Self-assembly self-replication RNA system and application thereof

Abstract

The invention discloses a self-assembly self-replication RNA (Ribonucleic Acid) system and application thereof. Belongs to the technical field of biological medicine. The method comprises the following steps: cutting off self-replicating RNA into two independent RNA sequences, and respectively accessing RNA ribozyme sequences to the upstream and downstream of each cut-off part; after the independent RNA is transcribed in vitro, ribozyme is autocatalytically broken to generate 2 ', 3'-cyclic phosphoric acid and a 5 '-hydroxyl terminal, the 2', 3 '-cyclic phosphoric acid and the 5'-hydroxyl terminal are introduced into a cell and are self-linked through host RTCB ligase to form complete saRNA, and efficient and continuous expression of target protein is realized. According to the present invention, through the splitting-self-assembly modular design, the length of the single RNA is reduced to 3000-7600 nt, the in vitro transcription efficiency is improved by 3-10 times, and the encapsulation of the lipid nanoparticles is easily achieved. The bottleneck that the traditional saRNA is large in molecular weight, difficult to produce and low in delivery efficiency is solved, and the method has important application value in the fields of vaccine production, recombinant protein expression, cell reprogramming and gene therapy.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and more specifically to a self-assembling and self-replicating RNA system and its applications. Background Technology

[0002] Self-replicating RNA (saRNA) is a type of nucleic acid molecule with the dual characteristics of "autonomous replication and continuous expression". Its core advantage lies in the fact that it can amplify the template in the host cell through its own RNA-dependent RNA polymerase (RdRp), and can continuously express the target protein with low doses. It has shown application potential superior to traditional mRNA in fields such as vaccine development and gene therapy.

[0003] However, existing saRNA technology faces a key bottleneck that is difficult to overcome: (1) Large molecular weight leads to low production efficiency To achieve autonomous replication, saRNA needs to integrate a complete replicase (Rep) coding region (approximately 7500 nt), cis-regulatory elements (CSE), and the target gene expression cassette, typically exceeding 9000 nt in length. During in vitro transcription (IVT) of long RNAs, RNA polymerase is prone to insufficient yield (only 1 / 10 to 1 / 5 of that of conventional mRNAs) due to template secondary structure obstruction or premature termination. Furthermore, the purification of long RNAs requires multiple anion exchange chromatography steps to remove fragments and double-stranded RNA (dsRNA) impurities, increasing production costs and making it difficult to meet the purity and uniformity requirements for large-scale production.

[0004] (2) Poor delivery efficiency and intracellular stability Ultra-high molecular weight saRNA is difficult to be efficiently encapsulated by delivery carriers such as lipid nanoparticles (LNPs) and polymers, with encapsulation rates generally below 50%. Furthermore, steric hindrance can lead to carrier particle aggregation and decreased stability. In addition, long-chain RNA is more easily degraded by extracellular nucleases during cellular uptake, or its chain can break due to physical delivery methods such as electroporation, which significantly reduces the effective intracellular template concentration and limits its in vivo and in vitro application effects.

[0005] (3) Inherent defects of the trans saRNA system To address the lack of regulatory flexibility caused by the functional coupling between the replicase and the target gene in the cis-saRNA system, researchers developed the trans-saRNA (taRNA) system. By separating the replicase coding sequence and the target gene into two independent RNA molecules, the decoupled regulation of the two was achieved.

[0006] However, this system still has three major limitations: ① Excessive target gene RNA load: The target gene RNA needs to integrate complete conserved sequence elements (CSEs) necessary for saRNA replication and transcription, including promoter elements in the 5' untranslated region (5'UTR), nsP1, nsP4, subgenomic promoters, and some or all elements in the 3'UTR, significantly increasing the molecular weight of the target gene RNA and affecting in vitro transcription and intracellular transport efficiency; ② Extremely difficult to control the co-delivery ratio: The efficient activation of the taRNA system depends on the precise matching of the replicase RNA and the target gene RNA. Existing studies have confirmed that its optimal molar ratio usually needs to be strictly controlled at around 400:1. Due to the inherent differences in intracellular uptake efficiency, endosome escape ability, and metabolic rate between the two types of RNA, insufficient replicase RNA or an imbalance in the ratio can easily lead to fluctuations in the amplification and expression levels of the target gene, seriously affecting the stability of the system output. ③ The replication RNA has poor stability and limits the expression duration: Most commonly used replication RNAs are designed with the linear structure of ordinary mRNA, which is easily degraded by exonucleases in the cell, directly leading to a shortened amplification cycle of the target gene and making it difficult to achieve long-term expression.

[0007] The aforementioned issues severely restrict the clinical translation of saRNA technology, especially in scenarios such as large-scale vaccine production (requiring low cost and high output) and gene therapy (requiring precise and efficient delivery).

[0008] Therefore, developing an improved technology that combines the core functions of saRNA, reduces its molecular weight, and enhances production and delivery efficiency has become a key issue that urgently needs to be addressed in this field. Summary of the Invention

[0009] In view of this, the present invention provides a self-assembling and self-replicating RNA system and its applications.

[0010] This invention aims to solve the technical problems of existing saRNAs, such as large molecular weight, low production efficiency, high delivery difficulty, and unstable expression in the trans-form system. It provides a modular, self-assembling saRNA system that achieves synergistic optimization of efficient production, flexible delivery, and stable expression.

[0011] To solve the above-mentioned technical problems, this application adopts the following technical solution: The core innovation of this invention lies in splitting traditional single-stranded saRNA into two independent RNA fragments, and achieving a closed-loop technology of "fragmented delivery - intracellular recombination - autonomous replication" through ribozyme self-cleavage and host endogenous ligase-mediated self-assembly. The specific scheme is as follows: A self-assembling self-replicating RNA (saaRNA) system, wherein self-replicating RNA (saRNA) is truncated at a selected position to form two independent RNA sequences, and an RNA ribozyme sequence is covalently linked to the 3' end of the upstream sequence and the 5' end of the downstream sequence at each RNA truncation site; After the two independent RNA sequences are co-introduced into the cell, they undergo ribozyme self-cleavage and host RTCB ligase-mediated self-ligation reaction to form a complete self-replicating RNA molecule, thereby driving the continuous expression of the target protein.

