Application of PCK1 in preparation of products for regulating and controlling proliferation of goat testicular interstitial cells

By constructing an overexpression plasmid of the PCK1 gene and a small RNA interference fragment, the proliferation and gluconeogenesis of goat testicular interstitial cells were regulated, solving the problem of unclear PCK1 gene function in existing technologies, achieving effective regulation of cell proliferation and gluconeogenesis, and improving testicular development quality.

CN121801807APending Publication Date: 2026-04-07GUIZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-07
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

In the current technology, the gluconeogenesis and proliferation mechanism of goat testicular interstitial cells has not been fully elucidated, especially the role of the PCK1 gene in this process is unclear, affecting testicular development and reproductive function.

Method used

By constructing the PCK1 gene overexpression plasmid pcDNA3.1(+)-PCK1 and the small RNA interference fragment si-PCK1, the proliferation and gluconeogenesis of goat testicular interstitial cells were regulated. Cell proliferation and gluconeogenesis were promoted or inhibited by upregulating and downregulating the expression of the PCK1 gene, respectively.

Benefits of technology

It significantly promotes or inhibits the proliferation and gluconeogenesis of goat testicular interstitial cells, regulates the expression of related marker genes CCNB1 and CCNE2, and improves the quality of testicular development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure B8U7ZFOK0GSKB90HBRXJMVCEOOXIPQWRRELWOHBE
    Figure B8U7ZFOK0GSKB90HBRXJMVCEOOXIPQWRRELWOHBE
  • Figure PS0PN8FASTCHN8WEW82BRNH1L1YEK2HETWLMW78L
    Figure PS0PN8FASTCHN8WEW82BRNH1L1YEK2HETWLMW78L
  • Figure QYM2ONVFRKOKUKNH5WXVOTOC4THGXJLQP5T8HRBM
    Figure QYM2ONVFRKOKUKNH5WXVOTOC4THGXJLQP5T8HRBM
Patent Text Reader

Abstract

The invention relates to the technical field of genetic engineering, in particular to application of PCK1 in preparation of products for regulating and controlling goat testicular interstitial cell proliferation. According to the invention, an over-expression plasmid pcDNA3.1 (+)-PCK1 of the PCK1 gene is constructed, an interference sequence si-PCK1 of the PCK1 gene is synthesized, and it is proposed for the first time that the over-expression of the PCK1 gene can significantly promote the proliferation of goat testicular interstitial cells, and the inhibition of the expression of the PCK1 gene can significantly inhibit the proliferation of the goat testicular interstitial cells. The invention has important significance for improving the development of the goat testis, and provides technical support for researching and developing related products for regulating and controlling the proliferation of the goat testis interstitial cells by taking the PCK1 gene as the target spot.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to the application of PCK1 in the preparation of products that regulate the proliferation of goat testicular interstitial cells. Background Technology

[0002] In recent years, with the development of biomedical research, key mechanisms of reproductive system regulation have been clarified. Against this backdrop, testicular interstitial cells (LCs), as crucial cells in testicular development, have increasingly attracted attention for their role in androgen synthesis and spermatogenesis regulation. The functional activity of LCs is vital in testicular development. As major endocrine cells, LCs are not only responsible for androgen biosynthesis to maintain male reproductive function, but also directly or indirectly regulate seminiferous tubule homeostasis by secreting various factors. For example, testosterone secreted by LCs directly drives spermatogonial differentiation, meiosis, and spermatogenesis by activating androgen receptors (AR) in the seminiferous epithelium. In addition to testosterone, insulin-like growth factor 1 (IGF1) secreted by LCs promotes spermatocyte energy metabolism through the PI3K / AKT pathway, and its gene expression is regulated by the GATA4 / COUP-TFII transcriptional complex.

[0003] Adequate proliferation of ligands (LCs) is crucial for maintaining normal serum testosterone levels, which are closely related to fertility. Abnormal LC function leads to spermatogenesis failure, often manifesting as azoospermia. Metabolic abnormalities in LCs result in an imbalance in INSL3 and androgen receptor expression, further impairing spermatogenesis. Previous studies have largely focused on the androgen synthesis mechanism of LCs, while the role of LCs in gluconeogenesis and proliferation remains fully elucidated.

