In a 1.5 mL EP tube, 500 μL RNase free H2O was added first, followed by 400 μL 50 mM ZnSO4solution, mixed by pipetting; then, 20 μL 1 M Mn(NO3)2solution was added, mixed by pipetting; finally, 80 μL 1 M 2 Methylimidazole solution was added, mixed by pipetting, and 100 g vortexed at room temperature for 5 min; centrifuged at 2000 g for 10 min at room temperature, and the obtained precipitate was Zn / Mn ZIF material; 1 mL RNase free H2O was added to the precipitate, mixed by pipetting, and the precipitate was resuspended, and the obtained material was Zn / Mn ZIF material.

[0053] By reducing the concentration of metal ions and 2 methyl imidazole in the solution, the reaction system was adjusted, and 0.25x and 0.5x reaction systems were configured respectively. The mass of the precipitate was weighed to determine the yield of Zn / Mn ZIF material. The yield of ZIF material is shown in Table 1, and the results of the precipitate state are shown in Figure 1 .

[0054] Table 1

[0055] As can be seen from Table 1, in different reaction systems, the greater the ion concentration, the higher the mass yield of the harvested material.

[0056] As Figure 1 can be seen, after centrifugation of the material, a milky white precipitate can be formed, and the higher the ion concentration, the more the precipitate.

[0057] Example 2: Zn / Mn Chemical property identification of ZIF 1. Morphological characteristics The Zn / Mn ZIF material prepared in Example 1 was added dropwise on a copper mesh and adsorbed for 10 min, and then naturally dried. Hitachi HT7700 transmission electron microscope (TEM) was used for observation, and porous spherical particles with a size of about 200 nm can be seen, as shown in FIG. A of Figure 2 ; German ZEISS Gemini SEM 300 scanning electron microscope (SEM) was used to observe the surface structure characteristics, and porous spherical particles with a size of about 200 nm can also be observed, as shown in FIG. B of Figure 2 ; these results show that the Zn / Mn ZIF material obtained in Example 1 is a spherical porous nanoparticle.

[0058] 2. Element identification Oxford x max energy dispersive X-ray spectrometer (EDX) was used to analyze the Zn / Mn ZIF material, and the results are shown in FIG. C of Figure 2 ; the figure shows that these nanoparticles mainly contain elements such as carbon 29.98wt%, oxygen 8.76wt%, nitrogen 23.12wt%, zinc 23.43wt%, and manganese 14.80wt%, which shows that the Zn / Mn ZIF material has zinc and manganese bimetallic elements, and the Zn Mn bimetallic ZIF material is successfully prepared in Example 1.

[0059] Furthermore, elemental characterization of the material was performed using X-ray photoelectron spectroscopy (XPS), and the results are shown in [Figure number missing]. Figure 3 Macroscopic XPS full spectrum confirmed C1s, N1s, O1s, Zn2p, and Mn2p signals. Mn2p appeared at ~641 eV, and Zn2p at ~1022 eV, with peak positions corresponding to the +2 valence state, indicating that Mn2p is present at ~641 eV and Zn2p at ~1022 eV. 2+ It has truly entered the tetrahedral coordination sites. By calculating the peak areas of Zn and Mn, the atomic ratio of zinc to manganese was determined to be Zn:Mn = 5.1:1, and the molecular formula of the basic unit grain of the material was derived as Zn. 0.836 Mn 0.164 (dmIm)2, where dmIm represents 2 Methylimidazole.

[0060] 3. Detection of nanoparticle size and surface Zeta potential Zn / Mn was measured using the British Malvern Zetasizer Nano ZS90. The size and surface zeta potential of ZIF nanoparticles are shown in the following results: Figure 4 As shown in Figures A and B.

[0061] Depend on Figure 4 It can be seen that Zn / Mn The ZIF nanoparticles have an average diameter of 167.4 ± 47.5 nm and a zeta potential of 12.5 ± 1.3 mV.

[0062] 4. Characteristics of chemical bonds and crystal structure Zn / Mn The ZIF was placed into 5mL vials and lyophilized using a freeze dryer. The lyophilization program was as follows: Pre-cool at 35℃ for 6 hours, then ventilate and condense for 40 minutes to allow the frozen well to reach the required temperature. 45℃, vacuum heating, control the heat conduction to... Freeze-drying was continued at 6℃ for 17 hours, followed by drying at 20℃ for 1 hour to obtain freeze-dried Zn / Mn. ZIF material.

