Red killifish spermatogonial stem cell strain capable of stably expressing Cas9 as well as construction method and application thereof

Abstract

The invention discloses an oryzias latipe spermatogonial stem cell strain capable of stably expressing Cas9 protein as well as a construction method and application of the oryzias latipe spermatogonial stem cell strain. The oryzias latipe spermatogonial stem cell strain is designed and constructed based on a Tol2 transposon system, wherein the transposon vector comprises a coding sequence of a Cas9 gene, a hygromycin B resistance gene and left and right arm sequences of a Tol2 transposon; constructing a Tol2 transposase expression vector; co-transfecting the transposon vector and the expression vector to the spermatogonial stem cells SG3 of the oryzias latipe; screening in an ESM4 culture medium containing hygromycin B to obtain a drug-resistant cell population capable of stably expressing Cas9; selecting monoclonal colonies under a microscope, and carrying out continuous subculture to obtain an oryzias latipe spermatogonial stem cell strain which stably expresses Cas9 protein and is named as oryzias latipe gonad cells SG3-Cas9. The method has the advantages of short construction period, high efficiency, good expression stability and the like, and provides a reliable cell platform for fish cell level gene editing research.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a medaka spermatogonial stem cell line stably expressing Cas9 protein and a construction method and application thereof. BACKGROUND

[0002] As a classic fish model organism, medaka spermatogonial stem cells (SSCs) have become an ideal system for studying reproductive development and genetic manipulation due to their self-renewal and differentiation potential. SSCs are the only adult stem cells in male animals that can transmit genetic information to the next generation, and have the ability to self-renew and differentiate into sperm. Medaka SSCs were first established by Professor Hong Yunhan and named SG3 cell line, marking the birth of the first fish spermatogonial stem cell line derived from adult. Fish SSC gene editing technology is expected to quickly obtain genetically modified gametes in vivo or in vitro, which not only can significantly shorten the breeding cycle of farmed fish, but also opens up a new way for the creation of excellent germplasm.

[0003] CRISPR-Cas9 gene editing technology relies on the ribonucleoprotein complex (RNP) formed by Cas9 protein and guide RNA (gRNA), which can accurately recognize and cut specific DNA sequences, achieve gene expression regulation, epigenetic editing and single base substitution, etc. Cas9 is a kind of endonuclease with the ability to cut double-stranded DNA, and the gene editing activity depends on the efficient delivery of Cas9 to target cells and successful entry into the nucleus. However, due to the technical difficulties and high cost of long-term culture of fish SSCs in vitro, so far there has been no report of SSC lines derived from medaka that can stably express Cas9 protein. However, the membrane phospholipid saturation of fish SSCs is relatively high, and the membrane structure is more rigid, resulting in relatively low transgenic efficiency.

[0004] The Tol2 transposon system has the advantages of large payload capacity (>10 kb), random integration and "cut-and-paste" mechanism, etc., which can carry Cas9 gene, selection marker and regulatory elements at the same time, avoiding the editing bias caused by target limitation. The application of Tol2 system to medaka SSCs can not only realize the stable integration and long-term expression of Cas9 gene, but also continuously provide nuclease activity after single transfection, support multiple rounds of gene editing and high-throughput functional screening. SUMMARY

[0005] Therefore, the main purpose of the present application is to provide a medaka spermatogonial stem cell line stably expressing Cas9 protein.

[0006] Another objective of this invention is to provide a method for constructing a stable medaka spermatogonial stem cell line expressing the Cas9 protein. By utilizing the Tol2 transposon system, the Cas9 gene can be efficiently and stably integrated and expressed in the cell line, providing an efficient and reproducible gene editing platform for research on fish reproductive development regulation, disease model construction, and precision breeding.

[0007] Another object of the present invention is to provide the application of the medaka spermatogonial stem cell line stably expressing the Cas9 protein in in vitro gene editing.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides a medaka spermatogonial stem cell line that stably expresses Cas9 protein, named medaka gonadal cells SG3-Cas9 (Oryzias latipes), with accession number CCTCC NO: C2025353, accession date December 23, 2025, and depositary institution: China Center for Type Culture Collection.

[0010] A second aspect of the present invention provides a method for constructing a medaka spermatogonial stem cell line stably expressing Cas9 protein, comprising the following steps:

[0011] S1. Based on the Tol2 transposon system, a transposon vector containing the coding sequence of the Cas9 gene, the hygromycin B resistance gene, and the left and right arm sequences of the Tol2 transposon was designed and constructed.