[0004] Gluconeogenesis is the reverse process of glycolysis, converting non-carbohydrate carbon sources, such as lactate, amino acids, and triglycerides, into glucose to maintain glucose homeostasis and meet the body's energy needs. PCK1 is the first rate-limiting enzyme in the gluconeogenesis pathway. Numerous studies have shown that the PCK1 gene plays a crucial role in disease development and treatment. In patients with fatty liver disease, PCK1 mRNA levels are reduced. Further research revealed that PCK1 deficiency in the liver leads to hepatitis and liver fibrosis in mice, causing a fatty liver phenotype and liver damage. In-depth studies have found that PCK1 causes hepatic metabolic disorders through the PI3K / AKT / PDGF axis, ultimately leading to fatty liver disease. In diabetic nephropathy, PCK1 is essential for mitochondrial function. PCK1 deficiency in renal tubular epithelial cells leads to mitochondrial ribosome defects and a decrease in mitochondrial membrane potential, ultimately causing mitochondrial dysfunction. Overexpression of the PCK1 gene can inhibit renal fibrosis by protecting mitochondrial ribosome function. Despite these important biological functions, the role of the PCK1 gene in goat testicular interstitial cells remains unclear.

[0005] Based on this, the present invention provides the application of PCK1 gene as a target in regulating the proliferation of goat testicular interstitial cells, aiming to overcome the shortcomings of the prior art and provide technical support for the research and development of products related to PCK1 gene-targeted regulation of goat testicular interstitial cell proliferation and gluconeogenesis. Summary of the Invention

[0006] The purpose of this invention is to provide the application of the PCK1 gene as a target in the preparation of products that regulate the proliferation of goat testicular interstitial cells.

[0007] Another objective of this invention is to provide the application of the PCK1 gene as a target in the preparation of products that regulate the expression of marker genes CCNB1 and CCNE2 related to the proliferation of goat testicular interstitial cells and products that regulate gluconeogenesis of goat testicular interstitial cells.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The application of the PCK1 gene as a target in the preparation of products that regulate the proliferation of goat testicular interstitial cells.

[0009] Preferably, in the application of the PCK1 gene as a target in the preparation of a product for regulating the proliferation of goat testicular interstitial cells, the product for regulating the proliferation of goat testicular interstitial cells targets the PCK1 gene and promotes the proliferation of goat testicular interstitial cells by upregulating the expression of the PCK1 gene through a PCK1 overexpression plasmid.

[0010] In a further preferred embodiment of the present invention, when the PCK1 gene is used as a target in the preparation of a product regulating the proliferation of goat testicular interstitial cells, the PCK1 overexpression plasmid is pcDNA3.1(+)-PCK1, and its construction method is as follows: S1. Extract cDNA from testicular interstitial cells, and use the cDNA as a template for PCR amplification of the PCK1 gene to obtain the target fragment of the PCK1 gene. S2. The obtained target gene fragment is ligated into the pcDNA3.1 vector digested with restriction endonucleases XbaI and kpn1 to obtain the pcDNA3.1(+)-PCK1 recombinant plasmid.

[0011] In a further preferred embodiment of the present invention, in the application of the PCK1 gene as a target in the preparation of products that regulate the proliferation of goat testicular interstitial cells, the primer sequences for PCR amplification in step S1 of the method for constructing the PCK1 overexpression plasmid pcDNA3.1(+)-PCK1 are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0012] In a further preferred embodiment of the present invention, in the application of the PCK1 gene as a target in the preparation of products regulating the proliferation of goat testicular interstitial cells, the amplification system and amplification program for the PCR amplification in step S1 of the construction method of the PCK1 overexpression plasmid pcDNA3.1(+)-PCK1 are as follows: Amplification system: 0.5 μL of upstream and downstream primers at a concentration of 50 pmol / μL; 0.5 μL of polymerase pv2; 10 μL of 5×PV2 buffer; 1 μL of 10 mM dNTP; 38 μL; total volume is 50 μL; The amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 25 s, 60℃ annealing for 20 s, 72℃ extension for 40 s, 25 cycles; 72℃ hold for 60 s.

