Amplification-free nucleic acid colorimetric detection method based on CRISPR / Cas12a regulation and control of gold nanoparticle plasma auto-deposition

This novel colorimetric detection method for HPV, which utilizes CRISPR/Cas12a-regulated plasma self-deposition of gold nanoparticles and combines DNA long and short chain modification with hydroxylamine-induced self-growth of gold nanoparticles, solves the problems of low sensitivity and equipment dependence in existing HPV detection technologies. It achieves high-sensitivity, low-cost, and real-time detection, suitable for early cervical cancer screening and rapid detection of multiple nucleic acid targets.

CN121802016APending Publication Date: 2026-04-07重庆医科大学国际体外诊断研究院
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-14
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

Existing HPV testing technologies suffer from drawbacks such as low sensitivity, complex operation, reliance on specialized equipment, long testing time, and susceptibility to non-specific interference, making it difficult to meet the needs of early cervical cancer screening and rapid testing of large populations.

Method used

An amplification-free nucleic acid colorimetric detection method based on CRISPR/Cas12a-regulated plasma self-deposition of gold nanoparticles was developed. A uniform colorimetric system was constructed by modifying gold nanoparticles with DNA long and short chains. AuNPs were self-grown by hydroxylamine and tetrachloroauric acid to amplify the signal. The specific recognition and trans-cleavage activity of CRISPR/Cas12a was used to trigger the aggregation and dispersion of AuNPs. The signal was then output using a portable ultraviolet detector.

Benefits of technology

It achieves highly sensitive amplification-free detection with a detection limit at the aM level, making it suitable for point-of-care testing scenarios. It supports dual-mode output of visual interpretation and instrument quantification, and is applicable to the rapid detection of various nucleic acid targets, reducing detection costs and equipment dependence.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121802016A_ABST
    Figure CN121802016A_ABST
Patent Text Reader

Abstract

The invention discloses an amplification-free nucleic acid colorimetric detection method based on CRISPR (clustered regularly interspaced short palindromic repeats) / Cas12a (clustered regularly interspaced short palindromic repeats) regulation of gold nanoparticle plasma autodeposition. A colorimetric probe is constructed by modifying AuNPs with long-chain and short-chain DNA, the long chain is used for cross-linking aggregation, and the short chain inhibits non-specific aggregation. Linker ssDNA in a CRISPR / Cas12a cutting system is activated through a target, the aggregation state of AuNPs is regulated and controlled, and preliminary detection is achieved. Hydroxylamine and tetrachloroauric acid are further introduced to induce the surface self-deposition of the gold nanoparticles, the local surface plasma resonance effect is enhanced, and a colorimetric signal is amplified. According to the method, nucleic acid amplification is not needed, detection can be completed within 46 minutes, the detection limit reaches the aM level, high specificity and universality are achieved, crRNA is designed to adapt to various targets such as HPV and pathogens, and the method is suitable for instant detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of nucleic acid detection technology, and relates to an amplification-free colorimetric detection method for nucleic acids based on CRISPR / Cas12a-regulated gold nanoparticle plasma self-deposition. Background Technology

[0002] Cervical cancer is the fourth most common malignant tumor among women worldwide, with approximately 660,000 new cases and 350,000 deaths globally in 2022, making disease prevention and control extremely challenging. High-risk human papillomavirus (HPV) infection is the leading cause of cervical cancer, with HPV types 16 and 18 being the most carcinogenic, accounting for approximately 70% of cervical cancer cases.

[0003] Currently, commonly used clinical methods for cervical cancer detection include cytological examination (Pap smear, liquid-based cytology test, TCT, etc.), colposcopy, cervical biopsy, and HPV testing. However, these methods generally suffer from drawbacks such as low sensitivity, susceptibility to human error, poor repeatability, invasive procedures in some cases, and high dependence on specialized techniques and equipment. These limitations severely restrict their effectiveness in early cancer diagnosis and large-scale screening. Existing HPV testing technologies mostly use viral DNA and mRNA as detection markers, requiring enzyme digestion signal amplification or nucleic acid amplification techniques to improve detection sensitivity. However, these technologies suffer from cumbersome procedures, high equipment costs, long testing times, and stringent requirements for laboratory environments, making them difficult to promote and apply in large-scale population screening, rapid on-site testing, and in grassroots or remote areas, thus failing to meet actual clinical testing needs.

