One-pot detection method, system and kit for regulating and controlling CRISPR / Cas12a trans-cleavage activity

Abstract

The invention relates to the technical field of biological detection, in particular to a one-pot detection method, system and kit for regulating and controlling CRISPR / Cas12a trans-cleavage activity. The method comprises the following steps: mixing a sample containing target nucleic acid with a reaction system, wherein the reaction system comprises a Cas12a-crRNA ribonucleoprotein complex; the programmable cleavage activator module comprises a first cleavage activation chain and a second cleavage activation chain, and the 5'end and / or the 3 'end of at least one chain is provided with an extension fragment; an entropy driving DNA circuit module; a reporter molecule which can be trans-cleaved by Cas12a; incubating under a constant temperature condition; and detecting a signal generated by cleavage of the reporter molecule, wherein the intensity of the signal is related to the concentration of the target nucleic acid. According to the method, the accurate and programmable regulation and control of the trans-cleavage activity of the Cas12a-crRNA compound is realized by introducing a programmable cleavage activator module with a specific extension fragment design, and the pollution risk caused by introduction of an exogenous enzyme is avoided.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, and in particular to a one-pot detection method, system, and kit for regulating the trans-cleavage activity of CRISPR / Cas12a. Background Technology

[0002] In the field of biosensor technology, the trans-cleavage activity triggered by the Cas12a protein recognizing a target under the guidance of guide RNA provides a tool for developing novel biosensors. However, once activated, the trans-cleavage activity of Cas12a remains persistent. This uncontrollable activation can easily lead to severe nonspecific cleavage in pre-packed systems containing all reaction components, resulting in high background signals and significantly reducing the signal-to-noise ratio and reliability of detection. One strategy focuses on chemically modifying or structurally designing crRNA, such as constructing light-controlled or circular crRNAs to achieve light-controlled activity. Another common strategy is to enzymatically cascade the CRISPR system with pre-isothermal amplification technology, triggering the CRISPR reaction through the accumulation of amplification products. These methods cannot fundamentally solve the problem of premature activation of the Cas12a protein under "one-pot" isothermal detection conditions due to nonspecific interactions with non-target molecules or the presence of trace activators in the system. Background leakage still limits further improvements in detection sensitivity. Summary of the Invention

[0003] The purpose of this invention is to provide a one-pot detection method for regulating the trans-cleavage activity of CRISPR / Cas12a, aiming to solve the technical problem that when CRISPR / Cas12a systems are used for biosensing, their trans-cleavage activity may be non-specifically activated in the absence of a target, resulting in high background signal and low signal-to-noise ratio.

[0004] To achieve the above objectives, the technical solution adopted in this application is as follows: Firstly, a one-pot detection method for controlling the trans-cleavage activity of CRISPR / Cas12a, comprising the following steps:

[0005] The sample containing the target nucleic acid is mixed with a reaction system comprising:

[0006] a) Cas12a-crRNA-ribonucleoprotein complex;

[0007] b) A programmable cleavage activator module, comprising a first cleavage activation strand and a second cleavage activation strand, wherein at least one strand has an extension fragment at its 5' end and / or 3' end, the extension fragment regulating the trans-cleavage activity of the Cas12a-crRNA complex through a steric hindrance effect.

[0008] c) An entropy-driven DNA circuit module comprising a nucleic acid component capable of undergoing a strand displacement reaction with the target nucleic acid, the strand displacement reaction releasing a trigger strand that binds to the programmable cleavage activator module to activate Cas12a.

[0009] d) Reporter molecules that can be trans-cleaved by Cas12a;

[0010] Incubation was carried out under constant temperature conditions; and

[0011] The signal generated by the cleavage of the reporter molecule is detected, and the intensity of the signal is correlated with the concentration of the target nucleic acid.

[0012] Optionally, both the first and second cleavage activation strands bind complementary to specific regions of the crRNA. When the first and second cleavage activation strands are present simultaneously, they together form a stable complex structure with the crRNA, jointly activating the trans-cleavage activity of Cas12a.

[0013] Optionally, the extended fragment is single-stranded DNA or double-stranded DNA, with a length of 3 to 12 nucleotides.

[0014] Optionally, when the sequence of the first splitting activation chain is fixed, introducing an extension fragment at the 3' end of the second splitting activation chain has a stronger inhibitory effect on Cas12a activity than introducing an extension fragment at the 5' end; and / or,

[0015] When the sequence of the second splitting activation chain is fixed, the inhibitory effect of introducing an extension fragment at the 5' end of the first splitting activation chain on Cas12a activity is stronger than that of introducing an extension fragment at the 3' end.