[0013] In a further preferred embodiment of the present invention, in the application of the PCK1 gene as a target in the preparation of products regulating the proliferation of goat testicular interstitial cells, in the method for constructing the PCK1 overexpression plasmid pcDNA3.1(+)-PCK1, in step S2: The enzyme digestion temperature was 37℃, and the digestion time was 60 min. The ligation conditions for the target gene fragment and the enzyme-digested pcDNA3.1 vector were: 52℃ water bath for 40 min, followed by transformation and incubation for 5 min.

[0014] Preferably, in the application of the PCK1 gene as a target in the preparation of a product for regulating the proliferation of goat testicular interstitial cells, the product for regulating the proliferation of goat testicular interstitial cells targets the PCK1 gene and inhibits the proliferation of goat testicular interstitial cells by downregulating the expression of the PCK1 gene through a small RNA interference fragment.

[0015] In a further preferred embodiment, in the application of the PCK1 gene as a target in the preparation of products regulating the proliferation of goat testicular interstitial cells, the small RNA interference fragment is si-PCK1, the sequence of which is shown in SEQ ID NO. 3.

[0016] The application of the PCK1 gene as a target in the preparation of products that regulate the expression of marker genes CCNB1 and CCNE2 related to the proliferation of goat testicular interstitial cells.

[0017] The application of the PCK1 gene as a target in the preparation of products that regulate gluconeogenesis in goat testicular interstitial cells.

[0018] The beneficial effects of this invention are: This invention constructed the PCK1 gene overexpression plasmid pcDNA3.1(+)-PCK1 (OE-PCK1) and synthesized its small RNA interference fragment si-PCK1. It is the first to propose that overexpression of the PCK1 gene significantly promotes gluconeogenesis and proliferation of goat testicular interstitial cells (UTCs); conversely, inhibiting PCK1 gene expression inhibits gluconeogenesis and proliferation of UTCs. This invention is of great significance for improving goat testicular development and provides technical support for the research and development of products targeting the PCK1 gene to regulate the proliferation of goat UTCs. Attached Figure Description

[0019] Figure 1 The effect of PCK1 gene on the expression of proliferation genes CCNB1 and CCNE2 in goat testicular interstitial cells (Figure: A shows the expression results of proliferation-related genes CCNB1 and CCNE2 in goat testicular interstitial cells after PCK1 overexpression by RT-qPCR; BC shows the expression results of PCK1 protein, CCNB1 protein, and CCNE2 protein after PCK1 overexpression; D shows the expression results of proliferation-related genes CCNB1 and CCNE2 in goat testicular interstitial cells after si-PCK1 by RT-qPCR; EF shows the expression results of PCK1 protein, CCNB1 protein, and CCNE2 protein after si-PCK1). Figure 2The effect of PCK1 gene on the proliferation of goat testicular interstitial cells (Figure: A is the CCK8 result after PCK1 gene overexpression; B is the Edu result after PCK1 gene overexpression; C is the CCK8 result after si-PCK1 gene overexpression; D is the Edu result after si-PCK1 gene overexpression). Figure 3 The effect of the PCK1 gene on glucose and lactate levels in goat testicular interstitial cells (Figure: A shows glucose level after PCK1 gene overexpression; B shows lactate level after PCK1 gene overexpression; C shows glucose level after si-PCK1 gene overexpression; D shows lactate level after si-PCK1 gene overexpression). Figure 4 The effect of PCK1 gene on mitochondrial membrane potential in goat testicular interstitial cells (Figure: A is the fluorescence spectrum of mitochondrial membrane potential after PCK1 gene overexpression; B is the quantitative analysis result of mitochondrial membrane potential after PCK1 gene overexpression; C is the fluorescence spectrum of mitochondrial membrane potential after si-PCK1 gene overexpression; D is the quantitative analysis result of mitochondrial membrane potential after si-PCK1 gene overexpression). Detailed Implementation

[0020] The technical solution of the present invention will be described in detail below with reference to specific embodiments. The following embodiments are for explanation and illustration only, and do not constitute a limitation on the technical solution of the present invention.

[0021] Example 1 A PCK1 gene expression-specific promoter targeting the PCK1 gene to promote the proliferation of goat testicular interstitial cells was developed. This promoter was a pcDNA3.1(+)-PCK1 recombinant plasmid, and its construction method is as follows: (1) Extract cDNA from testicular interstitial cells and use the cDNA as a template for PCR amplification of the PCK1 gene to obtain the target fragment of the PCK1 gene.

