Genetically engineered bacterium for efficiently producing L-homoserine as well as construction method and application of genetically engineered bacterium

By optimizing the gene expression and knockout strategy of L-homoserine producing strains, a genetically engineered strain for high-efficiency L-homoserine production was constructed, solving the problems of low yield and high environmental pollution in existing technologies, and achieving high-yield and low-cost fermentation production.

CN121801792APending Publication Date: 2026-04-07ZHEJIANG XINAN CHEM IND GRP CO LTD
View PDF 7 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-05
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

Existing methods for producing L-homoserine suffer from high production costs, complex processes, and significant environmental pollution. Furthermore, the yield and conversion rate in fermentation production are insufficient to meet industrialization needs.

Method used

By knocking out or weakening the expression of the homoserine kinase encoding gene thrB, the homoserine O-succinyltransferase encoding gene metA, the pyruvate kinase encoding gene pykA, the soluble pyridine nucleotide transhydrogenase encoding gene sthA, the NADPH-dependent aldehyde reductase encoding gene yahK, and the diaminopimelic acid decarboxylase encoding gene lysA, and enhancing the expression of the aspartate kinase I-homoserine dehydrogenase I encoding gene thrA, the phosphoenolpyruvate carboxylase encoding gene ppc, the pyridine nucleotide transhydrogenase encoding gene pntAB, the sodium polyphosphate-dependent nicotinamide adenine dinucleotide kinase MAnadk*, and the homoserine extracellular transporter encoding gene rhtA, the reducing power supply and synthesis pathway were optimized to construct a genetically engineered bacterium that efficiently produces L-homoserine.

Benefits of technology

It increased the yield and conversion rate of L-homoserine, meeting the needs of industrial production, reducing production costs and environmental pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention relates to the technical field of microbial metabolism and genetic engineering, in particular to construction and application of genetic engineering bacteria for producing L-homoserine. The construction method of the engineering bacteria for efficiently producing the L-homoserine is characterized in that escherichia coli W3110 is taken as an original strain, thrB, metA, pykA, stA, yahK and lysA related to metabolic synthesis branches and competitive pathways of the L-homoserine are knocked out or weakened, thrA, ppc, pntAB, MAnadk * and aspA which are related to precursors and reducing power supply in the synthesis pathway of the L-homoserine are enhanced, and the engineering bacteria for efficiently producing the L-homoserine are obtained. The enhancement of rhtA in extracellular transport in a synthetic route of L-homoserine is realized. After the engineering bacteria constructed by the invention are fermented for 72 hours, 147.6 g / L of L-homoserine can be accumulated. The engineering bacterium does not carry plasmids, induction is not needed in the fermentation process, control is easy, and application to industrial production is facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of microbial metabolic engineering and genetic engineering, and in particular to genetically engineered bacteria that efficiently produce L-homoserine, their construction methods, and applications. Background Technology

[0002] Homoserine (2-Amino-4-hydroxybutyric acid) is a non-protein amino acid with two isomers: L-homoserine and D-homoserine. L-homoserine is a precursor to essential amino acids such as L-methionine, L-threonine, and L-isoleucine, participating in various physiological and biochemical reactions and multiple metabolic processes in vivo, thus possessing important physiological functions and applications. L-homoserine is also an important platform compound, used as a raw material or intermediate in the synthesis of various chemical products, and is widely used in the food, cosmetics, pharmaceutical, and feed industries. L-homoserine can be used to synthesize L-glufosinate with herbicidal activity, reducing the amount and cost of herbicides and minimizing harm to soil and crops. Therefore, the use of L-homoserine to synthesize the novel pesticide L-glufosinate has broad market prospects.

[0003] Traditional methods for producing L-homoserine mainly include chemical synthesis, chemical chiral resolution, and biological methods. Chemical synthesis is the dominant method, but it suffers from cumbersome purification steps, long reaction times, high production costs, complex processes, and environmental pollution. Chemical chiral resolution involves adding chiral reagents to a swirling homoserine solution to induce a difference in the properties of L / D-homoserine, thus separating L-homoserine. However, this method has low yields, high reagent costs, requires large amounts of organic solvents, and poses a significant environmental pollution threat. Biological methods currently mainly include enzymatic and fermentation methods. Enzymatic methods require expensive coenzymes and toxic raw materials such as formaldehyde and formic acid, resulting in high costs and environmental unfriendliness. Microbial fermentation, on the other hand, offers advantages such as low cost, mild conditions, and less environmental pollution, making it the preferred process for producing various amino acids.

[0004] Initially, the market for fermentation methods mainly consisted of small-scale production of L-homoserine using microbial fermentation in Japan and the United States. With the rapid development of metabolic engineering and synthetic biology, the fermentation synthesis of L-homoserine has attracted widespread attention. Currently, numerous patents exist for engineered bacteria that produce high-yield homoserine, such as those from Zhejiang University of Technology (CN1175353 30A, CN117286087A, CN116622607A), Tianjin University of Science and Technology (CN112779204B, CN11718 7151A), the Institute of Microbiology, Chinese Academy of Sciences (CN118497101B), and Nanjing Shengde Chuangying Biotechnology Co., Ltd. (CN117384811A). According to available data, current research mainly focuses on the main synthetic pathway, excretion system, cofactor modules, and competitive and degradation pathways. Among these, the modification of the main synthetic pathway is the most crucial. This study also follows the same modification strategy, but it optimizes the supply of reducing power involved in the synthetic pathway to the greatest extent. Specifically, it not only enhances the expression of the pntAB gene, but also overexpresses the exogenously modified MAnadk* gene variant and knocks out the sthA and yahK genes to provide sufficient reducing power to promote the synthesis of homoserine through the aspA and aspC pathways. In addition, by combining the modification of the aspA and aspC pathways, it is also possible to maintain the balance between the aspA and aspC pathways and increase the substrate conversion rate.

[0005] Currently, homoserine is mainly produced through chemical synthesis, which suffers from problems such as complex processes, high technical barriers, low safety, and significant environmental pollution. Although the modification of L-homoserine-producing strains has achieved a certain level of high yield, its production yield and conversion rate in fermentation production of L-homoserine are still some distance from industrial-scale production. Therefore, improving the production performance of engineered L-homoserine strains is a goal for those skilled in the art. Summary of the Invention

[0006] In view of this, the purpose of the present invention is to overcome the shortcomings of the prior art, provide a recombinant Escherichia coli with high L-homoserine production and its construction method, and apply it to the fermentation production of L-homoserine, so as to overcome the problem of low yield of L-homoserine produced by existing L-homoserine producing strains in the prior art.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] In a first aspect, the present invention provides the use of any of the following in the construction of L-homoserine producing strains and / or the fermentation production of L-homoserine:

[0009] (I) Knock out or weaken one or more of the following expressions:

[0010] (I-1) The homoserine kinase encoding gene thrB;

[0011] (I-2) The homoserine O-succinyltransferase encoding gene metA;

[0012] (I-3) Pyruvate kinase encoding gene pykA;

[0013] (I-4) The gene encoding sthA, a soluble pyridine nucleotide transhydrogenase;

[0014] (I-5) The gene encoding NADPH-dependent aldehyde reductase yahK

[0015] (I-6), the gene encoding diaminopimelic acid decarboxylase lysA

[0016] and / or

[0017] (II) Enhance the expression of any one or more of the following:

[0018] (II-1) The gene thrA encoding aspartate kinase I-homoserine dehydrogenase I;

[0019] (II-2) The gene encoding phosphoenolpyruvate carboxylase, ppc;

[0020] (II-3) The gene pntAB, which encodes pyridine nucleotide transhydrogenase;

[0021] (II-4) Sodium polyphosphate-dependent exogenously modified nicotinamide adenine dinucleotide kinase MAnadk*;

[0022] (II-5) The aspartate ammonia-lyase encoding gene aspA;

[0023] (II-6) rhtA, a gene encoding a homoserine extracellular transporter.

[0024] In some specific embodiments of the present invention, Escherichia coli K12 W3110 is used as the chassis strain.

[0025] In some specific embodiments of the present invention, thrA, ppc, pntAB, MAnadk* and / or aspA are expressed using strong promoters;

[0026] As a preferred option, a strong promoter P is used. em7 The thrA was overexpressed; a strong promoter P was used. tac Overexpression of the ppc, the pntAB gene, the MAnadk*, the aspA and / or the rhtA;

[0027] Preferably, the strong promoter P tac have:

[0028] (i) A nucleotide sequence as shown in SEQ ID No. 57; or

[0029] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0030] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0031] Preferably, the strong promoter P em7 have:

[0032] (i) A nucleotide sequence as shown in SEQ ID No. 58; or

[0033] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0034] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

[0035] In some specific embodiments of the present invention, any one of the following is included:

[0036] After knocking out thrB, replace the start codon ATG of lysA with GTG; and / or

[0037] After knocking out metA, pykA, sthA, and / or yahK, the integrated gene is performed; preferably, the gene includes thrA, ppc, pntAB, and MAnadk*; preferably, MAnadk* is a variant derived from Micrococcus sp. ACRRV; and / or

[0038] The overexpressed aspA and rhtA genes were replaced with in situ promoters.