[0063] The chemical bond characteristics of the freeze-dried samples were determined using a Thermo Scientific Nicoleti S50 Fourier transform infrared spectroscopy analyzer, and the results are as follows: Figure 5 As shown in Figure A, in this figure, 3117cm 1 The absorption peaks in the vicinity mainly originate from the C on the imidazole ring. H-mode stretching vibration at 1627cm 1Absorption peaks in the vicinity are typical characteristics of C=C and C=O stretching vibration modes, 1576 cm 1 Absorption peaks in the vicinity are typical characteristics of C=N stretching vibration modes on imidazole ring, 1411 cm 1 and 1329 cm 1 Absorption peaks in the vicinity are attributed to C=C stretching vibration modes in imidazole ring of ligand, 1113 cm 1 Absorption peaks in the vicinity are typical characteristics of C =N stretching vibration modes on imidazole ring.

[0064] Further, using Japan Rigaku SmartLab SEX ray diffractometer, Zn / Mn ZIF material crystal structure characteristics are detected, and the diffraction pattern is shown in B figure of Figure 5 . The diffraction pattern shows a plurality of sharp diffraction peaks, indicating that Zn / Mn ZIF material has good crystallinity; and, its main characteristic peaks appear in the range of about 10 40 degrees, and the strong diffraction peak observed in the lower angle region (10 20 degrees) is typical characteristics of ZIF material, so the result shows that Zn / Mn ZIF material retains the basic framework structure peak of ZIF; in addition, the strongest diffraction peak appears near about 15 16 degrees, which is consistent with typical ZIF 8 structure, further supporting the basic framework structure of Zn / Mn ZIF material.

[0065] In addition, by analyzing the Fourier infrared spectrum shown in A figure of Figure 5 and the X-ray crystal diffraction pattern shown in B figure, the chemical formula of Zn / Mn ZIF material is Zn2Mn(dmIm)6, wherein, dmIm represents 2 methyl imidazole, and each nanoparticle is composed of a polyhedral cage structure combined by 6 four rings and 8 six rings, in its molecular structure, each metal atom is connected with 4 2 methyl imidazole to form a tetrahedral configuration.

[0066] 5、Specific surface area and pore size Using American Micromeritics ASAP2460, the specific surface area and pore size of Zn / Mn ZIF material are measured, and the results are shown in Figure 6 . Figure 6In the middle, A is the N2 adsorption desorption isotherm graph, B is the specific surface area graph, and C is the pore volume graph.

[0067] From Figure 6 Zn / Mn The BET specific surface area of the ZIF material is 2.7019 m 2 / g, the Langmuir surface area is 14.2706 m 2 / g, the t Plot micropore area is 1.1579 m 2 / g, the external surface area is 1.5440 m 2 / g; its BJH adsorption pore volume (1.5 300 nm) is 0.005008 cm 3 / g, the BJH desorption pore volume (1.5 300 nm) is 0.005215 cm 3 / g, the t Plot micropore volume is 0.000397 cm 3 / g; its BJH adsorption average pore diameter is 6.5572 nm, the BJH desorption average pore diameter is 5.2460 nm, and the BET adsorption average pore diameter is 7.5330 nm.

[0068] These results show that the Zn / Mn ZIF material contains a certain amount of "ink bottle" type pore junctions, mainly containing micropores and small mesoporous structures, and the micropore size is mainly concentrated in the interval of 1.2 1.8 nm, which provides sufficient active sites for gas adsorption and catalytic applications.

[0069] Example 3: Evaluation of the immune activation ability of Zn / Mn ZIF 1. Evaluation of natural immune activation of cytokines Through three ways of nose drops, lung delivery, intraperitoneal injection, and intravenous injection, 50 μL / each of Zn / Mn ZIF (obtained from 1x reaction system in Example 1) was used to immunize 6-week-old female Balb / c mice, and 24 h after immunization, blood was taken from each group of mice and serum was separated. Among them, the nose drop immunization group also took the nasal cavity and lung tissue, and used 1 mL of PBS for 60HZ grinding for 10 min, and then centrifuged at 12000 rpm for 10 min to take the supernatant. Then, the expression of cytokines in the serum and tissue grinding supernatant of the immunized mice was detected using a Luminex kit, and the results are shown in Figure 7 .