[0022] The PCR expansion primer sequences are as follows: Forward: CTGGCTAGCGTTTAAACTTAAGCTTGGTACC; Reverse:GCTGATCAGCGGGTTTAAACGGGCCCTCTAGA.

[0023] The PCR amplification system and amplification procedure are as follows: Amplification system: 0.5 μL of upstream and downstream primers at a concentration of 50 pmol / μL; 0.5 μL of polymerase pv2; 10 μL of 5×PV2 buffer; 1 μL of 10 mM dNTP; 38 μL; total volume is 50 μL; The amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 25 s, 60℃ annealing for 20 s, 72℃ extension for 40 s, 25 cycles; 72℃ hold for 60 s.

[0024] (2) The obtained target gene fragment was ligated into the pcDNA3.1 vector digested with restriction endonucleases XbaI and kpn1 to obtain the pcDNA3.1(+)-PCK1 recombinant plasmid.

[0025] The enzyme digestion conditions were: 37℃, 60 min; The connection conditions are: 52℃ water bath for 40 min, followed by conversion and placement for 5 min.

[0026] Example 2 use The pcDNA3.1(+)-PCK1 recombinant plasmid (1 μg / mL) constructed in Example 1 was transfected into goat testicular interstitial cells according to the manufacturer's protocol, upregulating the levels and protein expression of PCK1, CCNB1 and CCNE2 genes, and promoting gluconeogenesis and proliferation of goat testicular interstitial cells.

[0027] Example 3 A PCK1 gene-specific inhibitor that targets the PCK1 gene to inhibit the proliferation of goat testicular interstitial cells. This inhibitor is a small RNA interference fragment si-PCK1.

[0028] The sequence of Si-PCK1 is: 5'-GGAUGUGGCCAGAAUUGAATT-3'.

[0029] Example 4 use The interfering sequence si-PCK1 (final concentration of 100 nM) provided in Example 3 was transfected into goat testicular interstitial cells according to the manufacturer's protocol, downregulating the levels and protein expression of PCK1, CCNB1 and CCNE2 genes, and inhibiting gluconeogenesis and proliferation of goat testicular interstitial cells.

[0030] To further verify the reliability of the present invention, the inventors conducted a series of experiments, as follows: 1. Materials 1.1 Animals After collecting goat testicles at the slaughterhouse, they were placed in a thermos containing 1 mL of sterile saline solution with penicillin-streptomycin (10000 IU / mL) and transported back to the laboratory within 1 hour. The collected testicles were rinsed three times with preheated saline solution to remove impurities and blood. Fat deposits, epididymis, and seminal vesicles were removed from the surface of the testicles with scissors. The trimmed testicles were then rinsed again with saline solution. The treated testicles were placed in a beaker containing 1 mL of penicillin-streptomycin (10000 IU / mL) saline solution and placed on a 37°C constant temperature platform for later use. Subsequently, the tunica albuginea tissue was peeled off and cut into 1... The cells were broken into small fragments. Next, they were digested with trypsin for 8 minutes. Then, complete culture medium containing 10% fetal bovine serum, 1% penicillin and streptomycin, and 89% DMEM / F-12 was added to terminate the digestion process. The digested and separated cell solution was filtered through 250-mesh and 400-mesh sieves to collect the cells. Finally, the collected cells were cultured in a cell culture incubator until 80% adherence was achieved, and the culture medium was changed regularly for subsequent experiments.

[0031] 1.2 Drugs and Reagents The PCK1 gene overexpression plasmid pcDNA3.1(+)-PCK1 (OE-PCK1) and the interfering sequence si-PCK1 were synthesized by Shanghai Jiying Biotechnology Co., Ltd.; the lactate level detection kit was purchased from Nanjing Jiancheng Bioengineering Institute; the mitochondrial membrane potential detection kit and the glucose level detection kit were purchased from Shanghai Beyotime Biotechnology Co., Ltd.; DMEM / F-12 was purchased from Thermofisher, Inc., USA; transfection reagents... The RNA extraction kit was purchased from Invitrogen, USA; the RNA extraction kit was purchased from Takara, Japan; and the reverse transcription kit was purchased from Aibimeng Technology Co., Ltd., China.