[0039] In some specific embodiments of the present invention, the thrB has:

[0040] (i) A nucleotide sequence as shown in SEQ ID No. 59; or

[0041] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0042] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0043] The metA has:

[0044] (i) A nucleotide sequence as shown in SEQ ID No. 60; or

[0045] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0046] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0047] The pykA has:

[0048] (i) A nucleotide sequence as shown in SEQ ID No. 61; or

[0049] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0050] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0051] The gene sthA has:

[0052] (i) A nucleotide sequence as shown in SEQ ID No. 62; or

[0053] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0054] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0055] The gene yahK has:

[0056] (i) A nucleotide sequence as shown in SEQ ID No. 63; or

[0057] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0058] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0059] The gene lysA has:

[0060] (i) A nucleotide sequence as shown in SEQ ID No. 64; or

[0061] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0062] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0063] The gene thrA has:

[0064] (i) A nucleotide sequence as shown in SEQ ID No. 65; or

[0065] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0066] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0067] The gene ppc has:

[0068] (i) A nucleotide sequence as shown in SEQ ID No. 66; or

[0069] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0070] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0071] The gene pntAB has:

[0072] (i) A nucleotide sequence as shown in SEQ ID No. 67; or

[0073] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0074] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0075] The gene MAnadk* has the following characteristics:

[0076] (i) A nucleotide sequence as shown in SEQ ID No. 68; or

[0077] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0078] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0079] The gene aspA has:

[0080] (i) A nucleotide sequence as shown in SEQ ID No. 69; or

[0081] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0082] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0083] The gene rhtA has:

[0084] (i) A nucleotide sequence as shown in SEQ ID No. 70; or

[0085] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0086] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

[0087] Secondly, the present invention also provides a genetically engineered bacterium that produces high levels of L-homoserine, comprising:

[0088] (I) Knock out or weaken one or more of the following expressions:

[0089] (I-1) The homoserine kinase encoding gene thrB;

[0090] (I-2) The homoserine O-succinyltransferase encoding gene metA;

[0091] (I-3) Pyruvate kinase encoding gene pykA;

[0092] (I-4) The gene encoding sthA, a soluble pyridine nucleotide transhydrogenase;

[0093] (I-5) The gene encoding NADPH-dependent aldehyde reductase yahK

[0094] (I-6), the gene encoding diaminopimelic acid decarboxylase lysA

[0095] and / or

[0096] (II) Enhance the expression of any one or more of the following:

[0097] (II-1) The gene thrA encoding aspartate kinase I-homoserine dehydrogenase I;

[0098] (II-2) The gene encoding phosphoenolpyruvate carboxylase, ppc;

[0099] (II-3) The gene pntAB, which encodes pyridine nucleotide transhydrogenase;

[0100] (II-4) Sodium polyphosphate-dependent exogenously modified nicotinamide adenine dinucleotide kinase MAnadk*;

[0101] (II-5) The aspartate ammonia-lyase encoding gene aspA;

[0102] (II-6) rhtA, a gene encoding a homoserine extracellular transporter.

[0103] In some specific embodiments of the present invention, the genetically engineered bacteria uses Escherichia coli K12 W3110 as the chassis strain.

[0104] In some specific embodiments of the present invention, thrA, ppc, pntAB, MAnadk* and / or aspA are expressed using strong promoters;

[0105] As a preferred option, a strong promoter P is used. em7 The thrA was overexpressed; a strong promoter P was used. tac Overexpression of the ppc, the pntAB gene, the MAnadk*, the aspA and / or the rhtA;

[0106] Preferably, the strong promoter P tac have:

[0107] (i) A nucleotide sequence as shown in SEQ ID No. 57; or

[0108] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0109] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0110] Preferably, the strong promoter P em7 have:

[0111] (i) A nucleotide sequence as shown in SEQ ID No. 58; or

[0112] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0113] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

[0114] In some specific embodiments of the present invention, the genetically engineered bacteria include any one of the following:

[0115] After knocking out thrB, replace the start codon ATG of lysA with GTG; and / or

[0116] After knocking out metA, pykA, sthA, and / or yahK, the integrated gene is performed; preferably, the gene includes thrA, ppc, pntAB, and MAnadk*; preferably, MAnadk* is a variant derived from Micrococcus sp. ACRRV; and / or

[0117] The overexpressed aspA and rhtA genes were replaced with in situ promoters.

[0118] In some specific embodiments of the present invention, the thrB has:

[0119] (i) A nucleotide sequence as shown in SEQ ID No. 59; or

[0120] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0121] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0122] The metA has:

[0123] (i) A nucleotide sequence as shown in SEQ ID No. 60; or

[0124] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0125] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0126] The pykA has:

[0127] (i) A nucleotide sequence as shown in SEQ ID No. 61; or

[0128] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0129] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0130] The gene sthA has:

[0131] (i) A nucleotide sequence as shown in SEQ ID No. 62; or

[0132] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0133] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0134] The gene yahK has:

[0135] (i) A nucleotide sequence as shown in SEQ ID No. 63; or

[0136] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0137] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0138] The gene lysA has:

[0139] (i) A nucleotide sequence as shown in SEQ ID No. 64; or

[0140] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0141] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0142] The gene thrA has:

[0143] (i) A nucleotide sequence as shown in SEQ ID No. 65; or

[0144] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0145] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0146] The gene ppc has:

[0147] (i) A nucleotide sequence as shown in SEQ ID No. 66; or

[0148] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0149] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0150] The gene pntAB has:

[0151] (i) A nucleotide sequence as shown in SEQ ID No. 67; or

[0152] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0153] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0154] The gene MAnadk* has the following characteristics:

[0155] (i) A nucleotide sequence as shown in SEQ ID No. 68; or

[0156] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0157] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0158] The gene aspA has:

[0159] (i) A nucleotide sequence as shown in SEQ ID No. 69; or

[0160] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0161] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii);

[0162] The gene rhtA has:

[0163] (i) A nucleotide sequence as shown in SEQ ID No. 70; or

[0164] (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or

[0165] (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

[0166] Thirdly, the present invention also provides a method for constructing the genetically engineered bacteria.

[0167] In some specific embodiments of the present invention, the construction method includes any one or more of the following steps:

[0168] Step (A): Knock out the homoserine kinase encoding gene thrB in the genome of strain E. coli K12 W3110;

[0169] Step (B): Knock out the homoserine O-succinyltransferase encoding gene metA in the genome of strain E. coli K12 W3110, and integrate P into the gene at that site. em7 The -thrA sequence was used to overexpress the gene encoding aspartate kinase I-homoserine dehydrogenase I;

[0170] Step (C): Knock out the pyruvate kinase encoding gene pykA in the genome of strain E. coli K12 W3110 and integrate P into the gene at that site. tac -ppc sequence to overexpress the gene encoding phosphoenolpyruvate carboxylase;

[0171] Step (D): Using P in the genome of strain E. coli K12 W3110 tac In situ promoter replacement of the rhtA gene was performed to enhance the expression of the homoserine extracellular transporter gene rhtA;

[0172] Step (E): The soluble pyridine nucleotide transhydrogenase encoding gene sthA was knocked out in the genome of strain E. coli K12 W3110, and P was integrated into the genome at that site. tac The pntAB sequence was used to overexpress the pntAB gene, which encodes pyridine nucleotide transhydrogenase.

[0173] Step (F): Knock out the NADPH-dependent aldehyde reductase-encoding gene yahK in the genome of strain E. coli K12 W3110 and integrate the strong promoter P at that site. tac And the MAnadk* sequence of the nicotinamide adenine dinucleotide kinase encoding gene derived from Micrococcus sp. ACRRV with a G210E / I219N / S220K three-point mutation, which encodes a sodium polyphosphate-dependent NAD kinase;

[0174] Step (G): Using P in the genome of strain E. coli K12 W3110 tac The promoter undergoes in situ promoter substitution of aspA, thereby enhancing the expression of the aspartate acyltransferase-encoding gene aspA; and / or

[0175] Step (H): The start codon ATG of lysA in the genome of strain E.coli K12 W3110 was replaced with GTG, which has a relatively weak translation initiation efficiency, thereby weakening the expression of the diaminopimelic acid decarboxylase encoding gene lysA.

[0176] There is no specific order between the steps; they can be performed individually or combined in any way.