[0012] S2. Construct the Tol2 transposase expression vector;

[0013] S3. Co-transfect the transposon vector and the expression vector into medaka spermatogonial stem cells SG3.

[0014] S4. Screening was performed in ESM4 medium containing hygromycin B to obtain a cell population that was resistant to the drug and stably expressed Cas9.

[0015] S5. Select single clonal colonies under a microscope, and continue to subculture to obtain the SG3-Cas9.

[0016] In step S1, the coding sequence of the Cas9 gene is shown in SEQ ID No. 1, as follows:

[0017]

[0018] In step S1, the left and right arm sequences of the Tol2 transposon are shown in SEQ ID No. 2 and SEQ ID No. 3, as follows:

[0019] CAGAGGTGTAAAGTACTTGAGTAATTTTACTTGATTACTGTACTTAAGTATTATTTTTGGGGATTTTTACTTTACTTGAGTACAATTAAAAATCAATACTTTTACTTTTACTTAATTACATTTTTTTAGAAAAAAAAGTACTTTTTACTCCTTACAATTTTATTTACAGTCAAAAAGTACTTATTTTTTGGAGATCACTT (SEQ ID No. 2);

[0020] TTCTTGCTTTTACTTTTACTTCCTTAATACTCAAGTACAATTTTAATGGAGTACTTTTTACTTTTACTCAAGTAAGATTCTAGCCAGATACTTTTACTTTTAATTGAGTAAAATTTTCCCTAAGTACTTGTACTTTCACTTGAGTAAAATTTTTGAGTACTTTTTACACCTCTG (SEQ ID No. 3).

[0021] In step S1, the sequence of the Tol2 transposase expression vector is shown in SEQ ID No. 4, specifically as follows:

[0022]

[0023] In step S1, the sequence of the hygromycin B resistance gene is shown in SEQ ID No. 5, as follows:

[0024]

[0025] Preferably, in step S3, the concentration of hygromycin B in the ESM4 culture medium is 300 µg / mL.

[0026] A third aspect of the present invention provides the application of a stable medaka spermatogonial stem cell line expressing Cas9 protein in in vitro gene editing.

[0027] A fourth aspect of the present invention provides a method for integrating a foreign gene into the genome of medaka spermatogonial stem cells, comprising: using the transposon vector and the Tol2 transposase expression vector to co-transfect the foreign gene into medaka spermatogonial stem cells, followed by screening and monoclonal amplification to obtain the desired result.

[0028] Preferably, the exogenous gene is sgRNA.

[0029] A fifth aspect of the present invention provides an in vitro gene editing method for a medaka spermatogonial stem cell line stably expressing Cas9 protein, comprising the following steps:

[0030] (1) Design and synthesize sgRNAs that target the target gene;

[0031] (2) Transfect the sgRNA into the stable medaka spermatogonial stem cell line expressing Cas9 protein;

[0032] (3) Obtain cell lines with the target gene knocked out through cell culture and single-clone screening.

[0033] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0034] I. Optimization of the Tol2 transposon system: In the transposon vector, the CMV promoter was used to drive Cas9 expression, and a nuclear localization signal (NLS) was introduced at both the N-terminus and C-terminus of the protein to ensure precise nuclear localization of Cas9. The hygromycin B resistance gene was placed downstream of the IRES structure to achieve synchronous expression of resistance and Cas9. The helper vector was driven by the CMVIE94 promoter to activate the Tol2 transposase. After co-transfection of the transposon vector and the Tol2 transposase expression vector, a >90% drug-resistant cell population was obtained within 10 days by selection with 300 µg / mL hygromycin B. After two rounds of restrictive dilution, a stable medaka spermatogonial stem cell line expressing Cas9 protein was successfully obtained and named SG3-Cas9.

[0035] II. Functional Validation: This invention not only supports conventional single-gene knockout but also supports high-throughput screening of sgRNA libraries. Taking the Egr1 gene as an example, knockout vectors targeting Egr1 and sgRNA expression vectors were transfected into wild-type SG3 and SG3-Cas9 cell lines, respectively. The editing efficiency was evaluated using T7E1 restriction enzyme digestion and TIDE analysis. The results showed that the wild-type group achieved 41.23%, while the SG3-Cas9 group reached 68.23%, significantly improving gene knockout efficiency and validating the advantages of this platform in SSC gene editing in fish.