[0004] Therefore, developing a highly sensitive, highly specific, simple, and rapid HPV detection method is of great significance for improving the efficiency of early cervical cancer screening, timely intervention of HPV infection, reducing the rate of misdiagnosis and missed diagnosis, and expanding the screening coverage, which can ultimately help reduce the incidence and mortality of cervical cancer.

[0005] In recent years, CRISPR / Cas systems, as an emerging nucleic acid detection technology, have attracted widespread attention due to their advantages such as ease of operation, mild reaction conditions, and high detection accuracy. Biosensing strategies developed based on CRISPR / Cas systems have been widely applied in the field of nucleic acid detection, encompassing various technical pathways such as fluorescence sensing, electrochemical sensing, colorimetric sensing, and lateral flow immunoassay. Among these, fluorescence detection and electrochemical sensing technologies, with their high sensitivity and specificity, can achieve accurate identification of low-concentration target DNA / RNA. However, both require specialized optical or electrochemical detection equipment, making them difficult to apply in point-of-care testing (POCT) scenarios lacking supporting instruments, and thus failing to meet the urgent need for convenient detection technologies in resource-limited areas.

[0006] Gold nanoparticles (AuNPs) have emerged as an ideal alternative to fluorescence detection technologies due to their unique optical properties. AuNPs exhibit high extinction coefficients and localized surface plasmon resonance (LSPR) effects, resulting in a noticeable color change in the solution when the particles aggregate. This characteristic overcomes the reliance on complex and expensive equipment in traditional detection techniques, giving AuNP-based detection systems a unique advantage in terms of rapid response and low cost in the field of point-of-care testing. Furthermore, the surface chemistry of AuNPs is easily modulated, allowing for convenient coupling with various functional molecular probes. Through combination with other detection technologies, novel biosensors with both high sensitivity and high specificity can be developed.

[0007] Currently, research combining the CRISPR / Cas12a system with AuNPs colorimetric analysis technology has shown great potential to simplify the detection reading process and improve detection sensitivity. However, existing AuNPs-based Cas system detection technologies still have many shortcomings: First, the signal transduction efficiency is low, and the catalytic efficiency of a single Cas molecule is limited, easily leading to insufficient signal amplification; second, the colorimetric signal intensity is weak, as traditional AuNPs aggregation relies on target-induced cross-linking reactions, and incomplete aggregation is prone to occur under low target concentration conditions, resulting in insignificant color changes in the solution and detection limits typically only reaching the pM level; third, non-specific adsorption interference is prominent, as the surface of AuNPs easily adsorbs non-target molecules such as proteins and salt ions, leading to false positive detection signals and affecting the accuracy of detection results. Summary of the Invention

[0008] To address the shortcomings and deficiencies of existing HPV and nucleic acid detection technologies, such as low sensitivity, complex operation, reliance on specialized equipment, long detection time, and susceptibility to nonspecific interference, this invention proposes an amplification-free nucleic acid colorimetric detection method based on CRISPR / Cas12a-regulated gold nanoparticle plasma self-deposition amplification.

[0009] This invention constructs a uniform colorimetric system by modifying gold nanoparticles (AuNPs) with DNA long and short chains. The long DNA chains are cross-linked with Linker ssDNA to induce AuNP aggregation, while the short DNA chains cover the AuNP surface to form a stable protective layer, effectively avoiding false-positive interference caused by non-specific adsorption. Addressing the problems of weak colorimetric signals and indistinct color changes at low target concentrations in traditional AuNPs, this invention introduces hydroxylamine (NH2OH) and tetrachloroauric acid (HAuCl4) to induce AuNP self-growth, increasing their particle size and producing significant color differences in the solution, greatly enhancing naked-eye colorimetric sensitivity. Combined with a portable UV detector, signal amplification is further achieved, raising the detection limit to the aM level, significantly superior to traditional non-amplified fluorescence-based Cas detection techniques (pM level). The entire detection process takes only 46 minutes, eliminating the need for complex nucleic acid amplification steps and expensive large-scale detection equipment. It supports both visual interpretation and instrument-based quantitative output, highly adaptable to the application requirements of point-of-care testing (POCT). Furthermore, based on the programmable nature of crRNA, this detection platform can achieve universal detection of a variety of nucleic acid targets by designing different guide RNA sequences. It is not only suitable for efficient screening of HPV, but can also be extended to the rapid detection of other pathogens and genetic markers, providing a high-efficiency, low-cost, and highly specific nucleic acid diagnostic solution for resource-limited areas.