[0012] Furthermore, the self-replicating RNA is Venezuelan equine encephalitis virus (VEEV), Eastern equine encephalitis virus (EEEV), Evogre virus (EVEV), Chikungunya virus (CHIKV), Ross River virus (RRV), Semliki forest virus (SFV), Sindbis virus (SINV), Western equine encephalitis virus (WEEV), Marburg virus (FMV), or a functional variant thereof obtained by mutation of nsP2-V372A or nsP4-K179R.

[0013] Furthermore, the self-replicating RNA comprises, from the 5' end to the 3' end, a 5' cap structure, a 5' untranslated region (5'UTR), an open reading frame encoding RNA replicase, a subgenome promoter, a target gene sequence, a 3' untranslated region (3'UTR), and a poly(A) tail. The target gene sequence is a single gene, or... Polycistronic gene clusters linked by 2A peptides (T2A, P2A, E2A, F2A) / internal ribosome entry sites (IRES).

[0014] Furthermore, the saRNA is truncated at any site to form two independent RNA fragments, and RNA ribozyme sequences are added upstream and downstream of the truncation site, respectively: The N-terminal fragment includes: a 5' cap, the first half of the truncation site, and a 3' ribozyme, where the 3' ribozyme generates a precise 3' end after self-cleavage (such as the twister ribozyme and the HDV ribozyme). The C-terminal fragment includes: a 5' ribozyme, the latter half of the truncation site, a 3' UTR, and a poly(A) tail. Among them, the 5' ribozyme generates a precise 5' end after self-cleavage (such as HH ribozyme, HHV ribozyme, twister sister ribozyme, and cp twister ribozyme).

[0015] The N-terminal 3' ribozyme and the C-terminal 5' ribozyme autocleave in vitro or in vivo, forming precise 3' and 5' ends (2', 3'-cyclic phosphate and 5'-hydroxyl ends) that are completely identical to the original cleavage site sequence. These two ends can be efficiently ligated by endogenous RTCB ligase to form a scarless, fully functional saRNA.

[0016] Furthermore, the cutoff position is selected from any one or a combination of the following: (1) Inside the open reading frame encoding RNA replicase; (2) Between the subgenomic promoter and the target gene sequence; (3) Inside the target gene sequence.

[0017] Preferred truncation site 1: The site between the subgenomic promoter and the target gene sequence, specifically the 5'UTR region of the target gene. This site can tolerate certain sequence insertions or deletions without affecting the function of the self-replicating RNA and has low requirements for ribozyme type. The saRNA is truncated between the subgenomic promoter and the target gene sequence, and a ribozyme sequence is added to form two independent RNA fragments: Replicaase RNA fragments (5'→3'): 5' cap structure, 5'UTR, replicase ORF (nsP1-nsP4), subgenomic promoter, 3' ribozyme sequence; Target gene RNA fragment (5'→3'): 5' ribozyme sequence, target gene, 3' UTR, poly(A) tail (>10nt).

[0018] In this mode, the single fragment length is ≤7600 nt, the replicase fragment can be immobilized and produced, and the target gene fragment can be replaced as needed, making it suitable for most single gene and polycistronic expression scenarios.

[0019] Preferred cutoff site 2: near the middle of the full-length saRNA, where the two fragments produced by the split are of similar length, resulting in high in vitro transcription efficiency. In this mode, the single fragment is the smallest, with a length ≤5000 nt, further reducing transcription and delivery pressure, and is suitable for large-sized target genes (such as polycistronic antigens and full-length viral antigens).

[0020] Furthermore, the RNA ribozyme is a hammerhead ribozyme (HHR), hairpin ribozyme (HPR), hepatitis D virus ribozyme (HDVR), Varkud satellite ribozyme (VSR), Twister ribozyme, Twister Sister ribozyme (TSR), Hatchet ribozyme, Pistol ribozyme, circular permutation Twister, or hammerhead variant ribozyme (HHVR).

[0021] Preferred ribozyme types: Twister, Hammerhead Variant, and Twister Sister ribozymes and their variants are preferred, as they have high sequence cleavage efficiency, short sequences (approximately 40-60 nt), and strong compatibility; Ribozyme variant design: To address the issue of decreased cleavage efficiency caused by base modifications, Twister1-3 variants with low cytidine content (8%~20% reduction in cytidine content) were developed to ensure that the ribozyme is subjected to m 5 Modifications such as C have the least impact and still maintain efficient cutting capabilities.

[0022] Furthermore, after the independent RNA sequence is transcribed in vitro driven by the T7, SP6 or T3 promoter, the RNA ribozyme self-cleaves in vitro or in vivo to produce a 2',3'-cyclic phosphate (cP) end and a 5'-hydroxyl (OH) end; The independent RNA sequence consists of natural ribonucleotides or modified nucleotides; The modified nucleotide includes 5-methylcytosine (m 5 C), 5-hydroxymethylcytosine (hm) 5 C), 5-methyluridine (m) 5 U), pseudouridine (Ψ), N1-methylpseudouridine (m) 1 Ψ), N1-ethylpseudouridine (m 1 At least one of EtΨ).

[0023] Furthermore, the cells are eukaryotic cells (BHK21, HEK293T, A549, HELA, RAW264.7, hiPSC), prokaryotic cells, or cell-free in vitro translation systems.

[0024] Furthermore, the molar ratio of the replicase RNA fragment to the target gene RNA fragment is 1:1 to 1:32.

[0025] The intracellular action of the saaRNA system consists of four steps: 1) Cutting stage: Ribozymes autocatalyze the in vitro transcription of RNA to produce 2',3'-cyclic phosphate (cP) ends and 5'-hydroxyl (OH) ends; 2) Delivery stage: Independent RNA fragments are co-delivered to the same cell via liposomes, LNPs, or electroporation, due to the short size of the fragments (≤7600nt). 3) Self-assembly stage: Endogenous RTCB ligases or RTCB homologs in the host cell recognize the cP and OH ends, catalyze the formation of phosphodiester bonds, and recombine into complete saRNA molecules; 4) Replication and expression stage: Recombinant saRNA expresses nsP1-nsP4 replicase, assembles to form a replication complex, drives saRNA self-amplification and initiates subgenomic transcription, and continuously expresses the target protein.

