Engineering strain capable of efficiently degrading dioxin compounds as well as construction method and application of engineering strain

Abstract

The invention belongs to the technical field of environmental microorganisms and genetic engineering, and particularly discloses an engineering strain capable of efficiently degrading dioxin compounds as well as a construction method and application of the engineering strain. Aiming at the problems of difficulty in genetic manipulation and limited degradation efficiency of wild type Sphingomonascus hiiRW1, the method comprises the following steps: firstly, accurately knocking out a plurality of target genes by utilizing a single base editing technology, and determining dxnA1, dxnA2, 3056 and 3046amp through screening; the invention also relates to a key role of genes such as 4901, 4902 and the like in the degradation process of dioxin compounds. On the basis, a key gene is cloned into a vector pYYDT, and an engineering strain is successfully constructed. Wherein the degradation performance of the engineering strain RW1 / pYYDT-dxnA2 is the most prominent, and the degradation rate of the engineering strain RW1 / pYYDT-dxnA2 on the DBF is increased by about 30.11% compared with that of the engineering strain RW1 / pYYDT-dxnA2 on the DBF.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of environmental microorganisms and genetic engineering, and specifically discloses an engineered strain for efficiently degrading dioxin compounds and a construction method and application thereof. BACKGROUND

[0002] As a typical persistent organic pollutant, dioxin (PCDD / Fs) widely exists in waste incineration fly ash, metallurgical smoke dust, paper pulp chlorine bleaching wastewater, hospital wastewater and contaminated sediments; although its water solubility is extremely low (pg-ng·L -1 grade), it is easy to be adsorbed on suspended particles and organic matter, enters water bodies with wastewater discharge and is long-term accumulated in sediments, becoming an important endogenous pollution source of water environment.

[0003] Traditional physical and chemical treatments rely on >850°C high-temperature incineration, V2O5 / TiO2 catalytic oxidation, activated carbon adsorption or advanced oxidation (photocatalysis, ozone, Fenton) and the like, which not only has high energy consumption and cost, but also has limited removal efficiency of dioxin in low-concentration and large-volume wastewater / sludge, and the adsorption method also has the problem of secondary solid waste disposal, so green and efficient alternative technologies are urgently needed.

[0004] Sphingomonas wittichii (RW1) can grow with dioxin as the sole carbon source / energy source, although Sphingomonas wittichii RW1 has the potential to naturally degrade dioxin, but its genetic manipulation system is not mature, and the traditional homologous recombination technology has extremely low efficiency (usually <5%) in this strain, and it is difficult to realize precise and efficient gene editing and modification. At the same time, the degradation efficiency of wild-type RW1 on dioxin compounds still has a large space for improvement, which limits its practical application in environmental remediation. Therefore, it is urgent to develop a high-efficiency and stable genetic engineering method suitable for RW1, and to construct an engineered strain with significantly enhanced degradation performance, so as to provide a new technical means for the bioremediation of dioxin pollution. SUMMARY

[0005] The application aims to provide an engineered strain for efficiently degrading dioxin compounds and a construction method, which uses a high-efficiency gene editing tool for systematic functional gene screening, locks the key target, and realizes the directional enhancement of degradation capacity through overexpression of the target gene, to solve the following technical problems: 1. The genetic manipulation system of Sphingomonas wittichii RW1 is not mature, the homologous recombination efficiency is low, and the gene editing efficiency is not high; 2. The wild-type Sphingomonas wittichii RW1 has low degradation efficiency on dioxin compounds.

[0006] In order to achieve the above object, the technical scheme adopted by the present application is as follows: A construction method of an engineered strain for efficiently degrading dioxin compounds, comprising the following steps: Step one, using single base editing technology, inactivating target genes related to dioxin degradation pathway in Sphingomonas wittichii RW1 to obtain Sphingomonas wittichii RW1 gene knockout mutant strain; Step two, screening and identifying the key genes necessary for Sphingomonas wittichii RW1 to degrade DBF (dibenzofuran) from the Sphingomonas wittichii RW1 gene knockout mutant strain; Step three, cloning the screened and identified key genes into a vector to construct a recombinant overexpression plasmid; Step four, electrotransforming the recombinant overexpression plasmid into the Sphingomonas wittichii RW1 wild type strain to obtain an engineered strain overexpressing target genes; The engineered strain overexpressing target genes is the engineered strain for efficiently degrading dioxin compounds.

[0007] Preferably, in step one, the target genes include dxnA1 gene, dxnA2 gene, 3056 gene, 3057 gene, 3046 gene and 4902 gene.