[0010] The technical solution of this invention is: an amplification-free nucleic acid colorimetric detection method based on CRISPR / Cas12a-regulated plasma self-deposition of gold nanoparticles, characterized in that CRISPR / Cas12a specifically recognizes the target nucleic acid, triggering its cleavage of the linker strand, thereby affecting the aggregation and dispersion of gold nanoparticles, and thus initiating the plasma self-deposition reaction of gold nanoparticles; utilizing the LSPR signal change caused by this self-deposition reaction, the presence of the target nucleic acid is converted into a color signal that can be recognized by the naked eye, realizing amplification-free detection.

[0011] In a first aspect, the present invention provides a gold nanoparticle nucleic acid probe (DNA-AuNPs), characterized in that it comprises: a gold nanoparticle core; and a nucleic acid modification layer modified on the surface of the gold nanoparticle; the nucleic acid modification layer imparts high dispersibility and high stability to the gold nanoparticle.

[0012] Furthermore, the gold nanoparticles are synthesized through the following steps: a tetrachloroauric acid solution is heated to boiling, and a sodium citrate solution is rapidly injected as a reducing agent, and the boiling reaction is continued for a certain period of time; then heating is stopped and stirring is continued until natural cooling to obtain a wine-red gold nanoparticle solution; the obtained solution is stored at 4°C in a sealed container away from light for later use.

[0013] Furthermore, the gold nanonucleic acid probe DNA-AuNPs is synthesized through the following steps: a mixture containing long-chain and short-chain DNA (molar ratio 1:19) is prepared, and TCEP reagent is added and incubated at room temperature to reduce thiol groups; then AuNPs solution is added, and after shaking and mixing, it is placed at -20℃ to promote coupling; after reconstitution, unbound DNA is removed by high-speed centrifugation, and the precipitate is washed with Buffer A; finally, the product is resuspended in Buffer B and stored at 4℃ in the dark for later use.

[0014] Secondly, the present invention provides a method for inducing the self-growth of gold nanoparticles by hydroxylamine (NH2OH) and tetrachloroauric acid (HAuCl4), characterized in that: the method introduces hydroxylamine and tetrachloroauric acid, and utilizes the reducing power of hydroxylamine to promote the deposition of gold ions on the surface of gold nanoparticles, resulting in an increase in particle size and a significant color difference, thereby improving the sensitivity of colorimetric detection.

[0015] Furthermore, the growth system is carried out through the following steps: citric acid, Tween-20, hydroxylamine, and tetrachloroauric acid are added sequentially to a buffer system containing DNA-AuNPs, and after rapid mixing, the self-growth reaction of gold nanoparticles is initiated; the reducing effect of hydroxylamine and the gold source provided by tetrachloroauric acid promote the increase of the particle size of gold nanoparticles and produce significant color differences.

[0016] Thirdly, a non-amplification nucleic acid colorimetric detection method based on CRISPR / Cas12a-regulated gold nanoparticle plasma self-deposition is characterized by: constructing a detection system comprising a CRISPR / Cas12a system, a linker ssDNA, and gold nanoparticles modified with long and short DNA chains (DNA-AuNPs); inducing AuNP aggregation by the complementary pairing of the long DNA chain and the linker ssDNA, and maintaining the dispersion stability of AuNPs by the short DNA chain; activating the trans-cleavage activity of Cas12a through target nucleic acid to degrade the linker ssDNA and block AuNP aggregation; and introducing hydroxylamine (NH2OH) and tetrachloroauric acid (HAuCl4) to induce AuNP plasma self-growth, utilizing the enhanced local surface plasmon resonance (LSPR) signal and color change caused by self-growth to achieve highly sensitive detection of target nucleic acids.

[0017] Furthermore, the method includes the following steps: Construction and activation of the Cas12a reaction system: The CRISPR / Cas12a complex, Linker ssDNA, and the sample to be tested are mixed and incubated; if the target nucleic acid is present, Cas12a is activated and trans-cleaves the Linker ssDNA, followed by heating to inactivate Cas12a; Regulation of gold nanoparticle aggregation: DNA-AuNPs are added to the above system; if the Linker ssDNA is cleaved, the AuNPs remain dispersed and appear red; if the Linker ssDNA is not cleaved, the AuNPs are induced to cross-link and aggregate; Plasma self-growth signal amplification: Citric acid, Tween-20, hydroxylamine, and tetrachloroauric acid are added sequentially to the system, and the mixture is quickly mixed to initiate the AuNPs self-growth reaction; Detection and analysis: After the reaction, the color change of the solution is observed by the naked eye, or the absorption intensity at a specific wavelength is detected using a UV-Vis spectrophotometer to achieve qualitative or quantitative analysis of the target.