[0026] The above system is applied in the following fields: (1) Vaccine production (the vaccines are antigen vaccines for COVID-19, influenza virus, and hepatitis B virus). (2) Recombinant protein expression (the recombinant protein is a fluorescent protein, cytokine, monoclonal antibody, or enzyme preparation); (3) Cell reprogramming (used for the preparation of induced pluripotent stem cells); (4) Gene therapy (for the in vivo delivery of defective genes or therapeutic proteins).

[0027] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects: (1) Production efficiency is greatly improved: the length of a single fragment is reduced to 3000~7600nt, the in vitro transcription efficiency is increased by 3~10 times, the purification of small fragments is simpler, and the production cost is reduced by 40%~70%; (2) Significantly optimized delivery performance: After the single fragment length was reduced, the encapsulation efficiency of liposomes and LNPs was improved; (3) High construction flexibility: The replicase fragment can be mass-produced as a "ready-to-use" component, and the target gene fragment can be quickly replaced by PCR, shortening the construction cycle from 5 days to 1 day; (4) Stable and long-lasting expression: The self-assembled saRNA can replicate continuously, and the target protein can be expressed for more than 40 days, which is more than 10 times that of traditional mRNA; (5) Strong compatibility: It supports single gene, polycistronic and multi-gene co-expression, is compatible with a variety of eukaryotic systems, and can reduce immunogenicity through base modification; (6) High safety: It relies on the host's endogenous ligase, does not require exogenous enzymes or auxiliary viruses, has no risk of genome integration, and has a high level of biosafety. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0029] Figure 1 This is a schematic diagram illustrating the construction and expression principle of saaRNA in Example 1 of the present invention.

[0030] Figure 2 The images show the plasmid maps of pT7AU-Rep-Twister (A) and pT7-cpTwister-EGFP-pA (B) in Example 1 of this invention.

[0031] Figure 3 This invention provides an example of fluorescence microscopy observation of long-term EGFP expression in BHK-21 cells transfected with saaRNA, as described in Example 1 of this invention.

[0032] Figure 4 The above is a flow cytometry analysis of the fluorescence expression of saaRNA transfected cells 48 h after the experiment in Example 1 of this invention. In this example, A represents the proportion of EGFP fluorescent cells and B represents the fluorescence intensity of EGFP.

[0033] Figure 5 This shows the fluorescence expression of saaRNA in various cells 24 hours after transfection in Example 1 of the present invention.

[0034] Figure 6 This is the carrier map in Embodiment 2 of the present invention.

[0035] Figure 7 In Example 2 of this invention, the internal sites of saaRNA were truncated and then self-assembled using different ribozymes.

[0036] Figure 8 This is for screening novel saaRNA combinations that highly express under p-methylated cytidine conditions in Example 3 of the present invention.

[0037] Figure 9 This is a map of the saaRNA expression polycistronic vector in Example 4 of the present invention.

[0038] Figure 10 This invention provides an example of achieving efficient polycistronic expression of saaRNA in Example 4 of this invention.

[0039] Figure 11 The map shows the target gene vectors expressing three different fluorescences constructed in Example 5 of this invention.

[0040] Figure 12 This invention demonstrates how saaRNA enables efficient expression of three fluorescent proteins in Example 5.

[0041] Figure 13 This is a map of the RBD domain of the SARS-CoV-2 spike protein expressed by saaRNA in Example 6 of the present invention.

[0042] Figure 14 In Example 6 of this invention, the levels of RBD protein expressed by saaRNA, saRNA, and mRNA were compared.

[0043] Figure 15 This is the pT7-cpTwister-Luc-pA plasmid map from Example 7 of the present invention.

[0044] Figure 16 This is for the purpose of comparing the expression of saaRNA and saRNA as luciferase in mice in Example 7 of the present invention. Detailed Implementation

[0045] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0046] The experimental materials required for this invention are conventional experimental materials, purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods, and will not be described in detail here.

[0047] Example 1 Construction and expression of saaRNA (1) Construction of saaRNA system vector See the schematic diagram of saaRNA construction process and expression mechanism. Figure 1 The specific process is as follows.

[0048] Using the T7-VEE-GFP plasmid with Addgene number #58977 as a backbone, high-fidelity PCR cloning technology was employed to precisely truncate the subgenomic promoter of this plasmid between the EGFP gene and the gene, splitting it into two functionally independent sequences: The first segment (replicaase RNA template): An artificial Twister ribozyme sequence (SEQ ID NO.1) was introduced at the 3' end via overlap extension PCR. Simultaneously, the original promoter was modified to the more efficient T7AU promoter (SEQ ID NO.2), thus constructing the in vitro transcription template plasmid pT7AU-Rep-Twister. The plasmid map is shown below. Figure 2 As shown in Figure A, this plasmid contains the complete sequence of “T7AU promoter-5'UTR-nsP1-nsP4 replicase gene-subgenomic promoter-Twister ribozyme”.

[0049] TGGGCTAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGGCCCA, SEQ ID NO. 1.

[0050] TAATACGACTCACTATAAT, SEQ ID NO. 2.

[0051] The second segment (EGFP expression RNA template): A T7 promoter (SEQ ID NO.4) and a circularly arranged permutation (cp) Twister ribozyme sequence (SEQ ID NO.5) were introduced into the 5' end of the EGFP gene (SEQ ID NO.3) via PCR. The 3' end retained the poly(A) tail structure of the original plasmid, thus constructing the in vitro transcription template plasmid pT7-cpTwister-EGFP-pA. The plasmid map is shown below. Figure 2 As shown in B.

[0052] , SEQ ID NO.3.

[0053] TAATACGACTCACTATAG, SEQ ID NO.4.

[0054] CTCCTGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGAGGCTGAAAAGCCTTAACACTGCCAAGGAG, SEQ ID NO.5.

[0055] The two plasmids were subjected to full-length sequencing verification (performed by Jin Weizhi) to confirm the accuracy and orientation of the promoter, ribozyme, and gene coding regions, and to ensure the absence of base mutations or deletions.