[0016] Optionally, the entropy-driven DNA circuit module includes a three-stranded complex and a fuel chain. The three-stranded complex comprises a first strand, a second strand, and a third strand bound together by partial complementary hybridization. A portion of the second strand's sequence is complementary to the target nucleic acid, and the third strand serves as the trigger strand.

[0017] Optionally, the hybridization of the target nucleic acid with the second strand triggers a strand displacement reaction, causing the second strand to be released from the three-stranded complex; the released second strand exposes a new toehold region on the first strand, driving the fuel chain to undergo a further strand displacement reaction, thereby releasing the third strand.

[0018] Optionally, the released third strand can interact with the first cleavage activation strand, the second cleavage activation strand, and the crRNA to form an activation structure, thereby activating the trans-cleavage activity of Cas12a.

[0019] Optionally, the isothermal condition is 37°C; the reporter molecule is a single-stranded DNA probe with fluorescent and quenching groups labeled at both ends; and the target nucleic acid is miRNA, DNA, or RNA.

[0020] Secondly, a biosensor system for one-pot detection of target nucleic acids includes:

[0021] reaction vessel; and

[0022] A combination of detection reagents, provided either within the reaction vessel or separately, comprises:

[0023] a) Cas12a-crRNA-ribonucleoprotein complex;

[0024] b) A programmable splitting activator module comprising a first splitting activation strand and a second splitting activation strand, wherein at least one strand has an extension fragment of 3 to 12 nucleotides in length at its 5' end and / or 3' end;

[0025] c) An entropy-driven DNA circuit module containing a nucleic acid component capable of undergoing a strand displacement reaction with the target nucleic acid and releasing the trigger strand;

[0026] d) Reporter molecules that can be trans-cleaved by Cas12a;

[0027] The entropy-driven DNA circuit module includes a three-stranded complex and a fuel chain. The three-stranded complex includes a first strand, a second strand, and a third strand that are bound together by partial complementary hybridization. The third strand serves as the trigger strand, and the trigger strand can co-activate Cas12a with the programmable cleavage activator module and crRNA.

[0028] Thirdly, a kit for one-pot nucleic acid detection includes a biosensor system for one-pot detection of target nucleic acid.

[0029] The beneficial effects of this application are as follows: The one-pot detection method includes the following steps: mixing a sample containing the target nucleic acid with a reaction system, wherein the reaction system comprises: a Cas12a-crRNA ribonucleoprotein complex; a programmable cleavage activator module, including a first cleavage activating strand and a second cleavage activating strand, wherein at least one strand has an extension fragment at its 5' end and / or 3' end, the extension fragment regulating the trans-cleavage activity of the Cas12a-crRNA complex through steric hindrance effect; an entropy-driven DNA circuit module, comprising a nucleic acid component capable of undergoing a strand displacement reaction with the target nucleic acid, the strand displacement reaction releasing a trigger strand that binds to the programmable cleavage activator module to activate Cas12a, a reporter molecule that can be trans-cleaved by Cas12a incubated under isothermal conditions; and detecting the signal generated by the cleavage of the reporter molecule, the intensity of which is correlated with the concentration of the target nucleic acid. The method, by introducing a programmable cleavage activator module with a specific extension fragment design, achieves precise and programmable control of the trans-cleavage activity of the Cas12a-crRNA complex. The programmable cleavage activator module is cascaded with the entropy-driven DNA circuit module. The entropy-driven DNA circuit module releases the trigger strand required to activate the downstream Cas12a system through a target-triggered strand displacement reaction, achieving initial signal amplification and conversion. This eliminates the need for enzymatic amplification steps such as RPA or LAMP in the entire detection process, which can be completed under isothermal conditions. This not only avoids the risks of contamination, increased costs, and operational complexity caused by the introduction of exogenous enzymes, but also eliminates the potential timing matching problem between multi-enzyme reaction systems. Attached Figure Description

[0030] Figure 1 A schematic diagram illustrating the activation of Cas12a by ssDNA during cell division;

[0031] Figure 2 This is a schematic diagram of the structure of nine different combinations of splitting ssDNA sequences;

[0032] Figure 3 This is a comparison chart of the efficiency of Cas12a activation by 9 different ssDNA combinations. Fluorescence represents fluorescence intensity.

[0033] Figures 4A - 4H This is a comparison chart showing the activation efficiency of Cas12a by extending the 5' / 3' end of the splitting activation strand, where AH correspond to different combinations of fixed strands (ssDNA / dsDNA) and variable strands (extended 5' / 3' / double ends);

[0034] Figure 5 This is a schematic diagram of the detection principle, where Intermediate represents the intermediate product and target represents the target.