[0177] Fourthly, the present invention also provides a genetically engineered bacterium for fermentation production of L-homoserine obtained by the construction method described above.

[0178] Fifthly, the present invention also provides the application of the genetically engineered bacteria in the fermentation production of L-homoserine.

[0179] In a sixth aspect, the present invention also provides a method for producing L-homoserine by fermentation, wherein the genetically engineered bacteria are selected for fermentation, the fermentation broth is collected, purified, and L-homoserine is obtained.

[0180] In this invention, Escherichia coli K12 W3110 is used as the chassis strain, and at least one of steps (A) to (H) is performed to construct recombinant Escherichia coli. This invention improves the production performance of recombinant Escherichia coli by pulling carbon flow to the product, weakening the TCA pathway, and enhancing reducing power supply. Specifically, steps (A) to (H) achieve the following effects: In step (A), the homoserine kinase encoding gene thrB is knocked out to reduce the homoserine degradation pathway;

[0181] In step (B), the homoserine O-succinyltransferase encoding gene metA is knocked out, and the aspartate kinase I-homoserine dehydrogenase I encoding gene thrA is integrated and inserted at this site; in order to reduce the synthesis of O-succinylhomoserine from homoserine while enhancing the aspartate to homoserine synthesis pathway and promoting the accumulation of homoserine.

[0182] Step (C) involves knocking out the pyruvate kinase encoding gene pykA in the genome of strain Escherichia coli K12 W3110 and integrating the phosphoenolpyruvate carboxylase encoding gene ppc into that site to increase the metabolic synthesis of oxaloacetate and promote the accumulation of homoserine.

[0183] Step (D) enhances the expression of the rhtA gene encoding the homoserine efflux transporter in the genome of strain E.coli K12 W3110, reduces product inhibition, and promotes homoserine synthesis;

[0184] Step (E) involves knocking out the sthA gene in the genome of strain E. coli K12 W3110 and simultaneously integrating the pntAB gene at that site to increase the intracellular content of reducing power coenzyme II; Step (F) involves knocking out the yahK gene in the genome of strain E. coli K12 W3110 and simultaneously integrating the MAnadk* gene to increase the intracellular content of reducing power coenzyme II.

[0185] Step (G) enhances the expression of the aspartate acylase-encoding gene aspA in the genome of strain E. coli K12 W3110, thereby increasing aspartate synthesis and promoting the accumulation of homoserine.

[0186] Step (H) weakened the expression of the lysA gene encoding diaminopimelic acid decarboxylase in the genome of strain E.coli K12 W3110, inhibiting the synthesis of L-lysine from the breakdown of aspartic acid semialdehyde and promoting the accumulation of L-homoserine.

[0187] By performing at least one of the above construction steps, a recombinant Escherichia coli that efficiently produces L-homoserine can be constructed.

[0188] Furthermore, by combining and executing the above 8 construction steps, the present invention successfully obtained recombinant Escherichia coli that efficiently produces L-homoserine.

[0189] The homoserine kinase encoding gene thrB has the nucleotide sequence shown in SEQ ID No. 59;

[0190] The homoserine O-succinyltransferase encoding gene metA has the nucleotide sequence shown in SEQ ID No. 60;

[0191] The pyruvate kinase I encoding gene pykA has the nucleotide sequence shown in SEQ ID No. 61;

[0192] The nucleotide sequence of the NADPH-dependent short-chain dehydrogenase encoding gene sthA is shown in SEQ ID No. 62;

[0193] The nucleotide sequence of the gene yahK is shown in SEQ ID No. 63;

[0194] The nucleotide sequence of the lysA gene encoding the diaminopimelic acid decarboxylase is shown in SEQ ID No. 64;

[0195] The nucleotide sequence encoding the aspartate kinase I-homoserine dehydrogenase I gene, thrA, is shown in SEQ ID No. 65.

[0196] The nucleotide sequence of the phosphoenolpyruvate carboxylase encoding gene ppc is shown in SEQ ID No. 66;

[0197] The nucleotide sequence of the pntAB gene encoding the pyridine nucleotide transhydrogenase is shown in SEQ ID No. 67;

[0198] The nucleotide sequence of the gene encoding nicotinamide adenine dinucleotide kinase MAnadk* is shown in SEQ ID No. 68;

[0199] The nucleotide sequence of the aspartate ammonia-lyase encoding gene aspA is shown in SEQ ID No. 69;

[0200] The nucleotide sequence of the homoserine extracellular transporter gene rhtA is shown in SEQ ID No. 70.

[0201] Further, the method involves inoculating any of the recombinant *E. coli* strains into a fermentation basal medium and fermenting at 35°C and 180-220 rpm. The culture medium is then separated and purified to obtain L-homoserine, which is preferred. The final composition of the fermentation basal medium is as follows: glucose 45 g / L, ammonium sulfate 17 g / L, yeast extract 4 g / L, potassium dihydrogen phosphate 2 g / L, MgSO4 1.5 g / L, sodium polyphosphate 1.2 g / L, L-threonine 0.40 g / L, L-methionine 0.4 g / L, calcium carbonate 0.1 g / L, FeSO4 0.01 g / L, MnSO4 0.01 g / L, ZnSO4 0.01 g / L, with deionized water as the solvent. The pH is 7.0, and the medium is sterilized by autoclaving at 121°C for 30 min.

[0202] Furthermore, before fermentation in the 50L fermenter, slant activation and seed culture are performed first. Then, the secondary seed culture is inoculated into the fermentation basal medium at a concentration of 5% by volume. The slant activation method is as follows: recombinant *E. coli* is inoculated onto LB plates and cultured overnight at 35°C to obtain slant cells. The seed culture method is as follows: a single colony of the slant cells is picked and inoculated into LB liquid medium and cultured overnight at 35°C and 200 rpm to obtain the primary seed culture. The primary seed culture is then inoculated into TB medium at a concentration of 10% by volume and cultured for 5 hours at 37°C and 200 rpm to obtain the secondary seed culture.

[0203] Compared with the prior art, the present invention has the following beneficial effects:

[0204] The recombinant *E. coli* strain modified in this invention is able to utilize carbon sources such as glucose for L-homoserine production more effectively than the wild type. Through multi-step modification, this invention yields a fermentation strain with optimal performance, achieving an L-homoserine accumulation level of 26.65 g / L after 48 hours of shake-flask fermentation and 147.6 g / L after 72 hours of fermentation in a 50L fermenter, with a sugar-acid conversion rate of 0.60 g / g and a space-time yield of 2.05 g / L / h. This L-homoserine accumulation level is among the highest in existing research, and the engineered strain does not carry plasmids, requiring no induction during fermentation and is easily controlled. Therefore, the recombinant *E. coli* strain provided by this invention has significant industrial application value. Attached Figure Description

[0205] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0206] Figure 1 The biomass OD of strain WH0-WH8 after 48 hours of shake-flask fermentation is shown. 600 Bar graph showing the concentrations of L-homoserine;

[0207] Figure 2 The biomass OD of strain WH8 during fed-batch fermentation in a 50L fermenter is shown. 600 Concentration curves of L-homoserine. Detailed Implementation

[0208] This invention discloses a genetically engineered bacterium for the efficient production of L-homoserine, its construction method, and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0209] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0210] Unless otherwise specified, the test materials used in the following examples are all conventional biochemical reagents, which are all available on the market. Please refer to the instruction manual for usage methods.

[0211] The primer synthesis and sequence sequencing in this invention were completed by Qingke Biotechnology Co., Ltd.

[0212] In the following examples, the term "enhancement" refers to increasing the activity of the enzyme encoded by the corresponding polynucleotide. This can be achieved by increasing the copy number of the gene or by replacing the expression regulatory sequence of the gene on the genome (such as promoter substitution).

[0213] In the following examples, the term "weakening" refers to reducing the activity of the enzyme encoded by the corresponding polynucleotide. This can be achieved by replacing the expression regulatory sequence of the gene on the genome (promoter substitution, start codon substitution, etc.).

[0214] In the following embodiments, the term "knockout" refers to the deletion of the relevant gene sequence, thereby eliminating the enzyme encoded by the corresponding polynucleotide within the genetically engineered bacteria.

[0215] In the following examples, the LB liquid culture medium consisted of: 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride, with deionized water as the solvent, and was sterilized at 121°C under high temperature and pressure for 30 min.

[0216] In the examples below, LB plates were prepared by adding agar to LB liquid medium at a final concentration of 20 g / L.

[0217] In the following examples, the TB culture medium consisted of: 12 g / L peptone, 24 g / L yeast extract, 5.04 g / L glycerol, 2.31 g / L dipotassium hydrogen phosphate, and 12.54 g / L potassium dihydrogen phosphate. The solvent was deionized water, and the medium was autoclaved at 121°C for 30 min.