[0056] (2) In vitro RNA transcription and purification Template preparation: The pT7AU-Rep-Twister plasmid was linearized by single-enzyme digestion with restriction endonuclease MluI. After digestion at 37℃ for 4 h, the linearized template was recovered by agarose gel electrophoresis. The in vitro transcription template of pT7-cpTwister-EGFP-pA was prepared by PCR amplification. The upstream primer was SEQ ID NO.6 (containing the T7 promoter sequence), and the downstream primer was SEQ ID NO.7 (containing the poly(A) tail complementary sequence). The PCR reaction conditions were: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 30 cycles, and a final extension at 72℃ for 5 min. The product was recovered and quantified by agarose gel electrophoresis.

[0057] TCTAATACGACTCACTATAGGCTCCTGCCGGTCCCA, SEQ ID NO. 6.

[0058] TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAAATATTAAAAACAAAATCCGATT, SEQ ID NO.7.

[0059] In vitro transcription: Using linearized plasmids or PCR products as templates, in vitro transcription was performed using T7 RNA polymerase. The replicase RNA transcription system (20 μL) contained: 40 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 5 mM DTT, 2 mM NTP mixture (2 mM each of ATP, UTP, GTP, and CTP), 1 U / μL T7 RNA polymerase, and 0.5 mM GAU Capping reagent, and was incubated at 37°C for 4 h; the EGFP RNA transcription system was the same as above except that GAU Cap was not added.

[0060] RNA purification: After the transcription reaction was completed, 1U DNase I (without RNase activity) was added and incubated at 37°C for 30 min to remove template DNA; then fine purification was performed using RNA purification magnetic beads (Ambion™) according to the kit instructions to remove short RNA fragments and salt impurities.

[0061] RNA quality control: RNA concentration and purity were measured using a NanoDrop 2000 spectrophotometer, requiring an A260 / A280 ratio of 1.8–2.0 and an A260 / A230 ratio ≥2.0. RNA integrity was assessed using 1% agarose gel electrophoresis (containing 1×MOPS buffer and 2.2M formaldehyde) to ensure a single target band without significant degradation or extraneous bands. Purified RNA was aliquoted and stored at -80°C to avoid repeated freeze-thaw cycles.

[0062] (3) Cell culture and preparation Cell line selection: BHK-21 cells (ATCC number: CCL10), 293T cells (ATCC number: CRL-3216), Vero cells (ATCC number: CCL-81), A549 cells (ATCC number: CCL-185), and HELA cells (ATCC number: CCL-2) were selected as test cell lines, covering multiple species and types of cells, including adherent cells, epithelial cells, and immune cells from mice, hamsters, monkeys, and humans, to verify the universality of the saaRNA system.

[0063] Culture conditions: All cells were cultured in DMEM high glucose medium (Gibco™, catalog number 11965-092) supplemented with 10% fetal bovine serum (FBS, Gibco™, catalog number 10099-141), 100 U / mL penicillin and 100 μg / mL streptomycin, and were incubated at 37°C in a constant temperature incubator containing 5% CO2.

[0064] Preparation before transfection: Preparing cells in logarithmic growth phase at a ratio of 1×102 5 The cells were seeded at a density of 1 cell per well in 24-well plates. 500 μL of culture medium was added to each well. When the cells reached 70% to 80% confluence, they were transfected. The culture medium was replaced with fresh antibiotic-free medium 1 hour before transfection.

[0065] (4) RNA transfection and fluorescence expression detection Transfection grouping: Experimental group (saaRNA group): The purified replicase RNA and EGFP expression RNA were mixed at a molar ratio of 1:8. The transfection complex was prepared according to the instructions of the transfection kit and incubated at room temperature for 10 min before being added to the cell wells.

[0066] Control group (saRNA group): Full-length T7-VEE-GFP saRNA (1 μg) was transfected using the same transfection reagents and methods as the experimental group.

[0067] Culture and observation: After transfection, the cells were cultured at 37℃ and 5% CO2. EGFP fluorescence expression was observed at 24h, 48h, 72h, 6d, 10d and 20d using an Olympus IX73 fluorescence microscope. Images were taken using the same exposure time (200ms) and gain parameters.

[0068] Quantitative detection by flow cytometry: Cells from each group were collected 48 h after transfection, washed twice with PBS, and the cell concentration was adjusted to 1×10⁻⁶. 6 The percentage of EGFP-positive cells and peak fluorescence intensity (PFI) were detected using a BD FACSCanto™ II flow cytometer. 5000 cells were analyzed per sample, and the data were analyzed using FlowJo 10.8 software.

[0069] (5) Results and Analysis Fluorescence microscopy observation results: such as Figure 3 As shown, 24 hours after transfection with BHK-21 cells, both the experimental and control groups began to show significant EGFP fluorescence. With prolonged culture time, the fluorescence intensity of the experimental group continued to increase, reaching a peak at 72 hours and maintaining strong fluorescence even at 20 days. Throughout each testing period, the fluorescence of the experimental group was significantly stronger than that of the control group.

[0070] Flow cytometry results: such as Figure 4 As shown, 48 h after BHK-21 cell transfection, the proportion of EGFP-positive cells in the experimental group was 93.2% ± 1.3%, and the average fluorescence intensity was 14,400,000 ± 30,000; while the proportion of positive cells in the control group was 88.1% ± 2.5%, and the average fluorescence intensity was 4,900,000 ± 20,000. The positive rate and fluorescence intensity in the experimental group were significantly higher than those in the control group (P < 0.01).

[0071] Transfection effects in various cell types: such as Figure 5 As shown, after 24 hours of transfection of 293T cells, Vero cells, A549 cells and HELA cells with saaRNA, strong green fluorescent protein was expressed.

[0072] Conclusion: The saaRNA system can efficiently self-assemble into complete saRNA in various cell lines, achieving efficient and long-term expression of the target gene. Its expression efficiency and stability are superior to those of traditional full-length saRNA.

[0073] Example 2 Construction and expression of saaRNA without scarring (1) Construction of saaRNA system vector Using the T7-VEE-GFP plasmid as a backbone, a truncation site was set near the middle of the saRNA sequence using PCR cloning technology to split it into two sequences: The first segment (N-terminal template): The T7-VEE-GFP expression RNA region (8600bp) was truncated at 4800bp (inside the nsP3 gene), and a novel artificial Twister ribozyme 2 (SEQ ID NO.8) was added to the 3' end. At the same time, the promoter was modified to T7AU promoter (SEQ ID NO.2) to construct plasmid pT7AU-RepN-Twister.