[0018] Fourthly, the present invention analyzes the performance of the detection method, specifically including the following steps: Sensitivity testing: A series of target nucleic acid (HPV-16) samples with different concentration gradients are prepared and detected using the method described in this invention. Signal acquisition and analysis: Before and after the self-growth reaction of gold nanoparticles (AuNPs), the absorption intensity of the solution at a specific wavelength is detected using a UV-Vis spectrophotometer, and the color change of the solution is observed with the naked eye.

[0019] The beneficial technical effects of this invention are:

[0020] 1. High Specificity: A uniform colorimetric system is constructed by modifying gold nanoparticles with DNA long and short chains. Targeted aggregation is achieved by the specific cross-linking of long chains and linker chains. The dense protective layer formed by short chains effectively inhibits non-specific aggregation and adsorption of non-target molecules, significantly reducing false positive interference and ensuring accurate and reliable detection results.

[0021] 2. Ultra-high sensitivity: The innovative introduction of hydroxylamine and tetrachloroauric acid to synergistically induce the self-growth of gold nanoparticles enhances the local surface plasmon resonance effect by increasing the particle size, making the color difference of the solution visible to the naked eye. Combined with portable ultraviolet detection, the signal is amplified, and the detection limit is as low as aM, which significantly improves the sensitivity compared with traditional methods.

[0022] 3. Suitable for point-of-care testing: No nucleic acid amplification step or expensive large equipment is required throughout the process. The test can be completed in just 46 minutes. It is easy to operate and has a low threshold. It supports dual-mode output of visual qualitative interpretation and instrument quantitative detection. It has a rapid response and is fully in line with the needs of point-of-care testing (POCT) scenarios.

[0023] 4. High versatility and wide application: Relying on the programmable characteristics of crRNA, specific guide RNA sequences can be designed to flexibly adapt to the detection needs of various pathogens and genetic markers such as HPV, bacteria, and viruses. It has a wide range of applications and outstanding practicality and promotion value.

[0024] The above content is only a brief overview of the technical solution of this application. In order to enable those skilled in the art to clearly understand the core technical means of this application and implement them accordingly, and to more intuitively and easily demonstrate the above and other objectives, features and advantages of this application, the following will be described in detail with reference to the accompanying drawings and preferred embodiments of this application.

[0025] Through the detailed description of specific embodiments of this application and the accompanying drawings, those skilled in the art will further understand the technical advantages, implementation logic, and application value of this application. Attached Figure Description

[0026] To more clearly illustrate the technical solutions of the embodiments of this application or to compare with the prior art, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the following drawings are only some of the embodiments of this application, and those skilled in the art can derive other related drawings from these drawings without creative effort. In all drawings, the same or similar elements / parts are identified by the same or similar reference numerals to ensure consistency and readability of the drawings.

[0027] Figure 1 is a schematic diagram of the principle of the amplification-free nucleic acid colorimetric detection method based on CRISPR / Cas12a-regulated gold nanoparticle plasma self-deposition.

[0028] Figure 2 shows the transmission electron microscopy (TEM) characterization of 13 nm gold nanoparticles (AuNPs);

[0029] Figure 3 shows the characterization of the dispersibility and stability of gold nanonucleic acid probes; where A represents unfrozen AuNPs, B represents DNA-modified AuNPs (DNA-AuNPs), and C represents frozen-treated unfrozen AuNPs; this figure illustrates the role of the DNA modification layer in maintaining the dispersibility and freeze-thaw stability of AuNPs.

[0030] Figure 4 shows a comparison of transmission electron microscopy (TEM) characterization of gold nanoparticles (AuNPs) before and after self-growth in the embodiments of the present invention; where A represents the original AuNPs and B represents the AuNPs after self-growth induced by hydroxylamine and tetrachloroauric acid; this figure confirms that the self-growth system can significantly increase the particle size of AuNPs.

[0031] Figure 5 shows the linear relationship between HPV-16 target nucleic acid concentration and UV-Vis absorption intensity in the embodiments of the present invention; where A is the linear fitting curve of AuNPs before self-growth, and B is the linear fitting curve of AuNPs after self-growth. Detailed Implementation

[0032] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. The specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.