[0035] Figure 6 This is a fluorescence kinetic diagram for feasibility verification, where Time represents time and Blank represents the blank control;

[0036] Figure 7 This is an optimized diagram of the fuel chain sequence in the reaction system;

[0037] Figure 8 This is a graph showing the optimized RNP concentration in the reaction system;

[0038] Figure 9 The fluorescence curves obtained by detecting different concentrations of miRNA-21 solutions in a one-pot assay for regulating CRISPR / Cas12a trans-cleavage activity in sensitivity detection.

[0039] Figure 10 This is a linear relationship graph of the one-pot detection method for regulating the trans-cleavage activity of CRISPR / Cas12a in sensitivity detection;

[0040] Figure 11 This is a graph showing the specificity detection results of a one-pot method for detecting the trans-cleavage activity of CRISPR / Cas12a;

[0041] Figure 12 This is a schematic diagram of the one-pot detection method for regulating the trans-cleavage activity of CRISPR / Cas12a. Detailed Implementation

[0042] Sequence List:

[0043] Number Sequence Name Sequence (5’-3’) 1 crRNA UAAUUUCUACUAAGUGUAGAUACCCCUAUCACCUCGACUCC 2 TS GGAGTCGAGGTGATAGGGGT 3 Reporter FAM-TTATT-BHQ1 4 Pd-ss6 GGAGTC 5 Pd-ss7 GGAGTCG 6 Pd-ss8 GGAGTCGA 7 Pd-ss9 GGAGTCGAG 8 Pd-ss10 GGAGTCGAGG 9 Pd-ss11 GGAGTCGAGGT 10 Pd-ss12 GGAGTCGAGGTG 11 Pd-ss13 GGAGTCGAGGTGA 12 Pd-ss14 GGAGTCGAGGTGAT 13 Pp-ss6 AGGGGT 14 Pp-ss7 TAGGGGT 15 Pp-ss8 ATAGGGGT 16 Pp-ss9 GATAGGGGT 17 Pp-ss10 TGATAGGGGT 18 Pp-ss11 GTGATAGGGGT 19 Pp-ss12 GGTGATAGGGGT 20 Pp-ss13 AGGTGATAGGGGT 21 Pp-ss14 GAGGTGATAGGGGT 22 Pd-ss11-c ACCTCGACTCC 23 Pp-ss9-c ACCCCTATC 24 Pd-ss11_5’E3 ACAGGAGTCGAGGT 25 Pd-ss11_3’E3 GGAGTCGAGGTACA 26 Pd-ss11_DE3 ACAGGAGTCGAGGTACA 27 Pd-ss11_5’E6 CACACAGGAGTCGAGGT 28 Pd-ss11_3’E6 GGAGTCGAGGTACACAC 29 Pd-ss11_DE6 CACACAGGAGTCGAGGTACACAC 30 Pd-ss11_5’E9 ACACACACAGGAGTCGAGGT 31 Pd-ss11_3’E9 GGAGTCGAGGTACACACACA 32 Pd-ss11_DE9 ACACACACAGGAGTCGAGGTACACACACA 33 Pd-ss11_5’E12 CACACACACACAGGAGTCGAGGT 34 Pd-ss11_3’E12 GGAGTCGAGGTACACACACACAC 35 Pd-ss11_DE12 CACACACACACAGGAGTCGAGGTACACACACACAC 36 Pd-ss11_5’E3-c TGTACCTCGACTCC 37 Pd-ss11_3’E3-c ACCTCGACTCCTGT 38 Pd-ss11_DE3-c TGTACCTCGACTCCTGT 39 Pd-ss11_5’E6-c GTGTGTACCTCGACTCC 40 Pd-ss11_3’E6-c ACCTCGACTCCTGTGTG 41 Pd-ss11_DE6-c GTGTGTACCTCGACTCCTGTGTG 42 Pd-ss11_5’E9-c TGTGTGTGTACCTCGACTCC 43 Pd-ss11_3’E9-c ACCTCGACTCCTGTGTGTGT 44 Pd-ss11_DE9-c TGTGTGTGTACCTCGACTCCTGTGTGTGT 45 Pd-ss11_5’E12-c GTGTGTGTGTGTACCTCGACTCC 46 Pd-ss11_3’E12-c