[0008] Preferably, the forward spacer sequence of the dxnA1 gene is shown as SEQ ID NO. 1: 5'-ctcaatcagtgccgtcaccg-3'; The forward spacer sequence of the dxnA2 gene is shown as SEQ ID NO. 2: 5'-agtcgaacagttcttgtacg-3'; The forward spacer sequence of the 3056 gene is shown as SEQ ID NO. 3: 5'-ggccgacactggagctatgt-3'; The forward spacer sequence of the 3057 gene is shown as SEQ ID NO. 4: 5'-tattatcagcgtcacgtcat-3'; The forward spacer sequence of the 3046 gene is shown as SEQ ID NO. 5: 5'-gggccacaaccgatgccgaa-3'; The forward spacer sequence of the 4902 gene is shown as SEQ ID NO. 6: 5'-cgacagttcgccgataacga-3'.

[0009] Preferably, in step one, the inactivation of the target gene includes changing C in the target gene to T, thereby introducing a stop codon in advance to achieve gene inactivation.

[0010] Preferably, in step two, the specific method for screening and identification is as follows: by comparing and analyzing the growth ability of the Sphingomonaswittichii RW1 gene knockout mutant strain and the Sphingomonaswittichii RW1 wild-type strain when DBF is the only carbon source, as well as the actual degradation efficiency of DBF, genes that can cause severe inhibition of strain growth or basic loss of degradation function are screened out, thereby identifying the key genes necessary for Sphingomonaswittichii RW1 to degrade DBF.

[0011] Preferably, DBF is the unchlorinated core structure of polychlorinated dibenzofurans (PCDFs, which are typical dioxin-like pollutants). It has the same aromatic ring-oxygen bridge skeleton as PCDFs and is an ideal non-toxic substitute for studying the microbial degradation mechanism and kinetics of dioxin-like compounds.

[0012] Preferably, in step two, the key gene includes the target gene or a combination of target genes from step one.

[0013] Preferably, in step three, the vector is required to be able to stably replicate and be induced to express in Sphingomonaswittichii RW1; The vectors that can be stably replicated and induced to be expressed in Sphingomonaswittichii RW1 include pYYDT.

[0014] Preferably, in step four, the electroconversion process includes: The recombinant overexpression plasmid and empty vector pYYDT were electroporated into the wild-type strain Sphingomonaswittichii RW1. Immediately after electroporation, LB medium was added, transferred to EP tubes, and the culture was revived. The revived bacterial culture was then spread on LB plates containing kanamycin and cultured.

[0015] The present invention also discloses an engineered strain for efficiently degrading dioxin compounds, obtained by the method described above for constructing an engineered strain for efficiently degrading dioxin compounds.

[0016] Application of an engineered strain that efficiently degrades dioxin-like compounds, as described above, in the degradation of dioxin-like pollutants in the environment.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. An efficient gene editing tool for RW1 was established: Single-base editing technology was successfully applied to Sphingomonaswittichii RW1, overcoming the bottleneck of low homologous recombination efficiency and achieving rapid and accurate gene knockout, providing a key tool for systematic research on the degradation gene function of this bacterium; 2. Key genes for DBF degradation were identified: By combining the knockout and phenotypic analysis strategies, the core roles of genes such as dxnA1, dxnA2, 3056, 3046 & 4902 in the DBF degradation process were clarified, revealing the degradation mechanism of RW1 at the functional level and providing clear targets for the rational design of engineered bacteria. 3. Created engineered strains with significantly improved degradation performance: Engineered strains constructed based on the overexpression of key genes (especially RW1 / pYYDT-dxnA2) increased the DBF degradation rate by about 30% in 96h, providing a powerful biotechnological solution for solving dioxin pollution in real-world environments. The engineered strain constructed in this invention has a clear enhanced degradation function and can be safely and efficiently applied to the bioremediation of wastewater, sediment and sites contaminated by dioxin-like pollutants. It is both environmentally friendly and cost-effective, and has broad application prospects. Attached Figure Description

[0018] Figure 1 The OD values ​​of the culture media of wild-type Sphingomonaswittichii RW1, RW1ΔdxnA1, RW1Δ3056, RW1ΔdxnA2, RW1Δ3057, RW1Δ3046, RW1Δ4902, and RW1Δ3046Δ4902 in Example 2 are... 600nm The measurement results are shown in the figure. Figure 2 The graph shows the results of DBF residual rate determination in the culture medium of wild-type Sphingomonaswittichii RW1, RW1ΔdxnA1, RW1Δ3056, RW1ΔdxnA2, RW1Δ3057, RW1Δ3046, RW1Δ4902, and RW1Δ3046Δ4902 in Example 2. Figure 3 The graph shows the results of DBF residual rate determination in the culture medium of engineered strains RW1 / pYYDT-dxnA1, RW1 / pYYDT-dxnA2, RW1 / pYYDT-3056, RW1 / pYYDT-3046&4902, empty vector control strain RW1 / pYYDT, and wild-type strain Sphingomonaswittichii RW1 in Example 4. Detailed Implementation

[0019] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0020] The standard culture conditions for strain SphingomonaswittichiiRW1 were: dark environment, rotation speed of 200 r / min, temperature of 30℃, M9 basal medium supplemented with trace elements, and 1 g / L DBF as the sole carbon source.