[0033] This invention provides an amplification-free colorimetric detection method for gold nanoparticles based on CRISPR / Cas12a-regulated plasma self-deposition. This method ingeniously integrates the specific recognition and trans-cleavage activity of CRISPR / Cas12a, the high stability of DNA long and short chain modified gold nanoparticles, and hydroxylamine-induced signal amplification technology for the self-growth of gold nanoparticles.

[0034] Specifically, the implementation process of this invention mainly includes the following key steps:

[0035] First, highly stable DNA-AuNPs probes were constructed. A specific ratio of long and short DNA chains was modified onto the surface of gold nanoparticles (AuNPs) via a thiol coupling reaction. The long DNA chains act as recognition and cross-linking elements, responsible for binding to the linker ssDNA; the short DNA chains act as stabilizers, forming a dense hydration protective layer on the AuNPs surface, effectively preventing non-specific aggregation and protein adsorption, thus ensuring the stability of the system.

[0036] Secondly, a CRISPR / Cas12a recognition and cleavage system was constructed. Cas12a protein, crRNA, and the sample to be tested were mixed. If the target nucleic acid (HPV-16 DNA) was present in the sample, the Cas12a / crRNA complex specifically recognized and bound the target, causing a conformational change in the protein and thus activating it. The activated Cas12a exhibited strong trans-cleavage activity, efficiently degrading the linker ssDNA in the system. Conversely, if the target was not present, the linker ssDNA remained intact.

[0037] Next, AuNP aggregation and signal transduction were performed. The reaction product was mixed with the prepared DNA-AuNPs. If the linker ssDNA had been cleaved, the AuNPs remained dispersed, and the solution was red; if the linker ssDNA was intact, cross-linking and aggregation of AuNPs were induced, and the solution color changed from red to purple.

[0038] Finally, amplification of the plasma self-growth signal is introduced. Hydroxylamine (NH2OH) and tetrachloroauric acid (HAuCl4) are added to the reaction system. The reducing effect of hydroxylamine promotes the deposition and growth of gold ions on the AuNP surface. This process significantly increases the particle size of the AuNPs, enhances the localized surface plasmon resonance (LSPR) effect, makes the color difference of the solution more significant, and greatly improves naked-eye visibility. Simultaneously, by using a UV-Vis spectrophotometer to detect absorbance changes at specific wavelengths, quantitative analysis of the target nucleic acid can be achieved.

[0039] Example 1: Preparation and Characterization of Gold Nanoparticles (AuNPs)

[0040] 1.1 Take 88.2 mL of 1 mM tetrachloroauric acid (HAuCl4) solution and add it to a 500 mL round-bottom flask. Place the flask on a constant temperature heating and stirring device, set the stirring speed to 300 rpm, and heat until the solution boils.

[0041] 1.2 Keep the mixture boiling and quickly add 10.1 mL of 34 mM sodium citrate solution (as a reducing agent) to the flask. Continue boiling for 10 min, during which the solution gradually changes from pale yellow to a uniform wine red.

[0042] 1.3 Turn off the heating device, maintain the stirring speed at 300 rpm and continue stirring for 15 min, then stop stirring and allow the solution to cool naturally to room temperature to obtain a uniformly dispersed wine-red AuNPs solution;

[0043] 1.4 Transfer the above AuNPs solution to a brown glass container, seal it, and store it in a refrigerator at 4°C away from light for later use;

[0044] 1.5 Characterization: The morphology and particle size of the prepared AuNPs were analyzed by transmission electron microscopy (TEM). The results showed that the AuNPs had uniform particle size with an average particle size of about 13 nm, no obvious aggregation, and good dispersibility (see Figure 2).

[0045] Example 2: Preparation of DNA-modified gold nanoparticles (DNA-AuNPs)

[0046] 2.1 Preparation of DNA mixture:

[0047] 2.1.1 Take 100 μM DNA long chain 1 and DNA short chain 3 reagents and prepare a total of 10 μL DNA mixture (named DNA-AuNPs a mixture) in a sterile centrifuge tube, in which DNA long chain 1 accounts for 5% (0.5 μL) and DNA short chain 3 accounts for 95% (9.5 μL);

[0048] 2.1.2 Using the same method, take 100 μM DNA long chain 2 and DNA short chain 4 reagents and prepare a total of 10 μL of DNA mixture (named DNA-AuNPs b mixture), in which DNA long chain 2 accounts for 5% (0.5 μL) and DNA short chain 4 accounts for 95% (9.5 μL).