[0074] AGTATTAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGATACT, SEQ ID NO. 8.

[0075] The second segment (C-terminal template): A T7 promoter (SEQ ID NO.4) is added to the 5' end, and three different ribozymes are inserted: hammerhead ribozyme (HHR, SEQ ID NO.9), hammerhead ribozyme variant (HHVR, SEQ ID NO.10), and Twister Sister ribozyme (TSR, SEQ ID NO.11) to construct three plasmids: pT7-HHR-RepC-EGFP-pA, pT7-HHVR-RepC-EGFP-pA, and pT7-TSR-RepC-EGFP-pA.

[0076] GACCTCTGATGAGAGCGAAAGCTCGAAACTGGAAAGCCAGTCAGGTC, SEQ ID NO.9.

[0077] AGACAACCAGGAGTCTATAAAATGACCTCTGAAGAGACTGGACGAAACCAATAGGTCAGGTC, SEQ ID NO. 10.

[0078] TCGACGCAAGGCCCAGTCCCGTGCAAGCCGGGACACAGGATCACCTGTCGGCGCTCAGGTCGA, SEQ ID NO.11.

[0079] The above plasmid maps are as follows Figure 6 As shown, sequencing verification confirmed that the connection direction of each ribozyme sequence and gene fragment was correct, with no mutations or frameshifts.

[0080] (2) In vitro RNA transcription and purification Template preparation: In vitro transcription templates for RNA were prepared by PCR amplification. The first template primers were SEQ ID NO.2 (upstream) and SEQ ID NO.12 (downstream), and the second template primers were SEQ ID NO.4 (upstream) and SEQ ID NO.7 (downstream). The PCR products were recovered and quantified by agarose gel electrophoresis.

[0081] TTTTTTTTTTGAATTAATTCCCCTCGATATC, SEQ ID NO. 12.

[0082] In vitro transcription: Following the transcription system of Example 1, GAU Cap was added during the transcription of the first RNA segment, but no GAU Cap was added during the transcription of the second RNA segment. The reaction was carried out at 37°C for 4 hours.

[0083] RNA purification and quality control: RNA was purified using magnetic beads. The concentration, purity, and integrity of the RNA were verified by NanoDrop and denaturing agarose gel electrophoresis to ensure that the RNA was free from degradation and could be used for subsequent experiments.

[0084] (3) Cell culture and RNA transfection Cell selection and culture: BHK-21 cells were selected as test cells and cultured under the same conditions as in Example 1. Before transfection, cells were seeded in 24-well plates with a confluence of 70% to 80%.

[0085] Transfection grouping: Experimental group 1: RepN RNA + HHR-RepC-EGFP RNA (molar ratio 1:8); Experimental group 2: RepN RNA + HHVR-RepC-EGFP RNA (molar ratio 1:8); Experimental group 3: RepN RNA + TSR-RepC-EGFP RNA (molar ratio 1:8); Control group: full-length saRNA (0.5 μg).

[0086] Each group has 3 replicate wells. The transfection reagent used is a universal mRNA transfection kit. The transfection complex was prepared according to the instructions.

[0087] (4) Detection and analysis of fluorescence expression Twenty-four hours after transfection, the expression of EGFP fluorescence in each group was observed using a fluorescence microscope. Total RNA was extracted from the cells, and reverse transcription PCR was used to determine whether the saaRNA had correctly self-assembled and ligated.

[0088] (5) Results and Analysis like Figure 7As shown, EGFP fluorescence expression was observed in all three experimental groups, and, like the control group, the proportion of cells expressing EGFP protein was higher than 80%, indicating that the intermediate division saaRNA system can achieve efficient self-assembly of saRNA. Sequencing revealed that the sequence formed by the self-ligation of the saaRNA system was completely identical to the saRNA at the ligation site, with no nucleotide insertions or deletions.

[0089] The results showed that the self-assembly efficiency of the traceless saaRNA system was high, and the lengths of the two RNA fragments were further reduced (both ≤5000nt), which is beneficial to RNA transcription and delivery.

[0090] Example 3 Construction and expression of vectors for base-modified self-assembling and self-replicating RNA (1) Construction of modified saaRNA vector Using the T7-VEE-GFP plasmid as a backbone, a saaRNA vector containing different ribozyme variants was constructed by truncating the plasmid between the subgenomic promoter and the EGFP gene. The replicase RNA template was modified by adding four Twister ribozyme variants to the 3' end: artificial Twister (SEQ ID NO.1), Twister1 (low cytidine, SEQ ID NO.13), Twister2 (low cytidine, SEQ ID NO.14), and Twister3 (low cytidine, SEQ ID NO.15). The promoter of all variants was T7AU (SEQ ID NO.2). The plasmids pT7AU-Rep-Twister, pT7AU-Rep-Twister1, pT7AU-Rep-Twister2, and pT7AU-Rep-Twister3 were constructed.

[0091] AAATTAATGCAACTACAAGAAATTGTATCGGTGACAAGTCCGAGATAAATGCAGAGTCATTT, SEQ ID NO. 13.

[0092] GTATTAAAACTAACTTGTATATTAGAGATACAAGCGGTTACAAGTCCGCATAAATAGTGAGTAGTAC, SEQ ID NO. 14.

[0093] TGGTTAATGCGGCTTATCGAGTTTTTGATAAACGGTTACAAGCCCGTGTAAACGCAGAGTGACCA, SEQ ID NO.15.

[0094] EGFP RNA template: The corresponding cp-Twister ribozyme variants were added to the 5' end: cp-Twister (SEQ ID NO. 5), cp-Twister1 (SEQ ID NO. 16), cp-Twister2 (SEQ ID NO. 17), and cp-Twister3 (SEQ ID NO. 18) to construct plasmids pT7-cpTwister-EGFP, pT7-cpTwister1-EGFP, pT7-cpTwister2-EGFP, and pT7-cpTwister3-EGFP.

[0095] GTGTATCGGTGACAAGTCCGAGATAAATGCAGAGTCATTTCAGAAGAAATTAATGCAACTACAC, SEQ ID NO.16.

[0096] ATACAAGCGGTTACAAGTCCGCATAAATAGTGAGTAGATGGAAACATTTAAAACTAACTTGTAT, SEQ ID NO.17.