[0021] The formula for M9 basic culture medium is: Na₂HPO₄ 6.78 g / L, KH₂PO₄ 3.0 g / L, NaCl 0.5 g / L, NH₄Cl 1.0 g / L, MgSO₄ 0.241 g / L, CaCl₂ 0.011 g / L. It is autoclaved at 121℃ for 20 min (MgSO₄ and CaCl₂ should be prepared as stock solutions and sterilized separately, as dissolving them together can easily form precipitates). The formula for the 100× trace element mother liquor is: 1.5 g / L ferrous chloride tetrahydrate, 0.006 g / L cobalt chloride hexahydrate, 0.036 g / L manganese chloride tetrahydrate, 0.024 g / L zinc chloride, 0.002 g / L boric acid, 0.19 g / L sodium molybdate dihydrate, 0.1 g / L nickel chloride hexahydrate, and 0.07 g / L copper chloride dihydrate, filtered for sterilization.

[0022] Example 1 This embodiment discloses a method for preparing a Sphingomonaswittichii RW1 gene knockout mutant strain: The target genes dxnA1, dxnA2, 3056, 3057, 3046 and 4902 related to the dioxin degradation pathway were selected from SphingomonaswittichiiRW1. The prespacer sequence of the dxnA1 gene is shown in SEQ ID NO.1: 5'-ctcaatcagtgccgtcaccg-3'; The prespacer sequence of the dxnA2 gene is shown in SEQ ID NO.2: 5'-agtcgaacagttcttgtacg-3'; The prespacer sequence of gene 3056 is shown in SEQ ID NO.3: 5'-ggccgacactggagctatgt-3'; The prespacer sequence of gene 3057 is shown in SEQ ID NO.4: 5'-tattatcagcgtcacgtcat-3'; The prespacer sequence of gene 3046 is shown in SEQ ID NO. 5: 5'-gggccacaaccgatgccgaa-3'; The prespacer sequence of gene 4902 is shown in SEQ ID NO. 6: 5'-cgacagttcgccgataacga-3'; Using the single-plasmid cytosine base editor pYYDT-BE (Environ. Sci. Technol. 2022, 56, 17, 12247-12256), the C in the target gene was changed to T, thereby introducing a stop codon in advance to achieve gene inactivation and obtain the Sphingomonaswittichii RW1 gene knockout mutant strain. The specific steps are as follows: Step 1: Target Design and Synthesis 1.1 The target sequence (20bp, PAM is NGG, cytosine is located at position 3-8 of the distal PAM) was designed using the “CBEI-predict” module of the CRISPR-CBEI online tool. 1.2 Use the "Off-Target" function of the same platform to screen sequences with zero off-target potential; 1.3 All sequences were synthesized by a biotechnology company. Step 2, Plasmid Construction: 2.1 The pYYDT-BE plasmid was digested with BsaI restriction endonuclease (NEB) to form sticky ends, and impurities in the digested plasmid were removed using a purification kit (Sangon Biotech). 2.2 Four-bp sticky ends were added to both ends of the prespacer sequences of the target genes dxnA1, dxnA2, 3056, 3057, 3046, and 4902, respectively. These ends were then paired and ligated with enzyme digestion plasmids to synthesize single-stranded DNA with four-bp sticky ends. The synthesized single-stranded DNA with four-bp sticky ends was then annealed to convert it into double-stranded DNA. The annealing process was as follows: the DNA was placed in a PCR instrument at 56°C for 15 seconds; phosphorylation was performed using T4 polynucleotide kinase (Takara). 2.3 The ligation fragment and enzyme-digested plasmid were assembled using GoldenGate and transformed into E. coli Turbo competent cells. Specifically, 5 μL of the phosphorylated plasmid from 2.2 was added to 50 μL of E. coli Turbo competent cells (Tulugang Biotechnology), incubated on ice for 30 min, heat-shocked at 42℃ for 90 s, incubated on ice for 2 min, 1 mL of LB medium was added, and activated at 37℃ and 200 rpm for 1 h. 100 μL of the bacterial culture was then plated on LB agar plates with a final concentration of 50 μg / mL kanamycin to screen for positive clones. Recombinant plasmids pYYDT-BE-dnxA1, pYYDT-BE-dxnA2, pYYDT-BE-3056, pYYDT-BE-3057, pYYDT-BE-3046, pYYDT-BE-4902, and pYYDT-BE-3046&4902 (3046&4902 represent two genes, 3046 and 4092, respectively; that is, one gene was knocked out first, and then another gene was knocked out based on this single knockout, resulting in a double knockout) were obtained. The plasmids were then expanded and cultured and extracted for later use. The expansion culture included inoculating positive clones into LB tubes with a final concentration of 50 μg / mL kanamycin and incubating at 37°C and 200 rpm for 16 h. Step 3: Electroporation and Obtaining Knockout Strains: 3.1 The Sphingomonaswittichii RW1 electrocompetent cells were prepared using the sucrose washing method, specifically as follows: Sphingomonaswittichii RW1 cells were activated by inoculating them into a culture tube and cultured to the plateau phase. 2 mL of the bacterial culture was centrifuged at 8000 g for 2 min to collect the cells. 1 mL of 300 mM sucrose solution was added to the cells in a clean bench, and the cells were slowly resuspended by pipetting. After centrifugation at 8000 g for 2 min, the supernatant was discarded. This process was repeated, and 100 μL of 300 mM sucrose solution was added to prepare a cell suspension, thus obtaining the Sphingomonaswittichii RW1 electrocompetent cells. Recombinant plasmids pYYDT-BE-dnxA1, pYYDT-BE-dxnA2, pYYDT-BE-3056, pYYDT-BE-3057, pYYDT-BE-3046, pYYDT-BE-4902, and pYYDT-BE-3046&4902 were electroporated into SphingomonaswittichiiRW1 electroporation competent cells. The electroporation process included: adding 1 μg of recombinant plasmid to the... After adding 100 μL of competent cells, mix them thoroughly by pipetting and transfer them into an electroporation cuvette with an electrode spacing of 2 mm. Place the cuvette in an electroporator, set the voltage to 2.5 kV, and electroporate for 5 ms. Immediately add 1 mL of fresh LB to the cuvette, mix thoroughly by pipetting, and carefully transfer the liquid into a sterile 1.5 mL EP tube. Incubate at 30°C and 200 rpm for 2 h in a shaker. Spread the bacterial culture onto an LB agar plate containing 50 μg / mL kanamycin resistance. 3.2 Select positive single clones verified by PCR. The PCR verification process is as follows: Select single clones from the LB plates in 3.1, and use bacterial culture PCR to verify whether the edited plasmid has been successfully transformed into SphingomonaswittichiiRW1. The bacterial culture with successfully transformed plasmid is plated with 10% sucrose to eliminate the plasmid. The editing effect is verified by Sanger sequencing. Finally, the gene knockout mutant strains of SphingomonaswittichiiRW1 are obtained: RW1ΔdxnA1, RW1Δ3056, RW1ΔdxnA2, RW1Δ3057, RW1Δ3046, RW1Δ4902, and RW1Δ3046Δ4902. Among them, RW1Δ3046Δ4902 represents the double knockout of genes 3046 and 4092.