[0032] 2. Test methods The PCK1 gene was overexpressed using the overexpression plasmid pcDNA3.1(+)-PCK1 (OE-PCK1), with the empty vector plasmid pcDNA3.1-GFP (OE-NC) used as a negative control. PCK1 gene expression was suppressed using the small RNA interference fragment si-PCK1. According to the manufacturer's protocol, overexpressing PCK1 plasmid (1 μg / mL), OE-NC (1 μg / mL), and si-PCK1 (final concentration 100 nM) were transfected into goat testicular interstitial cells. The effects of PCK1 gene on the mRNA and protein levels of proliferation pathway marker genes were detected using qRT-PCR and Western blot (WB) experiments. The effect of PCK1 gene on the proliferation of goat testicular interstitial cells was detected using the CCK8 assay. The effect of PCK1 gene on the mitochondrial membrane potential of goat testicular interstitial cells was detected using the JC-1 assay. The effect of PCK1 gene on gluconeogenesis in goat testicular interstitial cells was observed using ELISA to detect cellular lactate and glucose levels.

[0033] The construction method of the overexpression plasmid pcDNA3.1(+)-PCK1 (OE-PCK1) is as follows: (1) cDNA was extracted from testicular interstitial cells, and the PCK1 gene was amplified by PCR using the cDNA as a template to obtain the target fragment of the PCK1 gene; wherein, the PCR amplification primer sequence of the PCK1 gene is: Forward (SEQ ID NO.1): CTGGCTAGCGTTTAAACTTAAGCTTGGTACC; Reverse (SEQ ID NO.2): GCTGATCAGCGGGTTTAAACGGGCCCTCTAGA.

[0034] The PCR amplification system consisted of: 0.5 μL of upstream and downstream primers at a concentration of 50 pmol / μL; 0.5 μL of polymerase pv2; 10 μL of 5×PV2 buffer; and 1 μL of 10 mM dNTP. 38 μL; total volume 50 μL. The amplification program was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 25 s, 60℃ annealing for 20 s, 72℃ extension for 40 s, 25 cycles; 72℃ hold for 60 s.

[0035] (2) The obtained target fragment was ligated into the pcDNA3.1 vector digested with restriction endonucleases XbaI and kpn1 to obtain the pcDNA3.1(+)-PCK1 recombinant plasmid.

[0036] Enzyme digestion conditions: 37℃, 60 min; ligation conditions: 52℃ water bath for 40 min, followed by transformation and incubation for 5 min to allow the temperature to decrease.

[0037] The si-PCK1 sequence (SEQ ID NO.3) is as follows: 5'-GGAUGUGGCCAGAAUUGAATT-3'.

[0038] 2.1 Cell passage and transfection Select cells in the late logarithmic growth phase with good morphology for passage. Passage can be performed when the cell density reaches 80%-90%. Before passage, discard the old culture medium, wash three times with PBS, and then add an appropriate amount of preheated 0.25% trypsin to the culture dish to cover the cells. Digest at room temperature for 2 min, then immediately add an appropriate amount of DMEM / F-12 medium (containing 10% FBS) to stop the digestion. Transfer the cells to a 4 mL sterile centrifuge tube, mix well, and centrifuge at 300×g for 5 min. After centrifugation, discard the supernatant, then resuspend the cells in 2 mL of DMEM / F-12 medium (containing 10% FBS). One cell line was seeded in a 10 cm culture dish and transferred to a CO2 incubator (5%). Incubate at 37℃ and 100% humidity for 48 hours.

[0039] Goat testicular interstitial cells were seeded at appropriate densities in 10 cm cell culture dishes. When the cell density reached 85%-90%, they were passaged. Cells / well and Goat testicular interstitial cells were seeded at a density of [number] cells / well in 12-well and 6-well cell culture plates, respectively, and then placed in a CO2 incubator (5%). Cells can be transfected when they have been cultured at 37°C and 100% humidity until the cell density is approximately 60%. Follow the transfection instructions. The transfection reagents were used to transfect OE-PCK1 (final concentration 1 μg / mL) and si-PCK1 (final concentration 100 nM) into goat testicular interstitial cells. The cells were harvested 24 h after transfection.