[0070] From Figure 7It can be seen that the upregulation of cytokines caused by various immune pathways in serum is basically consistent. Among them, the inflammatory factor IL-6 was upregulated 10-fold, while NK cell and cytotoxic T cell-related factors were upregulated by IL-6. 15 / IL 15R was upregulated 10-fold; after intranasal administration, the main component in lung tissue was the chemokine MIP. 2 was upregulated 15-fold, regulatory T cell-related factor IL-2 7R was upregulated 8-fold, and B-cell-related factor IL-1 was also upregulated. 7 was upregulated 3-fold; in nasal tissue, the inflammatory factor IL-6 was upregulated 5-fold, and the chemokine MIP was also upregulated. 2 was upregulated 10-fold, and other regulatory factors, such as LIF, were upregulated 6-fold. These results indicate that the Zn / Mn ratio... ZIF can effectively activate inflammatory factors and antiviral innate immune responses related to cellular immune activation in mice, and can stimulate the upregulation of the expression levels of various cytokines in the blood and upper and lower respiratory tract organs.

[0071] 2. Evaluation of mucosal immune activation by IgM and IgA antibodies The Zn / Mn solution is administered via nasal drops at a dose of 50 μL per dose. Six-week-old female Balb / c mice were immunized with ZIF (obtained in the 1× reaction system of Example 1). Nasal and lung tissues were collected from the mice on days 1, 7, and 14 post-immunization. The tissues were homogenized in 1 mL PBS at 60 Hz for 10 min, centrifuged at 12000 rpm for 10 min, and the supernatant was collected. The expression levels of IgM and IgA in the lung and nasal mucosa were detected using an ELISA kit. The results are as follows: Figure 8 As shown.

[0072] Depend on Figure 8 It can be seen that in lung tissue, Zn / Mn On day 7 after ZIF administration, IgM antibody expression levels began to upregulate, increasing 1.5-fold. mIgA and sIgA antibody expression levels began to upregulate after day 14, increasing 2-fold. In nasal tissue, IgM, mIgA, and sIgA antibody expression levels all began to upregulate on day 7 after administration, and increased more than 2-fold after day 14. These results indicate that the Zn / Mn ratio... ZIF, administered via nasal drops, can effectively activate the expression of non-specific IgM antibodies, mIgA antibodies, and sIgA antibodies in the upper and lower respiratory tract tissues, indicating that the material can effectively activate mucosal immune responses and form a certain immune protective barrier.

[0073] Example 4: Zn / Mn Evaluation of ZIF's anti-influenza virus infection ability The Zn / Mn solution is administered via nasal drops at a dose of 50 μL per dose. Six-week-old female Balb / c mice were immunized with ZIF (obtained from the 1× reaction system in Example 1). One day after immunization, they were inoculated with 104 PFU of influenza virus H1N1PR8 strain via intranasal injection. One day after infection, they were again administered 50 μL / mouse of Zn / Mn via intranasal injection. ZIF (obtained from the 1× reaction system in Example 1). Mice were dissected on days 2 and 5 post-infection, and lung and nasal tissues were collected. The tissues were homogenized in 1 mL PBS at 60 Hz for 10 min, centrifuged at 12000 rpm for 10 min, and the supernatant was collected. The influenza virus RNA copy number was detected using quantitative real-time PCR. The results are as follows: Figure 9 As shown.

[0074] Depend on Figure 9 It can be seen that on the second day post-infection, influenza virus RNA decreased by 3-fold in lung tissue and 5-fold in nasal cavity; on the fifth day post-infection, influenza virus RNA decreased by 2-fold in lung tissue and 3-fold in nasal cavity. This result indicates that Zn / Mn ZIF, administered via nasal drops, has a certain antagonistic effect against influenza virus infection and can effectively inhibit the replication of influenza virus RNA in the upper and lower respiratory tract tissues of mice.

[0075] Example 5: Zn / Mn Evaluation of ZIF RNA packaging efficiency 1. First, synthesize siRNA with a Cy5 tag at the 5' end. The siRNA sequence is as follows: Justice Chain UUCUCCGAACGUGUCACGUUU(SEQIDNO: 1), Negative chain ACGUGACACGUUCGGAGAAUU (SEQ ID NO: 2).

[0076] 2. The methods are adsorption and self-encapsulation, respectively (see schematic diagram). Figure 10 (as shown); wherein, the adsorption method is: using the Zn / Mn obtained by the 1× reaction system in Example 1. 13.3 mg (dry weight) of ZIF material was added, along with 1 μg of the above-mentioned siRNA. The mixture was incubated at room temperature for 5 minutes, then centrifuged at 2000g for 5 minutes at room temperature to complete packaging. The self-encapsulation method involved sequentially adding 20 mM ZnSO4, 20 mM Mn(NO3)2, 1 μg of the above-mentioned siRNA, and 80 mM 2... Methylimidazole was reacted at room temperature for 5 minutes, followed by centrifugation at 2000g at room temperature for 5 minutes to complete packaging. It was observed that all the blue Cy5-labeled RNA was converted to Zn / Mn. Packaged by ZIF.