[0023] Example 2 This embodiment discloses a method for screening and identifying key genes essential for DBF degradation by Sphingomonaswittichii RW1 from Sphingomonaswittichii RW1 gene knockout mutant strains: Step 1: Inoculate wild-type Sphingomonaswittichii RW1 strain (denoted as RW1) and Sphingomonaswittichii RW1 gene knockout mutant strains RW1ΔdxnA1, RW1Δ3056, RW1ΔdxnA2, RW1Δ3057, RW1Δ3046, RW1Δ4902, and RW1Δ3046Δ4902 into 8 test tubes containing 5 mL of LB medium, respectively, and culture at 30℃ and 200 rpm for 20 h to obtain seed culture; Step 2: Transfer the 8 seed cultures to sterilized 5mL centrifuge tubes, centrifuge at 6000g for 3min, resuspend the cultures in PBS and wash three times to remove the influence of nutrients in LB. At an inoculation rate of 1% (v / v), use a sterile pipette to add 0.5mL of seed culture to each of the 250mL Erlenmeyer flasks containing 50mL LM9 minimal medium (containing 1.0g / LDBF). Set up 3 replicates and place all Erlenmeyer flasks in the dark at 30℃ and 200rpm. Step 3: Take samples periodically, 1 mL of culture medium each time, and measure the absorbance (OD) at 600 nm using a UV spectrophotometer. 600nm ), OD 600nm The measurement results are as follows Figure 1 As shown. From Figure 1 It can be seen that, compared with the wild-type SphingomonaswittichiiRW1 strain RW1, the gene knockout mutant strains RW1ΔdxnA1, RW1Δ3056, RW1ΔdxnA2, RW1Δ3057, RW1Δ3046, RW1Δ4902, and RW1Δ3046Δ4902 all affected the growth of strain RW1 in DBF as the sole carbon source, and their growth was inhibited. Among them, the gene dxnA1, gene 3056, and gene The knockout of dxnA2, gene 3046, and gene 3046 & 4092 resulted in almost no growth, indicating that genes dxnA1, 3056, dxnA2, 3046, and 3046 & 4092 are crucial for the growth of SphingomonaswittichiiRW1 with BDF as the sole carbon source. This leads to the identification of key genes necessary for RW1 to degrade DBF: genes dxnA1, dxnA2, 3056, and 3046 & 4902 (a combination of genes 3046 and 4092).