ACCTCGACTCCTGTGTGTGTGTG 47 Pd-ss11_DE12-c GTGTGTGTGTGTACCTCGACTCCTGTGTGTGTGTG 48 Pp-ss9_5’E3 CACGATAGGGGT 49 Pp-ss9_3’E3 GATAGGGGTCAC 50 Pp-ss9_DE3 CACGATAGGGGTCAC 51 Pp-ss9_5’E6 ACACACGATAGGGGT 52 Pp-ss9_3’E6 GATAGGGGTCACACA 53 Pp-ss9_DE6 ACACACGATAGGGGTCACACA 54 Pp-ss9_5’E9 CACACACACGATAGGGGT 55 Pp-ss9_3’E9 GATAGGGGTCACACACAC 56 Pp-ss9_DE9 CACACACACGATAGGGGTCACACACAC 57 Pp-ss9_5’E12 ACACACACACACGATAGGGGT 58 Pp-ss9_3’E12 GATAGGGGTCACACACACACA 59 Pp-ss9_DE12 ACACACACACACGATAGGGGTCACACACACACA 60 Pp-ss9_5’E3-c GTGACCCCTATC 61 Pp-ss9_3’E3-c ACCCCTATCGTG 62 Pp-ss9_DE3-c GTGACCCCTATCGTG 63 Pp-ss9_5’E6-c TGTGTGACCCCTATC 64 Pp-ss9_3’E6-c ACCCCTATCGTGTGT 65 Pp-ss9_DE6-c TGTGTGACCCCTATCGTGTGT 66 Pp-ss9_5’E9-c GTGTGTGTGACCCCTATC 67 Pp-ss9_3’E9-c ACCCCTATCGTGTGTGTG 68 Pp-ss9_DE9-c GTGTGTGTGACCCCTATCGTGTGTGTG 69 Pp-ss9_5’E12-c TGTGTGTGTGTGACCCCTATC 70 Pp-ss9_3’E12-c ACCCCTATCGTGTGTGTGTGT 71 Pp-ss9_DE12-c TGTGTGTGTGTGACCCCTATCGTGTGTGTGTGT 72 Pp-ss9_DE6-cPAM ACACACGATAGGGGTTAAACA 73 Pp-ss9_DE6-cPAM-c TGTTTAACCCCTATCGTGTGT 74 Pp-ss9_DE6-ncPAM1 ACACACGATAGGGGTCATACA 75 Pp-ss9_DE6-ncPAM1-c TGTATGACCCCTATCGTGTGT 76 Pp-ss9_DE6-ncPAM2 ACACACGATAGGGGTGACACA 77 Pp-ss9_DE6-ncPAM2-c TGTGTCACCCCTATCGTGTGT 78 S0 TCAACATCAGTCTGATAAGCTATAGGGACCCCTATCACCTCGACTCC 79 S1 CCCTATAGCTTATCAGACT 80 S2 GGAGTCGAGGTGATAGGGGT 81 F GGAGTCGAGGTGATAGGGGTCCCTATAGCTTATCAGACT 82 S0’ TCAACATCAGTCTGATAAGCTATAGGGGTGACCCCTATCGTG 83 S2’ CACGATAGGGGTCAC 84 F’(F’2) TAGGGGTCACCCCTATAGCTTATCAGACT 85 Alt-S0’ TCAACATCAGTCTGATAAGCTATAGGGTACCTCGACTCCT 86 Alt-S2’ AGGAGTCGAGGTA 87 Alt-F’ TCGAGGTACCCTATAGCTTATCAGACT 88 F’1 ATAGGGGTCACCCCTATAGCTTATCAGACT 89 F’3 AGGGGTCACCCCTATAGCTTATCAGACT 90 F’4 GGGGTCACCCCTATAGCTTATCAGACT 91 F’5 GGGTCACCCCTATAGCTTATCAGACT 92 miRNA-21 UAGCUUAUCAGACUGAUGUUGA 93 SM-miRNA-21 UAGCUUAUCACACUGAUGUUGA 94 DM-miRNA-21 UAGGUUAUCACACUGAUGUUGA 95 miRNA-155 UUAAUGCUAAUCGUGAUAGGGGUU 96 miRNA-373 GAAGUGCUUCGAUUUUGGGGUGU 97 miRNA-141 UAACACUGUCUGGUAAAGAUGG 98 let-7a UGAGGUAGUAGGUUGUAUAGUU

[0044] Notes: c indicates complementary sequence; cPAM indicates typical PAM sequence; ncPAM indicates atypical PAM sequence; Alt indicates substitution sequence; SM indicates single base mismatch; DM indicates double base mismatch; red markers indicate mismatch sites; 5'E, 3'E, and DE indicate extension sequences located at the 5' end, 3' end, and both ends, respectively; numerical suffixes indicate the length of the extension sequence (in nucleotide pairs); ss and ds indicate single-stranded and double-stranded forms, respectively.