[0097] GATAAACGGTTACAAGCCCGTGTAAACGCAGAGTGAGAAATCTTAATGCGGCTTATC, SEQ ID NO. 18.

[0098] (2) In vitro transcription and purification of modified RNA Transcription grouping: Unmodified group: Conventional CTP was used in the transcription system; Modification group: 5-methylcytidine triphosphate (m) was used in the transcription system. 5 Replace CTP with CTP (replacement ratio 100%).

[0099] In vitro transcription and purification: Transcription was performed according to the method in Example 1. After purification, the RNA quality was tested to ensure that the integrity and purity of the RNA before and after modification were consistent.

[0100] (3) Cell transfection and detection Cell culture: BHK-21 cells were seeded in 24-well plates and cultured until confluence reached 70%–80%.

[0101] Transfection grouping: The four replicase RNAs were mixed with their corresponding EGFP RNAs at a molar ratio of 1:8 and divided into unmodified groups (4 combinations) and modified groups (4 combinations), with 3 replicate wells in each group. The transfection method was the same as in Example 1.

[0102] Detection: 48 h after transfection, the expression of EGFP fluorescence in each group was observed by fluorescence microscopy, and the proportion of EGFP-positive cells was detected by flow cytometry to evaluate the effect of different ribozyme variants and base modifications on saaRNA expression efficiency.

[0103] (4) Results and Analysis like Figure 8 As shown, under unmodified conditions, wild-type Twister and Twister3-mediated saaRNA expression efficiency was high (positive rates were 95.8% ± 1.2% and 94.5% ± 1.5%, respectively); while in m 5 Under C modification conditions, the expression efficiency of artificial Twister and Twister3 decreased significantly (positive rates decreased to 12.3%±2.8% and 35.1%±3.0%, respectively). In contrast, Twister1 and Twister2 maintained high expression efficiency under both modified and unmodified conditions: the positive rates were 93.2%±1.8% and 92.7%±2.1% under unmodified conditions, and 88.5%±2.3% and 87.9%±2.5% under modified conditions, respectively, with no significant difference (P>0.05). These results indicate that the low cytidine content Twister ribozyme variant can effectively circumvent the inhibition of ribozyme cleavage activity by base modification, enabling efficient expression of modified saaRNA.

[0104] Example 4 Polycistronic construction and expression of self-assembling and self-replicating RNA (1) Construction of polycistronic saaRNA vector Replicaase RNA template plasmid: The pT7AU-Rep-Twister plasmid (containing T7AU promoter, replicaase ORF and Twister ribozyme) constructed in Example 1 was used directly to ensure the consistency of the replication module.

[0105] Construction of polycistronic RNA template plasmid: A synthetic mCherry-2A-EGFP-2A-tagBFP (RGB) polycistronic sequence (SEQ ID NO.19) was created. This sequence connects three fluorescent protein genes via a P2A self-cleaving peptide (SEQ ID NO.20), enabling the simultaneous release of three independent proteins after transcription of a single RNA.

[0106]

[0107] GLY SER GLY ALA THR ASN PHE SER LEU LEU LYS GLN ALA GLY ASP VAL GLUGLU ASN PRO GLY PRO, SEQ ID NO. 20.

[0108] The T7 promoter (SEQ ID NO.4) and cp-Twister ribozyme (SEQ ID NO.5) were introduced at the 5' end of the RGB sequence using PCR technology, and a 30nt poly(A) tail was added at the 3' end.

[0109] The above fragment was cloned into the EcoRI / XhoI multiple cloning site of the pUC19 plasmid to construct the pT7-cpTwister-RGB-pA plasmid. The plasmid map is shown below. Figure 9 As shown.

[0110] Sanger sequencing confirmed that the T2A peptide sequence, ribozyme sequence, and fluorescent protein coding region had no base mutations and the reading frame was correct.

[0111] (2) In vitro RNA transcription and purification Template preparation: RGB polycistronic RNA transcription templates were prepared by PCR amplification (upstream primer SEQ ID NO.6, downstream primer SEQ ID NO.7). The replicase RNA template used was the MluI linearized pT7AU-Rep-Twister plasmid from Example 1.

[0112] In vitro transcription: Following the reaction system of Example 1, GAU Cap (final concentration 10mM) was added during the transcription of replicase RNA, and GAU Cap was not added during the transcription of RGB RNA. The reaction was carried out at 37°C for 4 hours.

[0113] RNA purification and quality control: Magnetic bead purification: Ambion™ RNA purification magnetic beads were used according to the kit instructions. The elution volume was 20 μL of RNase-free water. After purification, NanoDrop analysis showed: A260 / A280 = 1.85–1.95, A260 / A230 = 2.1–2.3, concentration ≥ 1 μg / μL; 1% agarose denaturing gel electrophoresis showed two single, clear RNA bands with no degradation (replicase RNA approximately 7600 nt, RGB RNA approximately 3000 nt).

[0114] (3) Cell culture and RNA transfection Cell preparation: BHK-21 cells (ATCC CCL-10) were cultured in DMEM high-glucose medium containing 10% FBS. One day before transfection, cells were injected with 1×10⁻⁶ cells / mL.5 Inoculate each well with one culture and incubate at 37°C and 5% CO2 until confluence reaches 70%–80%. Replace with fresh, antibiotic-free medium 1 hour before transfection.

[0115] Transfection ratio: Rep RNA:RGB RNA = 1:4 (molar ratio, total RNA amount 0.5μg).

[0116] Transfection procedure: RNA was transfected using the same transfection reagent as in Example 1, following the kit instructions.

[0117] (4) Detection and analysis of polycistronic expression Fluorescence microscopy observation: 48 h after transfection, fluorescence expression was observed in the mCherry (excitation wavelength 587 nm, emission wavelength 610 nm), EGFP (excitation wavelength 488 nm, emission wavelength 520 nm), and tagBFP (excitation wavelength 387 nm, emission wavelength 449 nm) channels using an Olympus IX73 fluorescence microscope, with the same exposure parameters (200 ms) used to capture images.

[0118] (5) Results and Analysis Fluorescence microscopy results: such as Figure 10 As shown, after transfection with polycistronic saaRNA, red (mCherry), green (EGFP), and blue (tagBFP) fluorescence can be observed simultaneously, with a cell fluorescence coverage of over 90%.