[0024] Further, the degradation of dioxin analogue DBF by wild-type Sphingomonaswittichii RW1 strain RW1, and gene knockout mutants of Sphingomonaswittichii RW1 (RW1ΔdxnA1, RW1Δ3056, RW1ΔdxnA2, RW1Δ3057, RW1Δ3046, RW1Δ4902, and RW1Δ3046Δ4902 was determined, including the following steps: (1) Sample preparation: Take 5 mL of the 8 culture solutions that were cultured at 30℃ and 200 rpm in the dark for 96 h in step 2 above into 50 mL centrifuge tubes, add 5 mL of dichloromethane, vortex for 3 min, centrifuge at 10,000×g for 10 min to separate the two phases, carefully aspirate the lower organic phase with a pipette and transfer it to a new centrifuge tube, repeat step 2 twice to ensure complete DBF extraction, combine the organic phases, add 0.5 g of anhydrous sodium sulfate to remove residual water, transfer the organic phase to a nitrogen blow-off tube, blow dry with nitrogen in a 35℃ water bath, dissolve the residue with 1 mL of methanol, mix thoroughly, filter through a 0.22 μm organic phase filter membrane into an HPLC sample vial for analysis; (2) Preparation of standard products: 2.1 Accurately weigh 10.0 mg of DBF standard and dissolve it in 10 mL of methanol to prepare DBF standard stock solution (1000 mg / L), and store at 4°C protected from light; 2.2 DBF mother liquor was serially diluted with methanol to obtain standard DBF working solutions with concentrations of 0.1 mg / L, 0.5 mg / L, 1 mg / L, 5 mg / L, 10 mg / L, and 20 mg / L; The HPLC detection conditions were as follows: a C18 reverse-phase column was used, the mobile phase was methanol:water = 30%:70% (volume ratio), the column temperature was set at 30℃, the flow rate was 1 ml / min, the injection volume was 20 uL, and an ultraviolet detector was used with a detection wavelength of 280 nm. The DBF standard curve was obtained by fitting the standard concentration and peak area. The peak surface of the sample was then substituted into the standard curve to calculate the residual DBF concentration in the culture medium. DBF residual rate = residual DBF concentration / initial DBF concentration. The determination results of DBF residual rate are as follows: Figure 2 As shown; The initial DBF concentration was 1 g / L.

[0025] from Figure 2 It can be seen that, compared with the wild-type SphingomonaswittichiiRW1 strain, the residual rate of DBF in the culture media of RW1ΔdxnA1, RW1Δ3056, RW1ΔdxnA2, RW1Δ3057, RW1Δ3046, RW1Δ4902, and RW1Δ3046Δ4902 all increased. This indicates that the knockout of genes dxnA1, 3056, dxnA2, 3057, 3046, 4902, and 3046&4092 inhibited the degradation of DBF by SphingomonaswittichiiRW1. In particular, the knockout of genes dxnA1, 3056, dxnA2, and 3046&4092 almost completely eliminated the ability to degrade DBF.

[0026] Example 3 This embodiment discloses a method for constructing an engineered strain that efficiently degrades dioxin-like compounds.