[0049] 2.2 Thiol reduction: Add 3 μL of 500 nM TCEP (tris(2-carboxyethyl)phosphine hydrochloride) reagent to the two DNA mixtures above, gently mix by pipetting, and let stand at room temperature for 30 min to reduce the thiol groups modified at the DNA ends.

[0050] 2.3 Coupling reaction: 200 μL of AuNPs solution prepared in Example 1 was added to the reduced DNA-AuNPs a mixture and DNA-AuNPs b mixture, respectively. The mixture was vortexed for 30 seconds, and then the centrifuge tubes were placed in a -20°C freezer for 2 h to achieve covalent coupling of DNA and AuNPs through gold-sulfur bonds.

[0051] 2.4 Purification: The two coupling products after freezing were taken out and rehydrated naturally at room temperature for 10 min. Then, the centrifuge tubes were placed in a high-speed refrigerated centrifuge and centrifuged at 12,000 rpm for 30 min. The supernatant was carefully discarded.

[0052] 2.5 Washing and Resuspension: Add 200 μL of Buffer A (5 mM HEPES, pH 7.6) to the centrifuged precipitate, vortex to disperse the precipitate, centrifuge again at 12000 rpm for 10 min, discard the supernatant, and repeat the washing 3 times; finally, resuspend the two precipitates separately in 200 μL of Buffer B (10 mM HEPES, 300 mM NaCl, pH 7.6) to obtain DNA-AuNPs a and DNA-AuNPs b probe solutions, and store them at 4℃ in the dark for later use;

[0053] 2.6 Characterization and Validation: Photographs of unfrozen naked AuNPs, DNA-AuNPs, and frozen naked AuNPs were taken, and TEM characterization was performed simultaneously. The results showed that DNA-AuNPs and unfrozen naked AuNPs were uniformly wine-red, and the TEM images showed that the particles were evenly dispersed. However, the frozen naked AuNPs solution produced a precipitate at the bottom, and the TEM images showed that the particles were aggregated in large quantities, confirming that DNA long and short chain modification can effectively maintain the stable dispersion of AuNPs (see Figure 3).

[0054] Table 1. Oligonucleotide sequences used in this part of the experiments. Name <![CDATA[ * Sequence (5'-3')]]> DNA long chain 1 SH-AAAAAAAAACCCAGGTTCTCT DNA long chain 2 TCACAGATGCGTAAAAAAAAA-SH DNA short chain 3 SH-AAAAAAAAACCC DNA short strand 4 CGTAAAAAAAAA-SH

[0055] Example 3: Preparation of target HPV-16 and CRISPR / Cas12a trans-cleavage reaction

[0056] 3.1 Preparation of target HPV-16:

[0057] 3.1.1 Take complementary hpv-16 NTS and hpv-16 TS sequences and add them to 1×Buffer 1 (containing 5 mM HEPES, 150 mM NaCl, 10 mM MgCl2, pH 7.6) to make the final concentration of both sequences 10 μM.

[0058] 3.1.2 Transfer the mixed solution to a PCR tube and place it in a PCR instrument to perform the following program: denature at 95℃ for 5 min, then cool naturally to 37℃ and incubate for 1 h to allow the two complementary single strands to anneal and form a double-stranded target HPV-16.

[0059] 3.1.3 After preparation, the double-stranded target HPV-16 was aliquoted into sterile centrifuge tubes and stored at -20°C for later use.

[0060] 3.2 CRISPR / Cas12a trans-cleavage reaction of Linker ssDNA:

[0061] 3.2.1 A CRISPR / Cas12a reaction system with a total volume of 50 μL was constructed, with the following components: 1×Buffer 1 5 μL, crRNA (1 μM) 1 μL, Cas12a protein (1 μM) 3 μL, Linker ssDNA (400 nM) 1 μL, target HPV-16 prepared in Example 3.1 2 μL, and enzyme-free water 38 μL; the final concentrations of each component in the system were: crRNA 32 nM, Cas12a 60 nM, Linker ssDNA 8 nM, and target HPV-16 400 pM;

[0062] 3.2.2 Add each component to a sterile centrifuge tube in sequence and gently mix with a pipette to avoid generating air bubbles;

[0063] 3.2.3 The centrifuge tubes were incubated in a 37°C water bath for 35 min to induce the Cas12a / crRNA complex to specifically recognize the target HPV-16 and undergo a conformational change, thereby activating trans-cleavage activity and cleaving the Linker ssDNA in the system.

[0064] 3.2.4 After incubation, transfer the centrifuge tube to a 65°C constant temperature water bath for 5 min to irreversibly inactivate the Cas12a enzyme, terminate the cleavage reaction, and prevent interference with subsequent experiments.