[0119] Conclusion: The saaRNA system can efficiently mediate the self-assembly and replication of polycistronic RNAs, enabling the synchronous and balanced expression of multiple genes.

[0120] Example 5 Multigene expression of self-assembled, self-replicating RNA (1) Construction of multi-gene saaRNA vector Replicaase RNA template: pT7AU-Rep-Twister plasmid as in Example 1.

[0121] Construction of three target gene RNA templates: mCherry gene (SEQ ID NO.21), EGFP gene (SEQ ID NO.3), and tagBFP gene (SEQ ID NO.22) were artificially synthesized. A T7 promoter (SEQ ID NO.4) and cp-Twister ribozyme (SEQ ID NO.5) were introduced into the 5' end of each gene, and a 30nt poly(A) tail was added to the 3' end.

[0122] ATGTACCCATACGATGTTCCAGATTACGCTGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAG,SEQ ID NO.21。

[0123] , SEQ ID NO.22.

[0124] The three genes were cloned into the pUC19 plasmid, respectively, to construct three plasmids: pT7-cpTwister-mCherry-pA, pT7-cpTwister-EGFP-pA, and pT7-cpTwister-tagBFP-pA. The plasmid maps are shown below. Figure 11 As shown.

[0125] Sequencing confirmed that the coding regions and ribozyme sequences of each gene were correct.

[0126] (2) In vitro RNA transcription and purification Following the method in Example 4, replicase RNA, mCherry RNA, EGFP RNA, and tagBFP RNA were transcribed and purified respectively. Quality control results showed that the A260 / A280 of the four RNAs were all between 1.8 and 2.0, and the agarose gel electrophoresis bands were single, without degradation or extraneous bands (mCherry RNA approximately 0.8 nt, EGFP RNA approximately 0.8 nt, and tagBFP RNA approximately 0.8 nt).

[0127] (3) Cell culture and RNA transfection Cell preparation: BHK-21 cells were seeded in 24-well plates and cultured under the same conditions as in Example 4.

[0128] Transfection groups: Four experimental groups were set up, with each group transfected with a total RNA amount of 0.5 μg. The effect of the mixed molar ratio of replicase RNA and the three target gene RNAs on co-expression efficiency was investigated. Each group had three replicates. Group 1: Rep RNA:mCherry:EGFP:tagBFP=1:2:2:2 (molar ratio, total RNA 0.5μg); Group 2: Rep RNA:mCherry:EGFP:tagBFP=1:4:4:4 (molar ratio, total RNA 0.5μg); Group 3: Rep RNA:mCherry:EGFP:tagBFP=1:8:8:8 (molar ratio, total RNA 0.5μg); Group 4: Rep RNA:mCherry:EGFP:tagBFP=1:16:16:16 (molar ratio, total RNA 0.5μg).

[0129] The transfection reagents and procedures are the same as in Example 4.

[0130] (4) Detection and analysis of multiple gene expression Fluorescence microscopy observation: such as Figure 12 48 hours after transfection, the experimental groups were observed under three fluorescence channels. All three fluorescences were detected simultaneously, and the fluorescence intensity of group 3 was the strongest.

[0131] Conclusion: The saaRNA system can simultaneously mediate the self-assembly and replication of multiple independent target gene RNAs. When the molar ratio of replicase RNA to each target gene RNA is 1:8:8:8, the multi-gene co-expression efficiency is optimal, the expression levels of the three genes are balanced, and there is no obvious mutual inhibition, indicating that the system has a flexible multi-gene delivery capability.

[0132] Example 6 Self-assembling and self-replicating RNA expresses viral antigens (SARS-CoV-2 RBD protein). (1) Construction of antigen expression saaRNA vector Replicaase RNA template: pT7AU-Rep-Twister plasmid as in Example 1.

[0133] RBD RNA template construction: The artificially synthesized SARS-CoV-2 (Wuhan-Hu-1 strain) spike protein RBD coding sequence (SEQ ID NO. 23, covering amino acids 319~541) was used to introduce the T7 promoter (SEQ ID NO. 4) and cp-Twister ribozyme (SEQ ID NO. 5) at the 5' end, and a 30nt poly(A) tail was added to the 3' end.

[0134]

[0135] The fragment was cloned into the pUC19 plasmid to construct the pT7-cpTwister-RBD-pA plasmid. The plasmid map is shown below. Figure 13 As shown.

[0136] Sequencing confirmed that the RBD sequence is identical to GenBank accession number MN908947.3, with no amino acid mutations.

[0137] (2) In vitro RNA transcription and purification The replicase RNA and RBD RNA were prepared according to the method in Example 1. After purification, the quality control results were: A260 / A280 = 1.88~1.92, RBD RNA length was about 1 kb, and there was no degradation.

[0138] (3) Cell culture and RNA transfection Cell preparation: BHK-21 cells were seeded in 6-well plates (5 × 10⁶ cells / well). 5 (each well contains 1 cell), and cultured until confluence reaches 70%~80%.

[0139] Transfection grouping: Experimental group: Rep RNA:RBD RNA = 1:8 (molar ratio, total RNA 2μg) + LNP transfection reagent (prepared according to instructions); Control group 1: Full-length saRNA-RBD (2 μg) + LNP (prepared according to instructions); Control group 2: RBD mRNA (2μg) + LNP (prepared according to instructions).

[0140] Each group had 3 replicates. After transfection, the cells were cultured for a longer period. Cell supernatants were collected at 24h, 48h, 72h, and 96h and stored at -80℃ for later use.

[0141] (4) Detection of RBD protein expression (ELISA method) ELISA Procedure: Use the Anti-SARS-CoV-2 S-RBD Human IgG ELISA Kit (Proteintech) and follow the instructions. Coating: Dilute RBD monoclonal antibody (1 μg / mL) with coating buffer and coat the microplate overnight at 4°C; Sealing: 5% skim milk powder sealed at 37℃ for 1 hour; Sample addition: Dilute cell supernatant 1:100 and incubate at 37°C for 2 hours; Detection: Add HRP-labeled secondary antibody (1:5000), incubate at 37°C for 1 h, and read the value at 450 nm after TMB color development.

[0142] Standard curve plotting: Plot a standard curve using the recombinant RBD protein provided in the kit and calculate the RBD protein concentration in the supernatant.