[0218] The final composition of the fermentation medium in the following examples is as follows: glucose 45 g / L, ammonium sulfate 17 g / L, yeast extract 4 g / L, potassium dihydrogen phosphate 2 g / L, MgSO4 1.5 g / L, sodium polyphosphate 1.2 g / L, L-threonine 0.40 g / L, L-methionine 0.4 g / L, calcium carbonate 0.1 g / L, FeSO4 0.01 g / L, MnSO4 0.01 g / L, ZnSO4 0.01 g / L, deionized water as solvent, pH 7.0, autoclaved at 121°C for 30 min.

[0219] The culture medium in the following examples was: glucose 500 g / L, L-threonine 0.40 g / L, L-methionine 0.4 g / L, deionized water as solvent, and autoclaved at 121°C for 30 min.

[0220] The L-homoserine detection method in the following examples is as follows: Fermentation broth was centrifuged at 12000×g for 2 min, the precipitate was discarded, and the supernatant was diluted and the L-homoserine content was detected by HPLC. Detection conditions: Agilent C18 column (150 mm × 4.6 mm i.d., 5 μm); mobile phase: V(acetonitrile):V(water) = 40:60, flow rate: 0.3 mL / min, 0-15 min; mobile phase: V(acetonitrile):V(water) = 70:30, flow rate: 1 mL / min, 15.2-30 min; detection wavelength: 210 nm; column temperature: 30 ± 0.5℃. Derivatization reagent: 0.03 mol / L FMOC-Cl derivatization solution; buffer solution: 0.13 mol / L borate buffer solution with pH 9-10. Derivatization method: Take 0.5 mL of the centrifuged fermentation broth, add 1 mL of 0.13 mol / L borate buffer solution, and finally slowly add 1 mL of FMOC-Cl derivatization solution. Use a vortex apparatus (temperature: 30°C). o C, rotation speed: 400) oscillate for 30 min, then sample for analysis.

[0221] The following examples illustrate the preparation method for electrocompetent cells: After activating the relevant bacterial strains by streaking in LB solid medium, single colonies were picked and inoculated into LB liquid medium for overnight shaking culture. The overnight culture was then inoculated into LB liquid medium at a ratio of 1% and shaken for 2 hours until OD reached [value missing]. 600 At approximately 0.7 (logarithmic growth phase), transfer the bacterial culture to centrifuge tubes, centrifuge, and discard the supernatant. First, resuspend the cell pellet in pre-cooled sterile distilled water, centrifuge, and discard the supernatant. Then, resuspend the cell pellet in pre-cooled 10% glycerol solution, centrifuge, and discard the supernatant twice. Finally, resuspend the cells in pre-cooled 10% glycerol solution and aliquot for storage.

[0222] The electroporation method in the following examples is as follows: After adding plasmid DNA to competent cells and mixing well, the mixture is transferred to a pre-cooled electroporation cuvette to avoid immediate electroporation of air bubbles. 1 mL of preheated LB medium is quickly added and transferred to a 2 mL EP tube. The cells are then incubated at 37°C and 200 rpm for 1 h.

[0223] In the following examples, the pCas9 vector was derived from Addgene, catalog number: #62225.

[0224] In the following examples, the pTargetF vector was derived from Addgene, catalog number: #62226.

[0225] Table 1

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240]

[0241] The present invention will be further illustrated below with reference to the embodiments:

[0242] Example 1 Construction of WH1 strain

[0243] Using the NEB Q5® Site-Directed Mutagenesis Kit (catalog number E0552S), primers W1 and W2 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is ATTGCTCGGAGATGTAGTCA (as shown in SEQ ID No. 1), targeting the thrB gene. The mutated pTargetF was named pTargetF-thrB.

[0244] Using the E. coli K12 W3110 genome as a template, the upstream sequence of the thrB gene was amplified using primers W3 and W4 and Phanta Flash high-fidelity DNA polymerase. The downstream sequence of the thrB gene was amplified using primers W5 and W6. The upstream and downstream fragments were recovered by gel extraction and used as templates. Then, using overlapping PCR with primers W3 and W6 at both ends, the gene editing repair template Donor-thrB (thrB knockout) was obtained.

[0245] After electroporating the pCas9 plasmid into *E. coli* K12 W3110, the plasmid was plated on a plate containing 50 mg / L kanamycin resistance and incubated at 30°C to obtain the strain *E. coli* K12 W3110 / pCas9. A small amount of *E. coli* K12 W3110 / pCas9 bacterial culture was picked and placed in a 250 mL shake flask containing 50 mL of LB medium containing kanamycin. The culture was incubated at 30°C and 220 rpm. When the OD of the medium reached a certain level... 600 When the concentration was 0.2, arabinose was added to a final concentration of 10 mM for induction, and OD... 600Competent cells were prepared at a concentration of 0.4. 2 μL of pTargetF-thrB plasmid and 10 μL of Donor-thrB template DNA were electroporated into E. coli K12 W3110 / pCas9 competent cells. The cells were plated on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin and incubated at 30°C and 220 rpm. Single colonies with complete thrB gene knockout were identified using primers W3 and W6. Correctly sequenced single colonies were selected and cultured with 0.5 mM IPTG to eliminate the pTargetF-thrB plasmid, yielding the engineered E. coli K12 W3110ΔthrB / pCas.

[0246] The bacteria were further inoculated into non-resistant LB liquid medium and cultured at 37°C for 12 hours. The culture was then diluted and spread onto LB plates to obtain the engineered strain E. coli K12 W3110△thrB with pCas9 plasmid eliminated, which was named WH1.

[0247] thrB sgRNA target ATTGCTCGGAGATGTAGTCA (as shown in SEQ ID No. 1)

[0248] W1: GATGTAGTCAGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 2)

[0249] W2: TCCGAGCAATGACTAGTATTATACCTAGG (as shown in SEQ ID No. 3)

[0250] W3: GGGTGATGTTGCCGCTTTTATGG (as shown in SEQ ID No. 4)

[0251] W4: AGATTGTAGAGTTTCATGTCAGACTCCTAACTTCCATGAG (as shown in SEQ ID No. 5)

[0252] W5: GGAAGTTAGGAGTCTGACATGAAACTCTACAATCTGAAAG (as shown in SEQ ID No. 6)

[0253] W6: GTCACTGGCTTATCACCCGCAAT (as shown in SEQ ID No. 7).

[0254] Example 2 Construction of WH2 strain

[0255] Using the NEB Site Directed Mutagenesis Kit (catalog number E0552S), primers W7 and W8 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is AACTTCTCGTGCGTCTGGTC (as shown in SEQ ID No. 8), targeting the metA gene. The mutated pTargetF was named pTargetF-metA.

[0256] Using E. coli K12 W3110 genomic DNA as a template, primers were designed to clone the nucleotide sequence of the reading frame thrA, and primers were designed to add P to the ATG terminus of thrA via PCR. em7 Promoter sequence construction P em7 -thrA, P em7 -thrA template contains homologous arms for subsequent fusion PCR; using the E. coli K12 W3110 genome as a template, the upstream sequence of the metA gene was amplified using primers W9, W10 and Phanta Flash high-fidelity DNA polymerase, and the downstream sequence of the metA gene was amplified using primers W11 and W12. After gel extraction and recovery of the upstream and downstream fragments, P was added to each fragment. em7 -thrA's anterior and posterior homologous arms; using primers G9 and G12 at both ends, the repair template Donor-thrA containing the thrA gene knock-in frame was obtained by overlapping PCR.

[0257] After electroporating the pCas9 plasmid into WH1 cells, the cells were plated on plates containing 50 mg / L kanamycin and cultured at 30°C to obtain strain WH1 / pCas9. WH1 / pCas9 bacterial colonies were picked and cultured in 250 mL shake flasks containing 50 mL of LB broth containing kanamycin at 30°C and 220 rpm. When the OD600 of the medium reached 0.2, 10 mM arabinose was added for induction. Competent cells were prepared when the OD600 reached 0.4. 2 μL of pTargetF-metA plasmid and 10 μL of Donor-thrA template DNA were electroporated into WH1 / pCas9 competent cells and plated on plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C and 220 rpm. Primers W9 and W12 were used to identify complete knockout of the metA gene and P... em7 Single colonies with -thrA knock-in were selected. Correctly sequenced single colonies were cultured with 0.5 mM IPTG to eliminate the pTargetF-metA plasmid, yielding the engineered E. coli K12 W3110ΔthrBΔmetA::P. em7 -thrA / pCas.

[0258] The bacteria were further inoculated into antibiotic-free LB liquid medium and cultured at 37°C for 12 hours. The resulting culture was then diluted and plated on LB agar plates to obtain the engineered strain *E. coli* K12 W3110ΔthrB ΔmetA::P, which eliminated the pCas plasmid. em7 -thrA, named WH2.