[0036] III. Advantages of the Construction Method: The construction method of the medaka spermatogonial stem cell line in this invention has the advantages of short construction cycle, high efficiency, and good expression stability, providing a reliable cell platform for gene editing research at the fish cell level. Simultaneously, this invention utilizes the SG3-Cas9 cell line for exogenous gene integration and target gene knockout, using transposon vectors and Tol2ase vectors to integrate the target gene or reporter gene into the medaka spermatogonial stem cell genome. Furthermore, by introducing sgRNA targeting the target gene (such as Egr1) into the SG3-Cas9 cell line, gene knockout can be efficiently achieved, providing new technical means for in-depth research in fish developmental biology, disease model construction, and precision breeding, with broad application prospects. Attached Figure Description

[0037] Figure 1 The image shown is a micrograph of the medaka spermatogonial stem cell line SG3-Cas9, which stably expresses the Cas9 protein in the examples. The bar is 100 μm.

[0038] Figure 2 The experimental results of PCR amplification and gel electrophoresis analysis in this example verify the successful insertion of the Cas9 gene into the genome of medaka spermatogonial stem cells.

[0039] Figure 3 The sequencing results in this example confirm the complete integration of the Cas9 gene into medaka spermatogonial stem cells.

[0040] Figure 4 The results of the Western blot (WB) assay for Cas9 protein expression in SG3-Cas9 cells are shown in the examples.

[0041] Figure 5 The results of T7E1 enzyme detection of Egr1 gene knockout and editing efficiency analysis in the examples are shown. The right bar chart shows the editing efficiency (mean ± standard deviation) between different samples, where *** indicates that the difference is extremely significant compared with the control group (P<0.001). Detailed Implementation

[0042] To more fully understand and demonstrate the technical solutions, objectives, and advantages of the present invention, the technical effects produced by the present invention will be further described in detail and completely below with reference to the accompanying drawings and specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. It should be noted that other embodiments obtained by those skilled in the art without departing from the concept of the present invention are all within the protection scope of the present invention.

[0043] The following examples provide a stable medaka spermatogonial stem cell line SG3-Cas9 expressing Cas9 protein, named medaka gonadal cells SG3-Cas9 (Oryzias latipes), with accession number CCTCC NO: C2025353 and accession date of December 23, 2025.

[0044] Example 1

[0045] 1. Cell resuscitation and passage

[0046] Preheat the water bath to 37°C. After removing the SG3 cell cryopreservation tubes from the liquid nitrogen, gently shake them in the water bath for 1-2 minutes until only about 5 mm of ice crystals remain. Transfer the thawed suspension to a 15 mL centrifuge tube containing 5 mL of pre-warmed ESM4 medium. Centrifuge at 1400 rpm for 5 minutes, discard the supernatant, gently resuspend the cells in fresh medium, and transfer them to a culture flask. Incubate at 28°C, 5% CO2 for 4-6 hours. Replace the medium after the cells have adhered to the culture vessel.

[0047] When the cell confluence reaches 80%-90%, remove the culture flask from the biosafety cabinet, discard the old solution, and wash twice with PBS. Add 1-1.5 mL of trypsin containing 0.25% EDTA, incubate at 28°C for 2-3 minutes, and stop digestion immediately when the cells become round and contracted. Add serum-containing medium to neutralize, gently pipette to detach the cells, and seed them into a new culture flask at a ratio of 1:2-1:3, adding 4-5 mL of ESM. Return the flask to the incubator. Monitor cell adhesion and growth status for 16-24 hours after passage.

[0048] 2. Screening of SG3 / Cas9 monoclonal cell lines

[0049] 24 hours after transfection, the original culture medium was removed, and the cells were gently washed twice with 1×PBS pre-adjusted to room temperature. Fresh ESM4 complete medium was then added to remove residual transfection reagents and cell debris. Selection pressure was applied by adding ESM4 medium containing 300 μg / mL hygromycin B. Fresh medium with the same concentration of hygromycin B was added every 48 hours until the cell mortality rate in the control group was >90%. After obtaining a stable cell population, the cells were washed three times with 1×PBS and digested with 0.25% trypsin at 28°C for 2 min. Cells were then collected by centrifugation at 1200 rpm for 5 min, and the supernatant was discarded. Cells were seeded into 96-well plates using a serial dilution method, maintaining a selection concentration of 200 μg / mL hygromycin B, with medium changed every 48 hours. Single-clonal cell colonies were selected under a microscope and expanded into 12-well plates for secondary passage. After two passages in 12-well plates, the cells were transitioned to ESM4 complete medium without selection pressure for routine culture. Normal SG3-Cas9 cell lines were cultured as follows: Figure 1 As shown.