[0027] After screening out the key genes for DBF degradation in Sphingomonaswittichii RW1, the key genes were overexpressed to verify the ability to degrade DBF. The core idea was to clone the key genes (dxnA1, dxnA2, 3056, and 3046 & 4902) into the pYYDT vector, which can stably replicate and be induced to express in Sphingomonaswittichii RW1, and then transform them into wild-type Sphingomonaswittichii RW1 strains to obtain overexpressing engineered bacteria. The specific steps are as follows: Step 1: Construct overexpression plasmids: 1.1 Genomic DNA was extracted from the wild-type strain Sphingomonaswittichii RW1. Specific primers were designed, and PCR was performed using high-fidelity DNA polymerase (Primestar HS, Takara) to amplify the target gene fragment containing the complete coding sequence. The sequence of the forward primer for gene dxnA1 is shown in SEQ ID NO.7: 5'-taagaaggagatatacatatggcaaagagaaatgcagttgac-3'; The sequence of the reverse primer for the gene dxnA1 is shown in SEQ ID NO. 8: 5'-tcatgcttcatctcccgccagcaaataaaacgaaaggct-3'; The sequence of the forward primer for the gene dxnA2 is shown in SEQ ID NO.9: 5'-taagaaggagatatacatatgagctctcaggttaagaccacc-3'; The sequence of the reverse primer for the gene dxnA2 is shown in SEQ ID NO.10: 5'-ttacaggaaggttgagatgccggacaaataaaacgaaaggct-3'; The sequence of the forward primer for gene 3056 is shown in SEQ ID NO. 11: 5'-taagaaggagatatacatatgaatgttgcgacttcgatcgc-3'; The sequence of the reverse primer for gene 3056 is shown in SEQ ID NO. 12: 5'-tcatatctccatcacctcgcgccaaataaaacgaaaggct-3'; The sequence of the forward primer for gene 3046 is shown in SEQ ID NO. 13: 5'-taagaaggagatatacatatgtctgaaatctcgagcctcgg-3'; The sequence of the reverse primer for gene 3046 is shown in SEQ ID NO. 14: 5'-aagttgttttactgacattcaatgcgcgtgcgcg-3'; The sequence of the forward primer for gene 4902 is shown in SEQ ID NO. 15: 5'-atgtcagtaaaacaacttggctacct-3'; The sequence of the reverse primer for gene 4902 is shown in SEQ ID NO. 16: 5'-tcaatgcgccggcaactgcaaataaaacgaaaggct-3'; 1.2 After verifying the correct fragment size by agarose gel electrophoresis, the PCR products were purified using a gel recovery kit to obtain the gene dxnA1 fragment, gene dxnA2 fragment, gene 3056 fragment, gene 3046 fragment and gene 4902 fragment, respectively. 1.3 Using pYYDT directly as a template, PCR amplification was performed using high-fidelity DNA polymerase (Primestar HS, Takara), and the linearized pYYDT vector backbone was obtained by agarose gel extraction and purification. The sequence of the forward primer for the linearized pYYDT vector backbone is shown in SEQ ID NO.17: 5'-caaataaaacgaaaggctcagtcgaaagac-3'; The sequence of the reverse primer for the linearized pYYDT vector backbone is shown in SEQ ID NO.18: 5'-atgtatatctccttcttaaagttaaacaaaattattcctagggc-3'; 1.4 Construction of recombinant plasmids: The purified linearized pYYDT vector backbone was ligated with gene fragments dxnA1, dxnA2, 3056, and 3046 & 4902 at 50°C for 2 hours to construct four ligation systems. The gene sequence of the linearized pYYDT vector backbone is shown in SEQ ID NO.19: The gene sequence of the dxnA1 fragment is shown in SEQ ID NO.20: The gene sequence of the gene dxnA2 fragment is shown in SEQ ID NO. 21: atgagctctcaggttaagaccaccgatgatcggctccggatccagtgggaagtcgaacagttcttgtacgaggaagccgcactcctcgccgaacggcgcttcgaagactggtacgccctgatcgccgaggacatccactatgctgtccccgcgcgcgaggtgcggatcctgaaggatatcgacaagcagttcctgccgctatcgaaaggcgctcacttcgaggacaattataaatcgctcggaatgcgcgtcaagaagctctccgatcaccgcacctgggtggaaaaccccccgatgtaccagcgtaccgccgtcaccaatgtccgcgtgcgcgaaaccgatgtcgcgggtgaatatgaagcctacagcaacatcgccttcacccgctctcgcctcgaaaaagtctatccgccgctgatcggctaccgccatgatctcgtccgacgcagcgatgggccgctaggattcagactcgccaggcgaaccgtctacctcgatcacgccgtgctcccgggatccggcatctcaaccttcctgtaa; The gene sequence of the gene 3056 fragment is shown in SEQ ID NO. 22: The gene sequence of the gene fragment 3046 is shown in SEQ ID NO.23: atgtctgaaatctcgagcctcggctatgtcggctacagcgtgaccgacctcgaccggtgggaggagctggcggtcgatatcctcggcttcgttcccggccgacgcaatcccggccgctcgctcggcctgcggatggacaagctcgagcagcgcatcgtcctcgaacgcgacgggaaggacgacctcaaatatgtcggctggctgttcgacaccgaggatgacctcgacggcttcgtcgacaaggcgcgcggcgccggcgtcgacatccggccgcagagcgcggagatcgccaagcagcgcgccgtcgaccgcgtccatgcggtgaccgatcccaacggcgtgatccacgaattcgcattcgggccgaaattcgcctccgcgcacgagccgttcctgtcgaaggtgctgcgcggcggcttcgtgaccggccggctcggcgtcggccatgtgctggaagtggcgcgcgactatggcgagacggtggccttcgcccgccgggtgctcgggttgaaggtcagcgactatatccgcgggccacaaccgatgccgaacggcatcttcgacgtcgaggcggcctttttccacacccggaccggacggcaccattcgctcgccacggccgaagtgccgacgccgctgcgcatccaccacatgatggtcgaggtcagcgacatggacgatgtcggcctggcctatgaccgctgccgcgcggcgggcttcccgatcggcatggagctcggccatcatcccaatgacgggatgttctccttctacgtgcgcacgccttccggcttcctgatcgagttcggctggggcggcgtggtcatcgacgacgccgattgggaagtgaagacctattcgcagctgagcgactggggacacgcgcacgcgcattga; The gene sequence of the gene fragment 4902 is shown in SEQ ID NO.24: atgtcagtaaaacaacttggctaccttatttttgaatgtagggctgatgttctggagcaaatggtagtcgtataccaagatatcatcggtgctgtggtggagcgtgatgaaggcggacgcgctcttgttcgccttgatggccgacctttccgtatcaggctcgatcctggccccgcaaaccgccttgcggcgatcggttggaatgtagaccctagtgatctggcggcgatagcggaacaggtggagaaggcatgttattcggtcgtaacggctgatgcggaactggccgcagatcgcgcggccgcccaagttcgacagttcgccgataacgatggctttacccatgaactgtatgtcgaatcgtcgtttcccaccgaccctgtgctcgagtctctattcgtctgtggtgaagaagcgaacggcatcttcggcttggggcacctcgtagtgatcgtggctgatcgggcgaagactcaatcttttttcactgatgttctgggcttcggactcagtgatcgggtaacttggcctgaagccgacatcttcttccttcactgcaaccagcgtcatcacaccgttgcactttcggcaccggcgctcggtcttaagccaggtatggttcatcatctgatgctagaagccaagagcaaagagcaggttgatcgcgcgttcgcagcggtcaagcgcttgggctatgatgtcctcatgacaattggccagcactccaatgataaggtctactccttctacatgatggcaccggctggttttgcagttgagttgggctttggtggccaggtgattggagatttggaaagttggcatgttggattctatgacgcaccgagcatttggggccacgagttgcagttgccggcgcattga; 1.5 Add 5 μL of the above ligation product to 50 μL of Lecoli Turbo competent cells (Tulugang Biotechnology), incubate on ice for 30 min, heat shock at 42℃ for 90 s, incubate on ice for 2 min, add 1 mL of LB medium, activate at 37℃ and 200 rpm for 1 h, take 100 μL of bacterial culture and spread it on an LB plate with 50 μg / mL kanamycin, incubate at 37℃ overnight, and use check primers to perform bacterial culture PCR to screen positive clones; The sequence of the forward primer of the check primer is shown in SEQ ID NO.25: 5'-ttgctgcaactctctcaggg-3'; The sequence of the reverse primer of the check primer is shown in SEQ ID NO.26: 5'-tgaagagcttggcggcgaa-3'; 1.6 Positive clones were inoculated into LB tubes containing 50 μg / mL kanamycin and cultured at 37℃ and 200 rpm for 16 h. Plasmids were extracted using a plasmid extraction kit from Sangon Biotech to obtain recombinant plasmids pYYDT-dxnA1, pYYDT-dxnA2, pYYDT-3056, and pYYDT-3046 & 4902. These were then sent for sequencing to verify the correctness of the inserted sequences. Step 2: Construct overexpression engineered strains: Following the sucrose washing electroporation method in Example 1, the recombinant plasmid and empty vector pYYDT were electroporated (2.5 kV, 5 ms) into the wild-type strain Sphingomonaswittichii RW1. Immediately after electroporation, LB medium was added, transferred to EP tubes, and the culture was incubated at 30°C and 200 rpm for 2.5 h. The incubated culture was then spread on LB plates containing kanamycin (100 g / mL) and cultured at 30°C for 18 h to obtain the engineered strains RW1 / pYYDT-dxnA1, RW1 / pYYDT-dxnA2, RW1 / pYYDT-3056, RW1 / pYYDT-3046&4902, and the empty vector control strain RW1 / pYYDT. Select single clones and verify whether the plasmid has been successfully transformed using colony PCR.