[0259] metA sgRNA target AACTTCTCGTGCGTCTGGTC (as shown in SEQ ID No. 8)

[0260] G7: GCGTCTGGTCGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 9)

[0261] G8: ACGAGAAGTTGACTAGTATTATACCTAGG (as shown in SEQ ID No. 10)

[0262] G9: CGATAAACAGCGCATCCATATGC (as shown in SEQ ID No. 11)

[0263] G10: AACCTGATTACCTCACTACATACGC (as shown in SEQ ID No. 12)

[0264] G11: TCTTCTGTGATAGTCGATCGTTAAGC (as shown in SEQ ID No. 13)

[0265] G12: GAATTTGCTTCTCCTGCTCGCC (as shown in SEQ ID No. 14)

[0266] Example 3 Construction of WH3 strain

[0267] Using the NEB Site Directed Mutagenesis Kit (catalog number E0552S), primers W13 and W14 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is CTTGAAAAAGTTATCGCGGC (as shown in SEQ ID No. 15), targeting the pykA gene. The mutated pTargetF was named pTargetF-pykA.

[0268] Using E. coli K12 W3110 genomic DNA as a template, primers were designed to clone ppc to develop the reading frame nucleotide sequence, and primers were designed to add P to the ATG end of ppc via PCR. tac Promoter sequence construction P tac - ppc, Ptac - The ppc template contains homologous arms for subsequent fusion PCR; using the E. coli K12 W3110 genome as a template, the upstream sequence of the pykA gene was amplified using primers W15, W16 and Phanta Flash high-fidelity DNA polymerase, and the downstream sequence of the pykA gene was amplified using primers W17, W18. After gel extraction and recovery of the upstream and downstream fragments, P was added to the ppc template. tac -The front and rear homologous arms of ppc; using primers G15 and G18 at both ends, the repair template Donor-ppc containing the ppc gene knock-in frame was obtained by overlapping PCR.

[0269] After electroporating the pCas9 plasmid into WH2 cells, the cells were plated on plates containing 50 mg / L kanamycin and cultured at 30°C to obtain strain WH2 / pCas9. WH2 / pCas9 bacterial colonies were picked and cultured in 250 mL shake flasks containing 50 mL of LB broth containing kanamycin at 30°C and 220 rpm. When the OD600 of the medium reached 0.2, 10 mM arabinose was added for induction. Competent cells were prepared when the OD600 reached 0.4. 2 μL of pTargetF-pykA plasmid and 10 μL of Donor-ppc template DNA were electroporated into WH2 / pCas9 competent cells and plated on plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C and 220 rpm. Primers W15 and W18 were used to identify complete knockout of the pykA gene and P… tac -ppc knock-in single colonies. Select single colonies with correct sequencing, add 0.5 mM IPTG for culture, eliminate pTargetF-pykA plasmid, and obtain engineered E. coli K12 W3110△thrB △metA::P em7 -thrA △pykA::P tac -ppc / pCas.

[0270] The bacteria were further inoculated into antibiotic-free LB liquid medium and cultured at 37°C for 12 hours. The resulting culture was then diluted and plated on LB agar plates to obtain the engineered strain *E. coli* K12 W3110ΔthrB ΔmetA::P, which eliminated the pCas plasmid. em7 -thrA △pykA::P tac -ppc, named WH3.

[0271] The pykA sgRNA target is CTTGAAAAAGTTATCGCGGC (as shown in SEQ ID No. 15).

[0272] G13: TTATCGCGGCGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 16)

[0273] G14: CTTTTTCAAGGACTAGTATTATACCTAGG (as shown in SEQ ID No. 17)

[0274] G15: GAAGCAACGCTGGCAATTACCC (as shown in SEQ ID No. 18)

[0275] G16: GTAATACTCCGTTGACTGAAACAACC (as shown in SEQ ID No. 19)

[0276] G17: GTACGTTGCCGGATGCGGC (as shown in SEQ ID No. 20)

[0277] G18: AAGACGCATCGTCTGACGATTCAG (as shown in SEQ ID No. 21)

[0278] Example 4 Construction of WH4 strain

[0279] Using the NEB Site-Directed Mutagenesis Kit (catalog number E0552S), primers G19 and G20 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is GCGCATTTTAGTCAAAACGG (as shown in SEQ ID No. 22), targeting a nearby sequence outside the rhtA gene. The mutated pTargetF was named pTargetF-rhtA.

[0280] Using the E. coli K12 W3110 genome as a template, the upstream sequence of the target site was amplified using primers G21 and G22 and Phanta Flash high-fidelity DNA polymerase. The downstream sequence of the target site was amplified using primers G23 and G24. After gel extraction and recovery, P was added to each sequence. tac The promoter sequence homologous arm was used for fusion PCR with primers G21 and G24 at both ends, followed by gel extraction to obtain P-containing homologous arms. tac Donor-P, the repair template for the starter key input box tac .

[0281] After electroporating the pCas9 plasmid into WH3, the plasmid was plated on a plate containing 50 mg / L kanamycin resistance and incubated at 30°C to obtain strain WH3 / pCas9. WH3 / pCas9 bacterial colonies were picked and placed in 250 mL shake flasks containing 50 mL of LB broth containing kanamycin and incubated at 30°C and 220 rpm. When the OD of the medium reached... 600 When the concentration was 0.2, arabinose was added to a final concentration of 10 mM for induction, and OD... 600 Competent cells were prepared at a concentration of 0.4. 2 μL of pTargetF-rhtA plasmid and 10 μL of Donor-P were added. tac Template DNA was electroporated into WH3 / pCas9 competent cells, plated on plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and incubated at 30°C and 220 rpm. P was identified using primers G21 and G24. tac Single colonies with promoter base knock-in were selected. Colonies with correct sequencing were cultured with 0.5 mM IPTG to eliminate the pTargetF-rhtA plasmid, yielding the engineered E. coli K12 W3110△thrB △metA::P em7 -thrA △pykA::P tac -ppc P tac -rhtA / pCas.

[0282] The bacteria were further inoculated into antibiotic-free LB liquid medium and cultured at 37°C for 12 hours. The resulting culture was then diluted and plated on LB agar plates to obtain the engineered strain *E. coli* K12 W3110△thrB △metA::P, which eliminated the pCas9 plasmid. em7 -thrA △pykA::P tac -ppc P tac -rhtA, named WH4.

[0283] sgRNA target GCGCATTTTAGTCAAAACGG (as shown in SEQ ID No. 22)

[0284] G19: GTCAAAACGGGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 23)

[0285] G20: TAAAATGCGCGACTAGTATTATACCTAGG (as shown in SEQ ID No. 24)

[0286] G21: CAGGTTGAAACCGCCCATTTTGTTC (as shown in SEQ ID No. 25)

[0287] G22: GTTGAAAAAATTTCCCCCAGGATTGATGGAATCATTAGTCTGG (as shown in SEQ ID No. 26)

[0288] G23: GGGAAAATTTTTTCAACAAATGCTCAACCAGCATTGGGTATATCC (as shown in SEQ ID No. 27)

[0289] G24: CCCAGCGGTACTGTCTGAATAG (as shown in SEQ ID No. 28)

[0290] Example 5 Construction of WH5 strain

[0291] Using the NEB Site Directed Mutagenesis Kit (catalog number E0552S), primers W25 and W26 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is CGTTATCAAAATGTTGGCGG (as shown in SEQ ID No. 29), targeting the sthA gene. The mutated pTargetF was named pTargetF-sthA.

[0292] Using E. coli K12 W3110 genomic DNA as a template, primers were designed to clone the pntAB nucleotide sequence, and primers were designed to add P to the 5' end of pntAB via PCR. tac Promoter sequence construction P tac -pntAB, P tac The pntAB template contains homologous arms for subsequent fusion PCR. Using the E. coli K12 W3110 genome as a template, the upstream sequence of the sthA gene was amplified using primers W27, W28 and Phanta Flash high-fidelity DNA polymerase. The downstream sequence of the sthA gene was amplified using primers W29 and W30. After gel extraction and recovery of the upstream and downstream fragments, P was added to the template. tac -The front and rear homologous arms of pntAB; using primers G27 and G30 at both ends, the repair template Donor-pntAB containing the pntAB gene knock-in frame was obtained by overlapping PCR.