[0050] 3. PCR verification of stable Cas9 protein expression

[0051] First, genomic DNA was extracted from wild-type SG3 cells and SG3-Cas9 cell lines. The PCR amplification products of each sample were loaded onto a 1% agarose gel for electrophoresis identification, such as... Figure 2 As shown, a distinct specific amplification band was observed at approximately 540 bp in the lane of the SG3-Cas9 cell line, while this band was not observed in the corresponding lane of wild-type SG3 cells. Furthermore, the band was clear and without significant tailing, indicating good primer specificity and minimal non-specific amplification. This band was recovered for Sanger sequencing. Figure 3 As shown in the figure, the alignment results indicate that the sequencing sequence is highly homologous to the Cas9 coding region, further confirming that the amplified product is a Cas9 gene-specific sequence. These results demonstrate that the Tol2ase / Cas9 transposon system successfully integrated and stably expressed the Cas9 gene in the SG3 cell genome.

[0052] 4. Western blot verification of stable Cas9 protein expression

[0053] Wild-type SG3 cells and gene-edited SG3-Cas9 cells were seeded separately in T25 culture flasks. When the cells reached 80%-90% confluence, the centrifuge column and receiving tube were pre-chilled. 100×PMSF inhibitor (final concentration 1×) was added to the lysis buffer. After aspirating the culture medium, the cells were washed twice with pre-chilled PBS at 4°C to remove residual serum. Then, 50 μL of lysis buffer containing PMSF was added to cover the cell layer. The cells were incubated on ice for 5 min and then gently detached. The lysis buffer was transferred to a pre-chilled centrifuge column and centrifuged at 14,000×g for 30 s at 4°C. The column was discarded, and the protein solution was collected, aliquoted, and stored at -80°C for later use. 10 μL of protein sample was mixed with 5 μL of pre-stained marker and loaded onto an SDS-PAGE gel (total volume 15 μL). Electrophoresis was performed at 110V for 45 min. After electrophoresis, the gel was assembled with an activated and equilibrated PVDF membrane and wet-transferred for 1 h (200 mA constant current). After transfer, the PVDF membrane was blocked in rapid blocking buffer at room temperature for 5 min. Then, rabbit monoclonal antibody Cas9 diluted 1:1000 and rabbit monoclonal antibody β-Actin diluted 1:10000 were added, and the membranes were incubated overnight at 4°C. The next day, the membranes were washed five times (10 min each time) with PBST containing 0.5% TWEEN-20, and then HRP-labeled goat anti-rabbit secondary antibodies (diluted 1:1000 and 1:5000, respectively) were added and incubated at room temperature for 1 h. After washing, a mixture of equal proportions of HRP-ECL chemiluminescent buffer was added, and the reaction was carried out in the dark for 1 min. Cas9 protein expression was detected using a chemiluminescence imaging system.

[0054] After transfecting the Tol2 system expressing Cas9, 300 μg / mL hygromycin B was added to the culture medium for selection. After 7 days, all wild-type SG3 cells died, leaving only polyclonal SG3-Cas9 cells carrying Tol2 / Cas9. Three stable Cas9-expressing monoclonal lines were obtained through two rounds of limiting dilution, named SG3-Cas9. To verify Cas9 expression, total protein was extracted from the three monoclonal lines and subjected to Western blotting. Figure 4 As shown, a specific band of approximately 158 kDa was detected in SG3-Cas9, while no signal was observed in the wild-type control, indicating that the Tol2 system successfully achieved stable integration and expression of the Cas9 protein in SG3 cells.

[0055] 5. Validation of Egr1 gene knockout in SG3-Cas9

[0056] Based on the CRISPR / Cas9 system, a knockout vector (pCas9-mU6-egr1-sgRNA) and an sgRNA expression vector (mU6-egr1-sgRNA) targeting the Egr1 gene were constructed. The knockout vector contains two key components:

[0057] (1) The sgRNA expression cassette driven by the medaka U6 promoter targets the exon region of the Egr1 gene (target sequence: 5'-CGGCCAGTGTAAGAAATGGG-3'), which was designed by the CIDP platform and has an off-target probability of less than 0.1.