[0077] 3. Using the adsorption and self-encapsulation methods described above, Zn / Mn ratios obtained from the 0.25×, 0.5×, and 1× reaction systems in Example 1 were respectively obtained. ZIF material (the amount of each material used is approximately the yield shown in Table 1) 10 μg EGFP packaged mRNA, its RNA sequence is as follows: (SEQ ID NO: 3).

[0078] After the packaging, the supernatant was taken after 10 min centrifugation at 2000g at room temperature, and the residual EGFP mRNA in the supernatant was detected by real-time fluorescent quantitative PCR The absolute content of mRNA was determined to determine the Zn / Mn The RNA packaging efficiency of ZIF.

[0079] Specifically, the absolute amount of residual RNA in the supernatant was calculated by the CT value of real-time fluorescent quantitative PCR and the calculation formula of RNA copy number (i.e., Log10EGFP mRNA copy number = 0.2713×CT value+12.531), and the adsorption rate (%) was calculated by the formula (i.e., adsorption rate (%) = (absolute amount of RNA in supernatant before packaging / absolute amount of RNA before packaging) x 100%) to obtain the packaging efficiency (%). The absolute amount of residual RNA in the supernatant was calculated by the CT value of real-time fluorescent quantitative PCR and the calculation formula of RNA copy number (i.e., Log10EGFP

[0080] The CT value data of real-time fluorescent quantitative PCR and the RNA copy number and adsorption rate calculated based thereon are shown in Table 2, and reflect the Zn / Mn The packaging efficiency of ZIF materials is shown in the column chart of Figure 11 .

[0081] Table 2

[0082] From Table 2 and Figure 11 It can be seen that the higher the concentration of Zn / Mn ZIF material, the higher the RNA packaging efficiency, and in particular, the Zn / Mn ZIF material obtained under the 1x reaction system can adsorb 10 μg of EGFPRNA molecules at 100%.

[0083] Example 6: Zn / Mn mRNA expression efficiency evaluation after mRNA transfection by ZIF packaging According to the description in Example 1, Zn / Mn ZIF materials of 0.25x, 0.5x and 1x reaction systems were synthesized, respectively, and the synthesized Zn / Mn ZIF materials (the amount of each material is approximately the yield shown in Table 1) were diluted according to 1:1, 1:2 and 1:4, and then 10 μg of EGFP mRNA was added for adsorption and packaging, and after the packaging, the precipitate was collected by centrifugation at 2000g at room temperature for 10 min.

[0084] 1 mL of opti Dissolve the precipitate using MEM, and add 100 μL of the lysis buffer to a 96-well plate containing a confluent monolayer of VERO or BHK cells. Culture for 6 hours for transfection. After 6 hours of culture, replace with fresh OPTILE solution. The cells were cultured in MEM medium for another 48 hours, and fluorescence imaging was performed using a fluorescence microscope. The fluorescence imaging images showed that the cells expressed green fluorescent protein, which is the transfected mRNA.

[0085] Fluorescence imaging results are shown in Figure 12 ;Depend on Figure 12 It can be seen that the Zn / Mn ratio obtained under the 1× reaction system ZIF material exhibits the highest transfection efficiency, achieving 100% cell positivity, with high fluorescence intensity in positive cells (indicating high mRNA content). However, as the concentration of the reaction system decreases during material preparation and the prepared Zn / Mn... As the concentration of ZIF material was diluted, both the number of positive cells and the intensity of green fluorescence in the cells gradually decreased.

[0086] Example 7: Zn / Mn Non-targeted delivery of ZIF-packaged siRNA in mice Take 50 μL of the Zn / Mn prepared in Example 3 Cy5-labeled siRNA packaged in ZIF was delivered to 6-week-old Balb / C female mice via intraperitoneal injection, intranasal administration, and pulmonary delivery. In vivo imaging was performed at 0h, 3h, and 24h post-administration using a PerkinElmer IVISSPECTRUM small animal in vivo imaging system. The detection conditions were chemiluminescence detection with 30s exposure, excitation wavelength of 640 nm, and emission wavelength of 680 nm.

[0087] The results are as follows Figure 13 As shown; by Figure 13 It can be seen that RNA can be detected in the liver and spleen of the intraperitoneal injection group. Cy5 signaling; RNA could be detected in the nasal cavity and lungs of the nasal droplet administration group. Cy5 signaling; RNA was detectable in the lungs and liver of the lung-delivered drug group. Cy5 signal.