[0040] 2.2 Cell RNA Extraction and Reverse Transcription RNA extraction was performed according to the instructions of Takara's RNAiso Plus reagent. The specific steps were as follows: (1) Cell collection: 24 hours after transfection, the supernatant was aspirated, washed 3 times with PBS, and 800 μL of RNAiso Plus reagent was added to each sample. The cells were then transferred to a 1.5 mL EP tube using a scraper and lysed at room temperature for 5 min. (2) Total RNA extraction: 200 μL of chloroform was added and mixed by inverting the tube. The mixture was allowed to stand for 30 s and then centrifuged at 12000×g for 10 min at 4℃. (3) RNA precipitation: The supernatant was carefully aspirated with a pipette and transferred to a 1.5 mL centrifuge tube without RNase. An equal volume of anhydrous ethanol was added, and the mixture was mixed by inverting the tube. The mixture was then transferred to a nucleic acid adsorption column and centrifuged according to the instructions. The column was washed twice with 70% ethanol and then left to air dry. (4) RNA dissolution: The centrifuge column was placed in a 1.5 mL centrifuge tube without RNase. An appropriate amount of RNase-free water was added to dissolve the RNA. The mixture was allowed to stand for 1 min and then centrifuged at 10000×g for 1 min at 4℃. After 1 minute, discard the centrifuge column and use a UV spectrophotometer to detect the RNA quality. Qualified RNA will be used directly for reverse transcription or frozen and stored in a -80°C freezer for later use.

[0041] Cellular mRNA reverse transcription was performed according to the instructions of the All-In-One 5X RT MasterMix kit from Abimon Technologies Co., Ltd. After preparing the reaction solution, the incubation times were 37°C for 10 min, 60°C for 5 min, and 95°C for 5 s.

[0042] 2.3 Analytical Methods (1) Detection of cell proliferation level The effects of PCK1 and si-PCK1 overexpression on the proliferation of goat testicular interstitial cells were detected using the CCK8 cell proliferation assay kit. The specific detection method is as follows: Goat testicular interstitial cells were inoculated at 3.0 × 10⁶ cells / year... 3 Cells were seeded at a density of 100 μL of culture medium per well into 96-well cell culture plates. After 12 h of cell adhesion, the cells were transfected. 24 h later, 10 μL of CCK8 was added to each well. The plates were incubated in the dark at 37°C for 2 h. The optical density (OD450) at 450 nm was measured using a microplate reader and statistical analysis was performed.

[0043] Edu cell proliferation assay: Goat testicular interstitial cells were cultured at 3.0 × 10⁻⁶ cells / mL. 3 Cells were seeded at a density of 100 μL / well in 96-well cell culture plates. After 12 h of cell adhesion, the cells were transfected. After 24 h, the cells were cultured according to the instructions of Beyotime Biotechnology Co., Ltd. The EdU-488 cell proliferation assay kit instructions are as follows: Add the prepared EdU solution to cell culture medium and incubate for 2 hours. Remove the culture medium and fix the cells with cell fixation solution for 30 minutes, followed by permeabilization with permeabilizer for 10 minutes, and then wash with PBS. Next, perform Apo110 staining, followed by Hoechst staining for nuclear DNA after PBS washing. Observe the cell staining under an inverted fluorescence microscope; the remaining steps are the same as above. Add 10 μL of CCK8 to each well, incubate in the dark at 37°C for 2 hours, and then measure the optical density (OD450) at 450 nm using a microplate reader and perform statistical analysis.

[0044] (2) Detection of cell proliferation gene levels Goat testicular interstitial cells were transfected for 24 h, and the mRNA and protein levels of proliferation-related genes CCNB1 and CCNE2 were detected using qRT-PCR and Western blot methods. The qRT-PCR and Western blot methods are as follows: qRT-PCR uses cDNA as a template and follows the BlasTaq protocol developed by Albion Technology Co., Ltd. TM The 2X qPCR MasterMix kit was used according to the instructions. After preparing the reaction solution, the reaction program was 95℃ for 30 s; 95℃ for 10 s; 60℃ for 30 s; 40 cycles; 95℃ for 15 s; 60℃ for 60 s; 95℃ for 15 s, with β-actin as an internal control. Real-time quantitative PCR results were obtained using... The primer sequences were calculated using the method described in Table 1.