[0293] After electroporating the pCas9 plasmid into WH4 cells, the cells were plated on plates containing 50 mg / L kanamycin and cultured at 30°C to obtain strain WH4 / pCas9. WH4 / pCas9 bacterial colonies were picked and cultured in 250 mL shake flasks containing 50 mL of kanamycin-containing LB medium at 30°C and 220 rpm. When the OD600 of the medium reached 0.2, 10 mM arabinose was added for induction. Competent cells were prepared when the OD600 reached 0.4. 2 μL of pTargetF-sthA plasmid and 10 μL of Donor-pntAB template DNA were electroporated into WH4 / pCas9 competent cells and plated on plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C and 220 rpm. Primers W27 and W30 were used to identify complete knockout of the sthA gene and P… tac Single colonies knocked in with pntAB were selected. Correctly sequenced single colonies were cultured with 0.5 mM IPTG to eliminate the pTargetF-sthA plasmid, yielding the engineered E. coli K12 W3110△thrB △metA::P em7 -thrA △pykA::P tac -ppc P tac -rhtA △sthA::P tac -pntAB / pCas.

[0294] The bacteria were further inoculated into antibiotic-free LB liquid medium and cultured at 37°C for 12 hours. The resulting culture was then diluted and plated on LB agar plates to obtain the engineered strain *E. coli* K12 W3110ΔthrB ΔmetA::P, which eliminated the pCas plasmid. em7 -thrA △pykA::P tac -ppc P tac -rhtA △sthA::Ptac-pntAB, named WH5.

[0295] The sthA sgRNA target is CGTTATCAAAATGTTGGCGG (as shown in SEQ ID No. 29).

[0296] G25: ATGTTGGCGGGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 30)

[0297] G26: TTTGATAACGGACTAGTATTATACCTAGG (as shown in SEQ ID No. 31)

[0298] G27: CATCACGATGTCTGAATCCTTGCC (as shown in SEQ ID No. 32)

[0299] G28: GGTAGGGCTTACCTGTTCTTATAC (as shown in SEQ ID No. 33)

[0300] G29: AACTTTATCGAAATGGCCATCCATTCTTG (as shown in SEQ ID No. 34)

[0301] G30: CTGATGCTGGAAGATGGTCACTG (as shown in SEQ ID No. 35)

[0302] Example 6 Construction of WH6 strain

[0303] Using the NEB Site Directed Mutagenesis Kit (catalog number E0552S), primers W31 and W32 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is TTGAACCGATGGATATCACC (as shown in SEQ ID No. 36), targeting the yahK gene. The mutated pTargetF was named pTargetF-yahK.

[0304] After codon optimization of MAnadk* based on the codon preference of E. coli K12 W3110, P was synthesized by Qingke Biotechnology. tac -MAnadk*,P tac -MAnadk* template contains homologous arms for subsequent fusion PCR; using the E. coli K12 W3110 genome as a template, the upstream sequence of the yahK gene was amplified using primers W33, W34 and Phanta Flash high-fidelity DNA polymerase, and the downstream sequence of the yahK gene was amplified using primers W35, W36. After gel extraction and recovery of the upstream and downstream fragments, P was added respectively. tac -The anterior and posterior homologous arms of MAnadk*; using primers G33 and G36 at both ends, the repair template Donor-MAnadk* containing the MAnadk* gene knock-in frame was obtained by overlapping PCR.

[0305] After electroporating the pCas9 plasmid into WH5 cells, the cells were plated on a plate containing 50 mg / L kanamycin and cultured at 30°C to obtain strain WH5 / pCas9. WH5 / pCas9 bacterial colonies were picked and cultured in 250 mL shake flasks containing 50 mL of kanamycin in LB broth, at 30°C and 220 rpm. When the OD600 of the medium reached 0.2, 10 mM arabinose was added for induction. Competent cells were prepared when the OD600 reached 0.4. 2 μL of pTargetF-yahK plasmid and 10 μL of Donor-MAnadk* template DNA were electroporated into WH5 / pCas9 competent cells and plated on a plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C and 220 rpm. Primers W33 and W36 were used to identify complete knockout of the yahK gene and P... tac -MAnadk* knock-in single colonies. Select single colonies with correct sequencing, add 0.5 mM IPTG for culture, eliminate pTargetF-yahK plasmid, and obtain engineered E. coli K12 W3110△thrB △metA::P em7 -thrA △pykA::P tac -ppc P tac -rhtA △sthA::P tac -pntAB △yahK::P tac -MAnadk* / pCas.

[0306] The bacteria were further inoculated into antibiotic-free LB liquid medium and cultured at 37°C for 12 hours. The resulting culture was then diluted and plated on LB agar plates to obtain the engineered strain *E. coli* K12 W3110ΔthrB ΔmetA::P, which eliminated the pCas plasmid. em7 -thrA △pykA::P tac -ppc P tac -rhtA △sthA::P tac -pntAB △yahK::P tac -MAnadk*, named WH6.

[0307] yahK sgRNA target TTGAACCGATGGATATCACC (as shown in SEQ ID No. 36)

[0308] G31: GGATATCACCGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 37)

[0309] G32: ATCGGTTCAAGACTAGTATTATACCTAGG (as shown in SEQ ID No. 38)

[0310] G33: GTAAGAGATTTAAGCCCCAGGGAG (as shown in SEQ ID No. 39)

[0311] G34: TGTGTTTACTCCTGATTAGCTATGTG (as shown in SEQ ID No. 40)

[0312] G35: AAAAATTAATAAATACCCTGTGGTTTAAC (as shown in SEQ ID No. 41)

[0313] G36: GAATATATCGACACAGGAAACCAG (as shown in SEQ ID No. 42)

[0314] Example 7 Construction of WH7 strain

[0315] Using the NEB Site-Directed Mutagenesis Kit (catalog number E0552S), primers W37 and W38 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is CCTAAGCAGCATATGATCT (as shown in SEQ ID No. 43), targeting a nearby sequence outside the aspA gene. The mutated pTargetF was named pTargetF-aspA.

[0316] Using the E. coli K12 W3110 genome as a template, the upstream sequence of the target site was amplified using primers W39 and W40 and Phanta Flash high-fidelity DNA polymerase. The downstream sequence of the target site was amplified using primers W41 and W42. After gel extraction and recovery, P was added to each sequence. tac The promoter sequence homologous arm was used for fusion PCR with primers W39 and W42 at both ends, followed by gel extraction to obtain P-containing homologous arms. tac Donor-P, the repair template for the starter key input box tac .

[0317] After electroporating the pCas9 plasmid into WH6, the plasmid was plated on a plate containing 50 mg / L kanamycin resistance and incubated at 30°C to obtain strain WH6 / pCas9. WH6 / pCas9 bacterial colonies were picked and placed in 250 mL shake flasks containing 50 mL of LB broth containing kanamycin and incubated at 30°C and 220 rpm. When the OD of the medium reached... 600 When the concentration was 0.2, arabinose was added to a final concentration of 10 mM for induction, and OD... 600Competent cells were prepared at a concentration of 0.4. 2 μL of pTargetF-aspA plasmid and 10 μL of Donor-P were added. tac Template DNA was electroporated into WH6 / pCas9 competent cells, plated on plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and incubated at 30°C and 220 rpm. P was identified using primers W39 and W42. tac Single colonies with promoter base knock-in were selected. Colonies with correct sequencing were cultured with 0.5 mM IPTG to eliminate the pTargetF-aspA plasmid, yielding the engineered strain *E. coli* K12 W3110△thrB △metA::P em7 -thrA △pykA::P tac -ppc P tac -rhtA △sthA::P tac -pntAB △yahK::P tac -MAnadk* P tac -aspA / pCas.

[0318] The bacteria were further inoculated into antibiotic-free LB liquid medium and cultured at 37°C for 12 hours. The resulting culture was then diluted and plated on LB agar plates to obtain the engineered strain *E. coli* K12 W3110△thrB △metA::P, which eliminated the pCas9 plasmid. em7 -thrA △pykA::P tac -ppc P tac -rhtA △sthA::P tac -pntAB △yahK::P tac -MAnadk* P tac -aspA, named WH7.

[0319] sgRNA target CCTCAGCAGCATATGATCT (as shown in SEQ ID No. 43)

[0320] G37: GCATATGATCTGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 44)

[0321] G38: TGCTTGAGGGACTAGTATTATACCTAGG (as shown in SEQ ID No. 45)

[0322] G39: GCACGAAATTCTTAAAGCCCTGG (as shown in SEQ ID No. 46)

[0323] G40: CGACCGAATACCCGATTTCTACCGTAATCTGGATCACTTTAAG (as shown in SEQ ID No. 47)

[0324] G41: AAATCGGGTATTCGGTCGATGCAGGGGATAATCGTCGGTC (as shown in SEQ ID No. 48)

[0325] G42: CGTTGTTCAGGACTTCATCACATG (as shown in SEQ ID No. 49)

[0326] Example 8 Construction of WH8 strain

[0327] In the genome of strain E.coli K12 W3110, the start codon ATG of lysA was replaced with GTG, which has a relatively weaker translation initiation efficiency, thereby weakening the expression of the diaminopimelic acid decarboxylase encoding gene lysA.