[0065] Table 2 CRISPR / Cas12a reaction system Reagent Name Volume (μL) target DNA 1.6 CrRNA 1uM 1.6 Cas12a 1uM 3 Linker ssDNA 400nM 1 1 × Buffer 1 5 Enzyme-free water 39.8

[0066] Table 3. Oligonucleotide sequences used in this part of the experiments. Name <![CDATA[ * Sequence (5'-3')]]> crRNA-16 UAAUUUCUACUAAGUGUAGAUUGAAGUAGAUAUGGCAGCAC HPV-16 NTS AGTATTTTTATATGTAGTTTCTGAAGTAGATATGGCAGCACATAATGACATATTTGTA HPV-16 TS TACAAATATGTCATTATGTGCTGCCATATCTACTTCAGAAAACTACATATAAAAATACT Linker ssDNA ACGCATCTGTGAAGAGAACCTGGG

[0067] Example 4: CRISPR / Cas12a cleavage regulates DNA-AuNP aggregation reaction

[0068] 4.1 Add 15 μL of the DNA-AuNPs a probe solution and 15 μL of the DNA-AuNPs b probe solution prepared in Example 2 to the CRISPR / Cas12a reaction system treated in Example 3.2, respectively;

[0069] 4.2 Place the centrifuge tube on a vortex mixer and vortex to mix thoroughly, ensuring that the DNA-AuNPs are mixed with the reaction system.

[0070] 4.3 Place the centrifuge tubes in a 37°C water bath and incubate for 6 minutes to carry out the aggregation reaction:

[0071] 4.3.1 If the Linker ssDNA in the system is not cleaved by Cas12a (no target HPV-16 is present), the Linker ssDNA will undergo specific base complementary pairing with the long DNA chains on the surface of DNA-AuNPs a and DNA-AuNPs b, forming cross-linking bridges and inducing the aggregation of the two probes;

[0072] 4.3.2 If the Linker ssDNA in the system has been cleaved and degraded by Cas12a (with the target HPV-16 present), cross-linking bridges cannot be formed, and DNA-AuNPs a and DNA-AuNPs b remain dispersed under the stabilizing effect of the short DNA chain.

[0073] Example 5: Hydroxylamine (NH2OH) and tetrachloroauric acid (HAuCl4) induce autogenous growth of AuNPs

[0074] 5.1 To the aggregation reaction system of Example 4, the following reagents were added in sequence: 1 μL of citric acid solution with a concentration of 1 mg / mL, 20 μL of Tween-20 solution with a volume fraction of 1 / 1000, 1 μL of NH2OH solution with a concentration of 1 M, and 5 μL of HAuCl4 solution with a concentration of 10 mM;

[0075] 5.2 Immediately place the centrifuge tube on a vortex mixer and shake rapidly to mix thoroughly, thus initiating the AuNPs self-growth reaction;

[0076] 5.3 The morphology and particle size changes of AuNPs were observed using transmission electron microscopy (TEM). The results showed that the particle size of the self-grown AuNPs was significantly larger than that of the original DNA-AuNPs. The aggregated AuNPs further formed dense aggregates through self-growth, confirming the success of the self-growth reaction (see Figure 4).

[0077] Table 4. Hydroxylamine (NH2OH) and tetrachloroauric acid (HAuCl4) induced gold nanoparticle self-growth reaction system Reagent Name Volume (μL) Citric acid 1 mg / mL 1 Twain – 20 1 / 1000 20 <![CDATA[NH2OH 1 M]]> 1 <![CDATA[HAuCl4 10 mM]]> 5

[0078] Example 6: Detection, Signal Analysis, and Performance Verification

[0079] 6.1 Colorimetric Detection: 20 seconds after the AuNPs self-growth reaction started, a colorimetric image of the solution was captured using a smartphone under natural light conditions, and the color change was observed with the naked eye.

[0080] 6.2 UV-Vis Spectroscopy Detection: The UV2600 UV-Vis spectrophotometer was used to detect the UV-Vis absorption intensity of AuNPs at 520 nm before growth and 540 nm after growth, respectively.