[0045] ; (3) Detection of mitochondrial membrane potential in testicular interstitial cells Testicular interstitial cells were seeded into 6-well cell culture plates. After 24 h of transfection, the cells were washed three times with PBS. Then, JC-1 staining solution (10 μM) was added, and the cells were incubated at 37°C in the dark for 30 min. After incubation, the cells were washed three times with PBS solution for 5 min each time to remove the JC-1 dye. The samples were placed under a fluorescence microscope, and the fluorescent dye was excited at a specific wavelength. Images were taken using the same parameters. The fluorescence images of the testicular interstitial cells were processed using Image-J software, and the mean fluorescence intensity (Mean = IntDen / Area) was calculated. An independent samples t-test was performed on the mean fluorescence intensity values ​​of the two groups. The mean fluorescence intensity of the control group was reset to 1 to plot the statistical values.

[0046] (4) Detection of lactate levels in testicular interstitial cells Testicular interstitial cells were seeded in 6-well cell culture plates. After 24 h of transfection, the cells were washed three times with PBS. Then, 0.25% EDTA-free trypsin was added to digest the cells for 2 min at room temperature. Immediately afterward, an appropriate amount of DMEM / F-12 medium (containing 10% FBS) was added to terminate the digestion. The cells were then transferred to 4 mL sterile centrifuge tubes and centrifuged at 300×g for 5 min. The supernatant was discarded after centrifugation, and lactate was measured according to the lactate detection instructions. Specifically, 0.5 mL of extraction buffer was added to the collected cells, followed by sonication and centrifugation at 10000×g for 10 min. The reaction solution was prepared according to the corresponding instructions. After mixing the sample, the reaction was incubated at 37℃ in the dark for 30 min, and the OD value was read at 450 nm. Independent samples t-tests were performed on the OD values ​​of the two groups. The mean lactate level of the control group was reset to 1 for statistical plotting.

[0047] (5) Detection of glucose levels in testicular interstitial cells Testicular interstitial cells were seeded into 6-well cell culture plates. After 24 h of transfection, the cells were washed three times with PBS. Then, following the instructions of the glucose assay kit, 100 μL of cell lysis buffer was added to each well. The cells and lysis buffer were thoroughly mixed by pipetting, and then transferred to 1.5 mL centrifuge tubes. The mixture was centrifuged at 12000×g for 5 min, and the supernatant was collected into a new centrifuge tube. Next, 20 μL of the sample was added to 170 μL of glucose assay reagent, vortexed, and centrifuged at 5000×g for a few seconds to allow the liquid to settle to the bottom of the tube. The PCR tubes were heated at 95°C for 8 min and then cooled to 4°C. After cooling to 4°C, the PCR tubes were removed. 180 µL of the liquid was aspirated from each tube into a new 96-well plate, and the OD value was read at 450 nm. An independent samples t-test was performed on the OD values ​​of the two groups, with the mean glucose level of the control group reset to 1 for statistical plotting.

[0048] 3. Results All data in this study are expressed as mean ± standard deviation, with at least three independent replicates. Differences between two groups were analyzed using t-tests and ANOVA. All analyses were performed in GraphPad Prism 8. (The text in the figures is incomplete and likely refers to a separate section.) "This represents P < 0.05", "This means P < 0.01.

[0049] 3.1 Effects of PCK1 gene on the expression of CCNB1 and CCNE2 proliferation genes in goat testicular interstitial cells The effects of PCK1 gene on the expression of CCNB1 and CCNE2 proliferative genes in goat testicular interstitial cells are as follows: Figure 1 As shown. By Figure 1It can be seen that OE-PCK1 significantly promotes the mRNA levels of PCK1, CCNB1, and CCNE2 in LCs. Figure 1 A), the Western blot results were consistent with the RT-aPCR results. Figure 1 B, 1C). The si-PCK1 group significantly suppressed the mRNA levels of gluconeogenesis genes PCK1, CCNB1, and CCNE2 in LCs (B, C). Figure 1 D), the Western blot results were consistent with the RT-aPCR results ( Figure 1 E, 1F).