[0143] (5) Results and Analysis like Figure 14 As shown, RBD protein expression in the experimental group could be detected 24 h after transfection (1650±213 ng / mL), reached a peak at 72 h (3285±124 ng / mL), and remained at a high level for 96 h. The peak RBD expression in control group 1 (full-length saRNA) was 2242±172 ng / mL (72 h), and the expression level remained stable thereafter. The highest expression in control group 2 (mRNA) was 538±78 ng / mL at 24 h, and then decreased rapidly, becoming almost undetectable after 72 h.

[0144] Conclusion: The saaRNA system can efficiently and sustainably express the SARS-CoV-2 RBD antigen, with significantly better expression levels and durations than traditional saRNA and mRNA, demonstrating its potential for vaccine development.

[0145] Example 7 Protein expression of self-assembled, self-replicating RNA in mice (firefly luciferase) (1) Construction of saaRNA expression vector in vivo Replicaase RNA template: pT7AU-Rep-Twister plasmid as in Example 1.

[0146] Construction of luciferase RNA template: A firefly luciferase gene (SEQ ID NO.24) was artificially synthesized, with a T7 promoter (SEQ ID NO.4) and cp-Twister ribozyme (SEQ ID NO.5) introduced at the 5' end, and a 30nt poly(A) tail added at the 3' end.

[0147]

[0148] Cloning into the pUC19 plasmid, constructing the pT7-cpTwister-Luc-pA plasmid, plasmid map as shown below. Figure 15 As shown.

[0149] (2) In vitro RNA transcription and purification The replicase RNA and Luc RNA were prepared according to the method in Example 1, purified and mixed (molar ratio 1:8), and encapsulated with invivo transfection reagent (Denabio) to prepare LNP-RNA complex (RNA concentration 0.5 μg / μL), which was stored at 4°C in the dark for later use.

[0150] (3) Animal experiment design and operation Animal grouping: Fifteen male C57BL / 6 mice aged 2-4 weeks were randomly divided into 3 groups (n=5 per group): Experimental group: Subcutaneous injection of LNP-saaRNA complex (containing 5 μg of Luc RNA); Control group: Subcutaneous injection of LNP-full-length saRNA-Luc (containing 5 μg of Luc RNA); Blank control group: Subcutaneous injection of an equal volume of LNP buffer.

[0151] In vivo imaging detection: Detection was performed 48 hours after transfection. Intraperitoneal injection of luciferase substrate (150 mg / kg body weight) was administered, and the mixture was allowed to stand in the dark for 15 minutes.

[0152] Images were acquired using the IVIS Spectrum small animal in vivo imaging system with an exposure time of 10 seconds. The fluorescence intensity (photons / second / cm² / sphericity, p / s / cm²) of the liver region was analyzed using LivingImage 4.5 software. 2 / sr).

[0153] (4) Results and Analysis like Figure 16 As shown, fluorescence signals were detected in both the experimental and control groups 48 hours after transfection, with the fluorescence intensity in the experimental group being (4.8±0.3)×10⁻⁶. 9 p / s / cm 2 / sr, higher than the control group (3.2±0.2)×10 9 p / s / cm 2 / sr. No fluorescence signal was observed in the blank control group.

[0154] Conclusion: The saaRNA system can achieve efficient expression of target proteins in mice, providing a feasible approach for in vivo gene therapy and vaccination.

[0155] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0156] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A self-assembling, self-replicating RNA system, characterized in that, The self-replicating RNA is truncated at a selected location to form two independent RNA sequences, and an RNA ribozyme sequence is covalently linked to the 3' end of the upstream sequence and the 5' end of the downstream sequence at each RNA truncation site; After the two independent RNA sequences are co-introduced into the cell, they undergo ribozyme self-cleavage and host RTCB ligase-mediated self-ligation reaction to form a complete self-replicating RNA molecule, thereby driving the continuous expression of the target protein.

2. The system as described in claim 1, characterized in that, The self-replicating RNA is a Venezuelan equine encephalitis virus, eastern equine encephalitis virus, Evogre virus, Chikungunya virus, Ross River virus, Semliki forest virus, Sindbis virus, western equine encephalitis virus, Marburg virus, or a functional variant thereof obtained by mutation of nsP2-V372A or nsP4-K179R.

3. The system as described in claim 1, characterized in that, The self-replicating RNA comprises, from the 5' end to the 3' end, a 5' cap structure, a 5' untranslated region, an open reading frame encoding RNA replicase, a subgenomic promoter, a target gene sequence, a 3' untranslated region, and a poly(A) tail. The target gene sequence is a single gene, or... Polycistronic gene clusters linked via 2A peptide / internal ribosome entry sites.

4. The system as described in claim 3, characterized in that, The cutoff position is selected from any one or a combination of the following: (1) Inside the open reading frame encoding RNA replicase; (2) Between the subgenomic promoter and the target gene sequence; (3) Inside the target gene sequence.

5. The system as described in claim 1, characterized in that, The RNA ribozyme is a hammerhead ribozyme, hairpin ribozyme, hepatitis D virus ribozyme, Varkud satellite ribozyme, Twister ribozyme, Twister Sister ribozyme, Hatchet ribozyme, Pistol ribozyme, circular permutation Twister, or hammerhead variant ribozyme.

6. The system as described in claim 1, characterized in that, The independent RNA sequence is transcribed in vitro driven by the T7, SP6 or T3 promoter, and the RNA ribozyme self-cleaves in vitro or in vivo to produce a 2',3'-cyclic phosphate terminus and a 5'-hydroxy terminus. The independent RNA sequence consists of natural ribonucleotides or modified nucleotides; The modified nucleotide includes at least one of 5-methylcytosine, 5-hydroxymethylcytosine, 5-methyluridine, pseudouridine, N1-methylpseudouridine, and N1-ethylpseudouridine.

7. The system as described in claim 1, characterized in that, The cells are eukaryotic cells, prokaryotic cells, or cell-free in vitro translation systems.

8. The system as described in claim 1, characterized in that, The molar ratio of the replicase RNA fragment to the target gene RNA fragment is 1:1 to 1:

32.

9. The application of the system according to any one of claims 1 to 8 in the following fields: (1) Vaccine production; (2) Recombinant protein expression; (3) Cell reprogramming; (4) Gene therapy.

Images