[0328] Using the NEB Site-Directed Mutagenesis Kit (catalog number E0552S), primers W43 and W44 were designed to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is CATTCACTGTTCAGCACCGA (as shown in SEQ ID No. 50), targeting a nearby sequence outside the lysA gene. The mutated pTargetF was named pTargetF-lysA.

[0329] Using the E. coli K12 W3110 genome as a template, the upstream sequence of the target site was amplified using primers W45 and W46 and Phanta Flash high-fidelity DNA polymerase. The downstream sequence of the target site was amplified using primers W47 and W48. The upstream and downstream fragments were recovered by gel extraction. Using these two fragments as templates, fusion PCR was performed using primers W45 and W48 at both ends, followed by gel extraction to obtain the repair template Donor-GTG containing the start codon ATG replaced with the GTG knock-in frame.

[0330] After electroporating the pCas9 plasmid into WH7, the plasmid was plated on a plate containing 50 mg / L kanamycin resistance and incubated at 30°C to obtain strain WH7 / pCas9. WH7 / pCas9 bacterial colonies were picked and placed in 250 mL shake flasks containing 50 mL of LB broth containing kanamycin and incubated at 30°C and 220 rpm. When the OD of the medium reached... 600 When the concentration was 0.2, arabinose was added to a final concentration of 10 mM for induction, and OD... 600Competent cells were prepared at a concentration of 0.4. 2 μL of pTargetF-lysA plasmid and 10 μL of Donor-GTG template DNA were electroporated into WH7 / pCas9 competent cells and plated on double-antibiotic plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C and 220 rpm. Single colonies with GTG knock-in were identified using primers W45 and W48. Correctly sequenced single colonies were selected, and 0.5 mM IPTG was added for culture to eliminate the pTargetF-lysA plasmid, yielding the engineered E. coli K12 W3110△thrB △metA::P em7 -thrA △pykA::P tac -ppc P tac -rhtA △sthA::P tac -pntAB △yahK::P tac -MAnadk*P tac -aspA GTG-lysA / pCas.

[0331] The bacteria were further inoculated into antibiotic-free LB liquid medium and cultured at 37°C for 12 hours. The resulting culture was then diluted and plated on LB agar plates to obtain the engineered strain *E. coli* K12 W3110△thrB △metA::P, which eliminated the pCas9 plasmid. em7 -thrA △pykA::P tac -ppc P tac -rhtA △sthA::P tac -pntAB △yahK::P tac -MAnadk* P tac -aspA GTG-lysA, named WH8.

[0332] sgRNA target CATTCACTGTTCAGCACCGA (as shown in SEQ ID No. 50)

[0333] G43: TCAGCACCGAGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID No. 51)

[0334] G44: ACAGTGAATGGACTAGTATTATACCTAGG (as shown in SEQ ID No. 52)

[0335] G45: AGGCAGGCAATAGACAGTTCTCC (as shown in SEQ ID No. 53)

[0336] G46: CACAACAAACTCCAGATAAGTGCTTTTTTATGATTACGCCACATC (as shown in SEQ ID No. 54)

[0337] G47: TTATCTGGAGTTTGTTGTGCCACATTCACTGTTCAGCACCGATAC (as shown in SEQ ID No. 55)

[0338] G48: CGAAACCTGGCCCAGTTGGTC (as shown in SEQ ID No. 56)

[0339] Example 9: Shake-flask fermentation experiment

[0340] (1) Seed culture

[0341] L-homoserine genetically engineered bacteria WH1, WH2, WH3, WH4, WH5, WH6, WH7, and WH8 were inoculated onto LB agar slants, with E. coli K12 W3110 as a control. The cultures were incubated overnight at 35°C and 200 rpm. Then, a single colony was picked and inoculated into 5 ml of LB agar, and incubated overnight at 35°C with a rotation speed of 200 rpm to obtain the seed culture.

[0342] (2) Fermentation culture

[0343] Add 50 ml of fermentation medium to a 250 ml shake flask, and inoculate the seed culture into the fermentation medium at a 2% inoculum. Incubate at 200 rpm in a shaker incubator at 35°C for 48 hours. Take a certain amount of fermentation broth from the shake flask, lyse the cells, centrifuge, and collect the supernatant. Dilute the supernatant with ultrapure water in a gradient manner to an L-homoserine concentration of 0.1-1 g / L. After filtration, detect the L-homoserine content in the fermentation broth using high-performance liquid chromatography (HPLC). Finally, compare the L-homoserine content obtained from different genotype strains. The results of the shake-flask fermentation experiment of the metabolically modified strain are shown in the table below:

[0344] Table 2

[0345]

[0346] Example 10: Fermentation Experiment in a 50L High-Density Tank

[0347] (1) Seed culture

[0348] The three genetically engineered bacteria with the highest L-homoserine production in the shake-flask experiment, namely WH6, WH7, and WH8, were inoculated onto LB solid medium slant, with E. coli K12 W3110 as a control. They were cultured overnight at 35°C. Then, several single colonies were picked and inoculated into 100 ml of LB medium and cultured overnight at 35°C with a rotation speed of 200 rpm to obtain the primary seed culture. The primary seed culture was then inoculated into 1000 ml of TB medium and cultured at 37°C with a rotation speed of 200 rpm for 5 h to obtain the secondary seed culture.

[0349] (2) Fermentation culture

[0350] Add 20L of basal fermentation medium to a 50L fermenter, and then add 1000ml of secondary seed culture to the fermenter. The fermentation cycle is 48-96 hours. During fermentation, control the culture temperature at 35℃, maintain the pH at 7.0±0.1 by adding ammonia, introduce 1.5±0.5 vvm of air to provide dissolved oxygen, and maintain dissolved oxygen at 35%±5% by activating the agitation-coupled dissolved oxygen mode. Control the agitation speed at 300–600 rpm. Add the culture medium in batches to maintain residual sugar at 3±1 g / L.

[0351] (3) Detection of L-homoserine in fermentation broth

[0352] During fermentation, a certain amount of fermentation broth was taken every 5 hours. After cell lysis, the supernatant was collected by centrifugation and serially diluted with ultrapure water to achieve an L-homoserine concentration of 0.1 g / L-1 g / L. After filtration, the L-homoserine content in the fermentation broth was detected by high-performance liquid chromatography (HPLC). Finally, the amount of L-homoserine obtained from different genotype strains was compared. The results of the high-density fermentation experiment of the metabolically modified strains are shown in the table below:

[0353] Table 3

[0354]

[0355] As shown in Table 3, the metabolically modified WH8 strain, due to its ability to produce and accumulate L-homoserine extracellularly without carrying exogenous plasmids, can better utilize carbon sources such as glucose for L-homoserine production compared to the wild-type strain. The modified strain with the best performance achieved an L-homoserine production level of 147.6 g / L after 72 hours of fermentation, with a sugar-acid conversion rate of 0.60 g / g and a space-time yield of 2.05 g / L / h.

[0356] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of any one of the following in constructing L-homoserine-producing strains and / or fermenting for the production of L-homoserine, characterized in that, (I) Knock out or weaken one or more of the following expressions: (I-1) The homoserine kinase encoding gene thrB; (I-2) The homoserine O-succinyltransferase encoding gene metA; (I-3) Pyruvate kinase encoding gene pykA; (I-4) The gene encoding sthA, a soluble pyridine nucleotide transhydrogenase; (I-5) The gene encoding NADPH-dependent aldehyde reductase yahK (I-6), the gene encoding diaminopimelic acid decarboxylase lysA and / or (II) Enhance the expression of any one or more of the following: (II-1) The gene thrA encoding aspartate kinase I-homoserine dehydrogenase I; (II-2) The gene encoding phosphoenolpyruvate carboxylase, ppc; (II-3) The gene pntAB, which encodes pyridine nucleotide transhydrogenase; (II-4) Sodium polyphosphate-dependent exogenously modified nicotinamide adenine dinucleotide kinase MAnadk*; (II-5) The aspartate ammonia-lyase encoding gene aspA; (II-6) rhtA, a gene encoding a homoserine extracellular transporter.

2. The application as described in claim 1, characterized in that, Escherichia coli K12 W3110 was used as the chassis strain.