[0058] (2) The SpCas9 expression cassette driven by the CMV promoter contains the nuclear localization signal (NLS), while the sgRNA expression vector retains only the mU6-sgRNA module.

[0059] like Figure 5 As shown, the editing efficiency of the Egr1 gene was evaluated using the T7E1 nuclease digestion method. Genomic DNA was extracted from wild-type SG3 cells, a control group transfected only with the knockout vector, and SG3-Cas9 cells. After PCR amplification of the target region, the DNA was co-incubated with the T7E1 enzyme at 37°C for 30 min, followed by 2% agarose gel electrophoresis. The results showed that wild-type SG3 cells showed only a complete amplification band of approximately 500 bp without enzyme digestion products, indicating that no gene editing occurred. The control group showed a weak cleavage band next to the main band, suggesting low-efficiency or non-specific editing. In contrast, the SG3-Cas9 group showed two distinct cleavage bands at approximately 250 bp with enhanced signal intensity, indicating that the Egr1 gene was efficiently cleaved in the Cas9 context. The cleavage products were further analyzed using Sanger sequencing and TIDE analysis to assess the editing efficiency. The results showed that the knockout efficiency of SG3-Cas9 cells was 68.49%, which was significantly improved by 27.26 percentage points compared with the wild type's 41.23%, verifying that the Tol2-Cas9 system has efficient editing capabilities.

[0060] The above are merely preferred embodiments of the present invention and are not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A stable medaka spermatogonial stem cell line expressing Cas9 protein, named medaka gonadal cells SG3-Cas9 (Oryzias latipes), with accession number CCTCC NO: C2025353 and accession date December 23, 2025.

2. The method for constructing a medaka spermatogonial stem cell line stably expressing Cas9 protein as described in claim 1, characterized in that, Includes the following steps: S1. Based on the Tol2 transposon system, a transposon vector containing the coding sequence of the Cas9 gene, the hygromycin B resistance gene (Hygro), and the left and right arm sequences of the Tol2 transposon was designed and constructed. S2. Construct the Tol2 transposase expression vector; S3. Co-transfect the transposon vector and the expression vector into medaka spermatogonial stem cells SG3. S4. Screening was performed in ESM4 medium containing hygromycin B to obtain a cell population that was resistant to the drug and stably expressed Cas9. S5. Select single-clonal colonies under a microscope and continue to subculture to obtain the desired product.

3. The method for constructing a medaka spermatogonial stem cell line stably expressing Cas9 protein according to claim 1, characterized in that, In step S1, the coding sequence of the Cas9 gene is shown in SEQ ID No.

1.

4. The method for constructing a medaka spermatogonial stem cell line stably expressing Cas9 protein according to claim 1, characterized in that, The left and right arm sequences of the Tol2 transposon are shown in SEQ ID No. 2 and SEQ ID No.

3.

5. The method for constructing a medaka spermatogonial stem cell line stably expressing Cas9 protein according to claim 1, characterized in that, The sequence of the Tol2 transposase expression vector is shown in SEQ ID No. 4, and the sequence of the hygromycin B resistance gene is shown in SEQ ID No.

2.

6. The method for constructing a medaka spermatogonial stem cell line stably expressing Cas9 protein according to claim 1, characterized in that, In step S3, the concentration of hygromycin B in the ESM4 culture medium is 300 µg / mL.

7. The application of the medaka spermatogonial stem cell line stably expressing Cas9 protein as described in claim 1 in in vitro gene editing.

8. A method for integrating exogenous genes into the genome of medaka spermatogonial stem cells, characterized in that, include: The exogenous gene was co-transfected into medaka spermatogonial stem cells using the transposon vector and the Tol2 transposase expression vector, followed by screening and monoclonal amplification to obtain the final product.

9. The method for integrating exogenous genes into the genome of medaka spermatogonial stem cells according to claim 8, characterized in that, The exogenous gene is sgRNA.

10. An in vitro gene editing method for a medaka spermatogonial stem cell line stably expressing Cas9 protein, characterized in that, Includes the following steps: (1) Design and synthesize sgRNAs that target the target gene; (2) Transfect the sgRNA into the stable medaka spermatogonial stem cell line expressing Cas9 protein; (3) Obtain cell lines with the target gene knocked out through cell culture and single-clone screening.

Images