[0028] Example 4 This embodiment discloses a method for testing the ability of engineered strains to degrade DBF: 4.1 Following the culture method of the strains in Example 2, the engineered strains RW1 / pYYDT-dxnA1, RW1 / pYYDT-dxnA2, RW1 / pYYDT-3056, RW1 / pYYDT-3046&4902 constructed in Example 3, as well as the empty vector control strain RW1 / pYYDT and the wild-type strain of Sphingomonaswittichii RW1, were cultured in M9 medium containing kanamycin (with DBF as the sole carbon source) to the logarithmic growth phase. 0.1 mM IPTG was added to induce gene expression, and the culture was continued at 30°C and 200 rpm for 96 h. (2) After culturing for 96 hours, the concentration of DBF in the culture medium was tested according to the method in Example 2. The test results are as follows: Figure 3 As shown. From Figure 3 It can be seen that genes dxnA1, 3056, dxnA2, and 3046 & 4902 can all improve the degradation ability of Sphingomonaswittichii RW1 for DBF. Among them, the residual rate of DBF in the culture medium of engineered strain RW1 / pYYDT-dxnA2 was only 15.46%, while the residual rate in the culture medium of wild-type Sphingomonaswittichii RW1 was 45.57%, indicating that the engineered strain increased the degradation rate of DBF by 30.11%.