3. The application as described in claim 1 or 2, characterized in that, The thrA, ppc, pntAB, MAnadk*, and / or aspA are expressed using strong promoters; As a preferred option, a strong promoter P is used. em7 The thrA was overexpressed; As a preferred option, a strong promoter P is used. tac Overexpression of the ppc, the pntAB gene, the MAnadk*, the aspA and / or the rhtA; Preferably, the strong promoter P tac have: (i) A nucleotide sequence as shown in SEQ ID No. 57; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); Preferably, the strong promoter P em7 have: (i) A nucleotide sequence as shown in SEQ ID No. 58; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

4. The application as described in any one of claims 1 to 3, characterized in that, Including any of the following: After knocking out thrB, replace the start codon ATG of lysA with GTG; and / or After knocking out metA, pykA, sthA, and / or yahK, the integrated gene is performed; preferably, the gene includes thrA, ppc, pntAB, and MAnadk*; preferably, MAnadk* is a variant derived from Micrococcus sp. ACRRV; and / or The overexpressed aspA and rhtA genes were replaced with in situ promoters.

5. The application as described in any one of claims 1 to 4, characterized in that, The thrB has: (i) A nucleotide sequence as shown in SEQ ID No. 59; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The metA has: (i) A nucleotide sequence as shown in SEQ ID No. 60; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The pykA has: (i) A nucleotide sequence as shown in SEQ ID No. 61; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene sthA has: (i) A nucleotide sequence as shown in SEQ ID No. 62; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene yahK has: (i) A nucleotide sequence as shown in SEQ ID No. 63; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene lysA has: (i) A nucleotide sequence as shown in SEQ ID No. 64; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene thrA has: (i) A nucleotide sequence as shown in SEQ ID No. 65; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene ppc has: (i) A nucleotide sequence as shown in SEQ ID No. 66; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene pntAB has: (i) A nucleotide sequence as shown in SEQ ID No. 67; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene MAnadk* has the following characteristics: (i) A nucleotide sequence as shown in SEQ ID No. 68; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene aspA has: (i) A nucleotide sequence as shown in SEQ ID No. 69; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene rhtA has: (i) A nucleotide sequence as shown in SEQ ID No. 70; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

6. A genetically engineered bacterium that produces high levels of L-homoserine, characterized in that, include: (I) Knock out or weaken one or more of the following expressions: (I-1) The homoserine kinase encoding gene thrB; (I-2) The homoserine O-succinyltransferase encoding gene metA; (I-3) Pyruvate kinase encoding gene pykA; (I-4) The gene encoding sthA, a soluble pyridine nucleotide transhydrogenase; (I-5) The gene encoding yahK, an NADPH-dependent aldehyde reductase; (I-6), the gene encoding diaminopimelic acid decarboxylase lysA; and / or (II) Enhance the expression of any one or more of the following: (II-1) The gene thrA encoding aspartate kinase I-homoserine dehydrogenase I; (II-2) The gene encoding phosphoenolpyruvate carboxylase, ppc; (II-3) The gene pntAB, which encodes pyridine nucleotide transhydrogenase; (II-4) Sodium polyphosphate-dependent exogenously modified nicotinamide adenine dinucleotide kinase MAnadk*; (II-5) The aspartate ammonia-lyase encoding gene aspA; (II-6) rhtA, a gene encoding a homoserine extracellular transporter.

7. The genetically engineered bacterium as described in claim 6, characterized in that, Escherichia coli K12 W3110 was used as the chassis strain.

8. The genetically engineered bacteria as described in claim 6 or 7, characterized in that, The thrA, ppc, pntAB, MAnadk*, and / or aspA are expressed using strong promoters; As a preferred option, a strong promoter P is used. em7 The thrA was overexpressed; a strong promoter P was used. tac Overexpression of the ppc, the pntAB gene, the MAnadk*, the aspA and / or the rhtA; Preferably, the strong promoter P tac have: (i) A nucleotide sequence as shown in SEQ ID No. 57; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); Preferably, the strong promoter P em7 have: (i) A nucleotide sequence as shown in SEQ ID No. 58; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

9. The genetically engineered bacteria according to any one of claims 6 to 8, characterized in that, Including any of the following: After knocking out thrB, replace the start codon ATG of lysA with GTG; and / or After knocking out metA, pykA, sthA, and / or yahK, the integrated gene is performed; preferably, the gene includes thrA, ppc, pntAB, and MAnadk*; preferably, MAnadk* is a variant derived from Micrococcus sp. ACRRV; and / or The overexpressed aspA and rhtA genes were replaced with in situ promoters.

10. The genetically engineered bacteria according to any one of claims 6 to 9, characterized in that, The thrB has: (i) A nucleotide sequence as shown in SEQ ID No. 59; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The metA has: (i) A nucleotide sequence as shown in SEQ ID No. 60; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The pykA has: (i) A nucleotide sequence as shown in SEQ ID No. 61; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene sthA has: (i) A nucleotide sequence as shown in SEQ ID No. 62; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene yahK has: (i) A nucleotide sequence as shown in SEQ ID No. 63; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene lysA has: (i) A nucleotide sequence as shown in SEQ ID No. 64; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene thrA has: (i) A nucleotide sequence as shown in SEQ ID No. 65; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene ppc has: (i) A nucleotide sequence as shown in SEQ ID No. 66; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene pntAB has: (i) A nucleotide sequence as shown in SEQ ID No. 67; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene MAnadk* has the following characteristics: (i) A nucleotide sequence as shown in SEQ ID No. 68; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene aspA has: (i) A nucleotide sequence as shown in SEQ ID No. 69; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii); The gene rhtA has: (i) A nucleotide sequence as shown in SEQ ID No. 70; or (ii) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (i) or (ii), and which has the same or similar function to the nucleotide sequence shown in (i) or (ii); or (iii) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence described in (i), (ii) or (iii).

11. The method for constructing the genetically engineered bacteria as described in any one of claims 6 to 10.

12. The construction method as described in claim 11, characterized in that, Includes any one or more of the following steps: Step (A): Knock out the homoserine kinase encoding gene thrB in the genome of strain E. coli K12 W3110; Step (B): Knock out the homoserine O-succinyltransferase encoding gene metA in the genome of strain E. coli K12 W3110, and integrate P into the gene at that site. em7 The -thrA sequence was used to overexpress the gene encoding aspartate kinase I-homoserine dehydrogenase I; Step (C): Knock out the pyruvate kinase encoding gene pykA in the genome of strain E. coli K12 W3110 and integrate P into the gene at that site. tac -ppc sequence to overexpress the gene encoding phosphoenolpyruvate carboxylase; Step (D): Using P in the genome of strain E. coli K12 W3110 tac In situ promoter replacement of the rhtA gene was performed to enhance the expression of the homoserine extracellular transporter gene rhtA; Step (E): The soluble pyridine nucleotide transhydrogenase encoding gene sthA was knocked out in the genome of strain E. coli K12 W3110, and P was integrated into the genome at that site. tac The pntAB sequence was used to overexpress the pntAB gene, which encodes pyridine nucleotide transhydrogenase. Step (F): Knock out the NADPH-dependent aldehyde reductase encoding gene yahK in the genome of strain E. coli K12 W3110 and integrate the strong promoter P at that site. tac And the MAnadk* sequence of the nicotinamide adenine dinucleotide kinase encoding gene derived from Micrococcus sp. ACRRV with a G210E / I219N / S220K three-point mutation, which encodes a sodium polyphosphate-dependent NAD kinase; Step (G): Using P in the genome of strain E. coli K12 W3110 tac The promoter undergoes in situ promoter substitution of aspA, thereby enhancing the expression of the aspartate acyltransferase-encoding gene aspA; and / or Step (H): The start codon ATG of lysA in the genome of strain E.coli K12 W3110 was replaced with GTG, which has a relatively weak translation initiation efficiency, thereby weakening the expression of the diaminopimelic acid decarboxylase encoding gene lysA. There is no specific order between the steps; they can be performed individually or combined in any way.

13. The genetically engineered bacteria for fermentation production of L-homoserine, constructed by the construction method as described in claim 11 or 12.

14. The use of the genetically engineered bacteria as described in any one of claims 6 to 10 or the genetically engineered bacteria as described in claim 13 in the fermentation production of L-homoserine.

15. A method for producing L-homoserine by fermentation, characterized in that, Select the genetically engineered bacteria as described in any one of claims 6 to 10 or as described in claim 13, ferment them, collect the fermentation broth, purify it, and obtain L-homoserine.

Citation Information

Patent Citations

  • A genetically engineered bacterium that produces L-homoserine and its applications

    CN112779204B

  • Recombinant escherichia coli with high yield of L-homoserine as well as construction method and application of recombinant escherichia coli

    CN116622607A

  • Genetically engineered bacterium for producing L-homoserine and application of genetically engineered bacterium

    CN117187151A

  • Genetically engineered bacterium with high yield of L-homoserine as well as construction method and application of genetically engineered bacterium

    CN117286087A

  • Genetic engineering strain for producing L-homoserine as well as construction method and application of genetic engineering strain

    CN117384811A