[0081] 6.3 Performance Verification Results:

[0082] 6.4.1 Sensitivity: Detection of HPV-16 target nucleic acids at concentrations ranging from 100 aM to 1 μM showed the following results: Before AuNPs were grown, when the HPV-16 concentration was in the range of 1 fM to 10 pM, the absorption intensity at 520 nm showed a good linear relationship with the logarithm of the target concentration. The linear regression equation was Y = 0.03709 lgC + 1.41562 (R² = 0.99232), and the LOD was 228.06 aM. After self-growth, AuNPs showed a good linear relationship between the absorption intensity at 540 nm and the logarithm of the target concentration when the HPV-16 concentration was in the range of 1 fM to 100 nM. The dynamic range was extended to 8 orders of magnitude, and the linear regression equation was Y = 0.13208 lgC + 1.63925 (R² = 0.9661). The LOD decreased to 86.3 aM (see Figure 5).

Claims

1. A non-amplification nucleic acid colorimetric detection method based on CRISPR / Cas12a-regulated gold nanoparticle plasma self-deposition, characterized in that, Includes the following steps: (1) Preparation of gold nanoparticles (AuNPs): A wine-red AuNPs solution was prepared by heating and boiling using tetrachloroauric acid as the gold source and sodium citrate as the reducing agent. (2) Preparation of DNA-modified gold nanoparticles (DNA-AuNPs): Two DNA mixtures were prepared, consisting of 5% long DNA chains and 95% short DNA chains, respectively. After thiol reduction, they were cryogenically coupled with the AuNPs prepared in step (1). After purification and washing, DNA-AuNPs a and DNA-AuNPs b probes were obtained. (3) CRISPR / Cas12a trans cleavage reaction: Construct a reaction system containing crRNA, Cas12a protein, Linker ssDNA and the sample to be tested. After incubation, activate the trans cleavage activity of Cas12a, and then heat to inactivate Cas12a. (4) DNA-AuNPs aggregation reaction: DNA-AuNPs a and DNA-AuNPsb probes are added to the reaction system of step (3), and the probe aggregation or dispersion is regulated according to the integrity of the Linker ssDNA after incubation. (5) Amplification of AuNPs self-growth signal: Citric acid, Tween-20, hydroxylamine (NH2OH) and tetrachloroauric acid (HAuCl4) are added sequentially to the system in step (4) to initiate the AuNPs self-growth reaction; (6) Detection and analysis: The target nucleic acid can be detected without amplification by observing the color change of the solution with the naked eye or by detecting the absorption intensity at the characteristic wavelength using a UV-Vis spectrophotometer.

2. The detection method according to claim 1, characterized in that, The preparation of the DNA mixture in step (2) includes: taking DNA reagent with a concentration of 100 μM and preparing a total volume of 10 μL of mixture, wherein DNA-AuNPs a is composed of DNA long chain 1 and DNA short chain 3, and DNA-AuNPs b is composed of DNA long chain 2 and DNA short chain 4; thiol reduction is performed using 500 nM TCEP reagent, and the mixture is allowed to stand at room temperature for 30 min. The coupling reaction is completed by freezing at -20℃ for 2 h. During purification, the mixture is centrifuged at 12000 rpm, washed 3 times with Buffer A, and then resuspended in Buffer B.

3. The detection method according to claim 1, characterized in that, The final concentrations of each component in the reaction system described in step (3) are: crRNA 32 nM, Cas12a 60 nM, and Linker ssDNA 8 nM; the incubation conditions are 37℃ for 35 min and 65℃ for 5 min; the buffer solution of the reaction system is 1×Buffer 1 containing 5 mM HEPES, 150 mM NaCl, 10 mM MgCl2, and pH 7.

6.

4. The detection method according to claim 1, characterized in that, The order of reagent addition for the self-growth reaction in step (5) is: citric acid, Tween-20, NH2OH, HAuCl4; where NH2OH is used as a reducing agent, tetrachloroauric acid is used as a gold source, citric acid is used as a stabilizer, and Tween-20 is used as a dispersant. The AuNPs particle size is increased through gold ion reduction deposition.

5. The detection method according to claim 1, characterized in that, The color change described in step (6) is as follows: when the target nucleic acid is present, DNA-AuNPs remain dispersed and the solution turns red after growth; when the target nucleic acid is absent, DNA-AuNPs aggregate and the solution turns purple after growth; the characteristic wavelengths detected by the UV-Vis spectrophotometer are: 520 nm before growth and 540 nm after growth, with a detection limit as low as aM.

6. The detection method according to any one of claims 1-5, characterized in that, The target nucleic acids include HPV viral nucleic acid, bacterial nucleic acid, viral nucleic acid, and genetic marker nucleic acid. Specific crRNA sequences are designed to achieve accurate detection of different targets.