[0029] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A method for constructing an engineered strain that efficiently degrades dioxin-like compounds, characterized in that, Includes the following steps: Step 1: Using single-base editing technology, the target gene related to the dioxin degradation pathway in Sphingomonaswittichii RW1 was inactivated to obtain the Sphingomonaswittichii RW1 gene knockout mutant strain. Step 2: Screening and identifying key genes essential for DBF degradation by Sphingomonaswittichii RW1 from Sphingomonaswittichii RW1 gene knockout mutant strains; Step 3: Clone the identified key genes into a vector to construct a recombinant overexpression plasmid; Step 4: Electroporate the recombinant overexpression plasmid into the wild-type strain Sphingomonaswittichii RW1 to obtain an engineered strain that overexpresses the target gene. The engineered strain that overexpresses the target gene is an engineered strain that efficiently degrades dioxin-like compounds.

2. The method for constructing an engineered strain that efficiently degrades dioxin-like compounds according to claim 1, characterized in that, In step one, the target genes include dxnA1, dxnA2, 3056, 3057, 3046 and 4902 genes.

3. The method for constructing an engineered strain that efficiently degrades dioxin-like compounds according to claim 2, characterized in that, The prespacer sequence of the dxnA1 gene is shown in SEQ ID NO.1: 5'-ctcaatcagtgccgtcaccg-3'; The prespacer sequence of the dxnA2 gene is shown in SEQ ID NO.2: 5'-agtcgaacagttcttgtacg-3'; The prespacer sequence of the 3056 gene is shown in SEQ ID NO.3: 5'-ggccgacactggagctatgt-3'; The prespacer sequence of the 3057 gene is shown in SEQ ID NO.4: 5'-tattatcagcgtcacgtcat-3'; The prespacer sequence of the 3046 gene is shown in SEQ ID NO. 5: 5'-gggccacaaccgatgccgaa-3'; The prespacer sequence of the 4902 gene is shown in SEQ ID NO. 6: 5'-cgacagttcgccgataacga-3'.

4. The method for constructing an engineered strain that efficiently degrades dioxin-like compounds according to claim 1, characterized in that, In step one, the inactivation of the target gene includes changing C to T in the target gene, thereby introducing a stop codon in advance to achieve gene inactivation.

5. The method for constructing an engineered strain that efficiently degrades dioxin-like compounds according to claim 1, characterized in that, In step two, the specific screening and identification method is as follows: by comparing and analyzing the growth ability of SphingomonaswittichiiRW1 gene knockout mutant strain and wild-type strain when DBF is the only carbon source, as well as the actual degradation efficiency of DBF, genes that can cause severe inhibition of strain growth or basic loss of degradation function are screened out, thereby identifying the key genes necessary for Sphingomonaswittichii RW1 to degrade DBF.

6. The method for constructing an engineered strain that efficiently degrades dioxin-like compounds according to claim 1, characterized in that, In step two, the key genes include the target genes or combinations of target genes from step one.

7. The method for constructing an engineered strain that efficiently degrades dioxin-like compounds according to claim 1, characterized in that, In step three, the vector is required to be able to be stably replicated and induced to express in Sphingomonaswittichii RW1; The vectors that can be stably replicated and induced to be expressed in Sphingomonaswittichii RW1 include pYYDT.

8. The method for constructing an engineered strain that efficiently degrades dioxin-like compounds according to claim 1, characterized in that, In step four, the electroconversion process includes: The recombinant overexpression plasmid and empty vector pYYDT were electroporated into the wild-type strain Sphingomonaswittichii RW1. Immediately after electroporation, LB medium was added, transferred to EP tubes, and the culture was revived. The revived bacterial culture was then spread on LB plates containing kanamycin and cultured.

9. An engineered strain for efficiently degrading dioxin-like compounds, obtained by the method for constructing an engineered strain for efficiently degrading dioxin-like compounds as described in any one of claims 1-8.

10. The application of an engineered strain as described in claim 9, which efficiently degrades dioxin-like compounds, in the degradation of dioxin-like pollutants in the environment.

Images