[0088] This result indicates that Zn / Mn ZIF materials can deliver siRNA to different tissues and organs in mice via different administration methods, and the distribution of the delivered RNA in the organs depends on the specific site of administration. Therefore, the Zn / Mn of the present invention... The ZIF material is suitable for delivery of RNA drug molecules to various treatment sites, and has wide application prospects.

[0089] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application, and are not limited thereto; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that the technical solutions described in the foregoing examples can still be modified, or some technical features therein can be replaced by equivalents; and such modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. A type of Zn Mn bimetallic ZIF material, characterized by: The Zn-Mn bimetallic ZIF material is prepared by reacting a solution containing a zinc ion source, a manganese ion source and 2-methylimidazole under oscillating conditions.

2. The Zn-Mn bimetallic ZIF material according to claim 1, characterized in that, The zinc ion source is one or more selected from the following soluble zinc salts: ZnSO4, Zn(NO3)2 and ZnCl2, preferably ZnSO4; and / or, the manganese ion source is one or more selected from the following soluble manganese salts: Mn(NO3)2, MnSO4 and MnCl2, preferably Mn(NO3)2; and / or, the solution is an aqueous solution.

3. The Zn-Mn bimetallic ZIF material according to claim 1, characterized in that, The concentration of the zinc ion source in the solution is 15-25 mM, preferably 20 mM; and / or, the concentration of the manganese ion source in the solution is 15-25 mM, preferably 20 mM; and / or, the concentration of 2-methylimidazole in the solution is 60-100 mM, preferably 80 mM; and / or, based on zinc ions, manganese ions and imidazole groups, the molar ratio of zinc ions, manganese ions and 2-methylimidazole is (0.8-1.2):(0.8-1.2):(3-5), preferably 1:1:

4.

4. The Zn-Mn bimetallic ZIF material according to claim 1, characterized in that, The reaction temperature is 20-30°C, preferably 23-28°C, more preferably 25-26°C; and / or the reaction time is 5-10 min, preferably 5-8 min, more preferably 5 min.

5. The Zn-Mn bimetallic ZIF material according to claim 1, characterized in that, The preparation method includes: first adding a zinc ion source, then adding a manganese ion source, and finally adding 2-methylimidazole, reacting under oscillation conditions to obtain the product; preferably, the reaction further includes centrifugation and / or resuspension steps.

6. The Zn-Mn bimetallic ZIF material according to claim 1, characterized in that, The particle size range of the Zn-Mn bimetallic ZIF material is 119.9-214.9 nm, preferably 167.4 nm; and / or, the ZETA potential of the Zn-Mn bimetallic ZIF material is 11.3-13.8 mV, preferably 12.5 mV.

7. The Zn-Mn bimetallic ZIF material according to claim 1, characterized in that, The Zn-Mn bimetallic ZIF material has a porous structure, and preferably, its BET specific surface area is approximately 2.7019 m². 2 / g; and / or, its micropore volume is approximately 0.000397 cm³. 3 / g.

8. The Zn-Mn bimetallic ZIF material according to claim 1, characterized in that, The chemical formula of the Zn-Mn bimetallic ZIF material is Zn 0.836 Mn 0.164 (dmIm)2, where dmIm represents 2-methylimidazole; and / or, the ratio of zinc atoms to manganese atoms in the Zn-Mn bimetallic ZIF material is 5.1:1; The Zn-Mn bimetallic ZIF material is a spherical structure formed by the self-assembly of nanocrystals. Imidazole is used as the bridging unit in the framework. Each nanocrystal is composed of a polyhedral cage structure consisting of 6 four-rings and 8 six-rings. In its molecular structure, each metal atom is connected to 4 2-methylimidazoles to form a tetrahedral configuration.

9. The Zn-Mn bimetallic ZIF material according to claim 1, characterized in that, The Zn-Mn bimetallic ZIF material has immune activation capabilities. Preferably, it can activate innate immune responses, enhance cellular immunity, and / or activate mucosal immune responses. More preferably, it can upregulate the expression of one or more cytokines, including but not limited to IL-6, IL-15 / IL-15R, MIP-2, IL-7R, IL-7, and LIF; and / or, it can upregulate the expression of one or more antibodies, including but not limited to IgM, mIgA, and sIgA.

10. The Zn-Mn bimetallic ZIF material according to any one of claims 1-8, characterized in that, The Zn-Mn bimetallic ZIF material has RNA loading capacity, preferably, as an RNA carrier it has cell membrane penetration ability and / or controllable RNA release characteristics; more preferably, its RNA packaging efficiency is 100%.

Images