[0050] 3.2 Effects of PCK1 gene on the proliferation of goat testicular interstitial cells The effect of PCK1 gene on the proliferation of goat testicular interstitial cells is as follows: Figure 2 As shown. By Figure 2 It can be seen that OE-PCK1 significantly promotes the viability of LCs ( Figure 2 A), Edu assays revealed that OE-PCK1 significantly promoted LC cell proliferation ( Figure 2 B). The si-PCK1 group significantly inhibited LCs cell viability ( Figure 2 C), Edu assays revealed that si-PCK1 significantly inhibited LCs cell proliferation (C). Figure 2 D) 3.3 Effects of PCK1 gene on glucose and lactate levels in goat testicular interstitial cells The effects of the PCK1 gene on glucose and lactate levels in goat testicular interstitial cells are as follows: Figure 3 As shown. Gluconeogenesis is often accompanied by an increase in glucose, while the substrate lactate level decreases. This study found that OE-PCK1 significantly promoted glucose levels in LCs ( Figure 3 A), lactate levels were significantly reduced ( Figure 3 B). Following si-PCK1, glucose levels in LCs significantly decreased ( Figure 3 C), lactate levels were significantly increased ( Figure 3 D). The above results indicate that overexpression of the PCK1 gene can promote gluconeogenesis in LCs.

[0051] 3.4 Effects of PCK1 gene on mitochondrial membrane potential levels in goat testicular interstitial cells The effect of PCK1 gene on mitochondrial membrane potential in goat testicular interstitial cells is as follows: Figure 4 As shown. Gluconeogenesis is often accompanied by an increase in energy levels. This study found that OE-PCK1 significantly increased the mitochondrial membrane potential level in LCs (as shown). Figure 4 A, 4B). The mitochondrial membrane potential level in LCs was significantly reduced after si-PCK1 ( Figure 4 C, 4D).

[0052] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. Application of PCK1 gene as a target in the preparation of products that regulate the proliferation of goat testicular interstitial cells.

2. The application according to claim 1, characterized in that, The product regulating the proliferation of goat testicular interstitial cells targets the PCK1 gene and promotes the proliferation of goat testicular interstitial cells by upregulating the expression of the PCK1 gene through a PCK1 overexpression plasmid.

3. The application according to claim 2, characterized in that, The PCK1 overexpression plasmid is pcDNA3.1(+)-PCK1, and its construction method is as follows: S1. Extract cDNA from testicular interstitial cells, and use the cDNA as a template for PCR amplification of the PCK1 gene to obtain the target fragment of the PCK1 gene. S2. The obtained target gene fragment is ligated into the pcDNA3.1 vector digested with restriction endonucleases XbaI and kpn1 to obtain the pcDNA3.1(+)-PCK1 recombinant plasmid.

4. The application according to claim 3, characterized in that, In the method for constructing the PCK1 overexpression plasmid pcDNA3.1(+)-PCK1, the primer sequences for PCR amplification in step S1 are shown in SEQ ID NO.1 and SEQ ID NO.

2.

5. The application according to claim 3, characterized in that, In the method for constructing the PCK1 overexpression plasmid pcDNA3.1(+)-PCK1, the amplification system and amplification program for PCR amplification in step S1 are as follows: Amplification system: 0.5 μL of upstream and downstream primers at a concentration of 50 pmol / μL; 0.5 μL of polymerase pv2; 10 μL of 5×PV2 buffer; 1 μL of 10 mM dNTP; 38 μL; total volume is 50 μL; The amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 25 s, 60℃ annealing for 20 s, 72℃ extension for 40 s, 25 cycles; 72℃ hold for 60 s.

6. The application according to claim 3, characterized in that, In the method for constructing the PCK1 overexpression plasmid pcDNA3.1(+)-PCK1, in step S2: The enzyme digestion temperature was 37℃, and the digestion time was 60 min. The ligation conditions for the target gene fragment and the enzyme-digested pcDNA3.1 vector were: 52℃ water bath for 40 min, followed by transformation and incubation for 5 min.

7. The application according to claim 1, characterized in that, The product regulating the proliferation of goat testicular interstitial cells targets the PCK1 gene and inhibits the proliferation of goat testicular interstitial cells by downregulating the expression of the PCK1 gene through a small RNA interference fragment.

8. The application according to claim 7, characterized in that, The small RNA interference fragment is si-PCK1, and its sequence is shown in SEQ ID NO.

3.

9. Application of a PCK1 gene as a target in the preparation of products containing CCNB1 and CCNE2, marker genes related to the regulation of goat testicular interstitial cell proliferation.

10. Application of a PCK1 gene-targeted product in the preparation of a product regulating gluconeogenesis in goat testicular interstitial cells.