[0045] The present invention will now be described in further detail with reference to specific embodiments and accompanying drawings. Similar elements in different embodiments are referred to by associated similar element reference numerals. In the following embodiments, many details are described to facilitate a better understanding of this application. However, those skilled in the art will readily recognize that some features may be omitted in different situations, or may be replaced by other elements, materials, or methods. In some cases, certain operations related to this application are not shown or described in the specification. This is to avoid obscuring the core parts of this application with excessive description. For those skilled in the art, detailed description of these related operations is not necessary; they can fully understand the related operations based on the description in the specification and general technical knowledge in the art.

[0046] Furthermore, the features, operations, or characteristics described in the specification can be combined in any suitable manner to form various embodiments. At the same time, the steps or actions in the method description can be rearranged or adjusted in a manner obvious to those skilled in the art. Therefore, the various orders in the specification and drawings are only for the clear description of a particular embodiment and do not imply a necessary order, unless otherwise stated that a particular order must be followed.

[0047] The serial numbers assigned to components in this article, such as "first" and "second", are used only to distinguish the objects being described and have no sequential or technical meaning.

[0048] A one-pot detection method for regulating the trans-cleavage activity of CRISPR / Cas12a includes the following steps:

[0049] The sample containing the target nucleic acid is mixed with a reaction system comprising:

[0050] a) Cas12a-crRNA-ribonucleoprotein complex;

[0051] b) A programmable cleavage activator module, comprising a first cleavage activation strand and a second cleavage activation strand, wherein at least one strand has an extension fragment at its 5' end and / or 3' end, the extension fragment regulating the trans-cleavage activity of the Cas12a-crRNA complex through a steric hindrance effect.

[0052] c) An entropy-driven DNA circuit module comprising a nucleic acid component capable of undergoing a strand displacement reaction with the target nucleic acid, the strand displacement reaction releasing a trigger strand that binds to the programmable cleavage activator module to activate Cas12a.

[0053] d) Reporter molecules that can be trans-cleaved by Cas12a;

[0054] Incubation is performed under constant temperature conditions; and the signal generated by the cleavage of the reporter molecule is detected, the intensity of which is correlated with the concentration of the target nucleic acid.

[0055] The method described above achieves precise and programmable control over the trans-cleavage activity of the Cas12a-crRNA complex by introducing a programmable cleavage activator module with a specific extension fragment design. Specifically, by introducing single- or double-stranded extension fragments of controllable length at the 5' or 3' end of the cleavage activation strand, these fragments can generate a steric hindrance effect, thereby effectively inhibiting non-specific activation of Cas12a in the absence of a target and significantly reducing background signal leakage in the detection system. Addressing the high background noise and system failure issues caused by uncontrolled activation in existing CRISPR / Cas12a detection methods, this method achieves precise inhibition of enzyme activity without relying on external physical stimuli or complex protein modifications, laying a core foundation for constructing a detection platform with low background and high signal-to-noise ratio.

[0056] A programmable cleavage activator module is cascaded with an entropy-driven DNA circuit module. The entropy-driven DNA circuit module, through a target-triggered strand displacement reaction, releases the trigger strand required to activate the downstream Cas12a system, achieving initial signal amplification and conversion. This eliminates the need for enzymatic amplification steps such as RPA or LAMP, allowing the entire detection process to be completed under isothermal conditions. This not only avoids the contamination risks, increased costs, and operational complexity associated with introducing exogenous enzymes but also eliminates potential timing matching challenges between multi-enzyme reaction systems. Therefore, this approach achieves high-sensitivity detection while significantly simplifying the operational process, improving detection stability and reproducibility, and providing a new technical pathway for developing easy-to-use molecular diagnostic tools suitable for point-of-care testing (POCT).

[0057] Secondly, all reaction components are pre-mixed in a single reaction vessel. After the sample is added, the entire process from target recognition and signal amplification to fluorescence signal output can be completed under constant temperature conditions without the need to add reagents or perform physical separation. This integrated design not only significantly improves the convenience and efficiency of detection and reduces the risk of errors or contamination introduced by multi-step operations, but also greatly reduces the dependence of the entire detection system on instruments and equipment, making it easier to deploy and apply in resource-constrained environments.

[0058] In some implementations, both the first and second cleavage activation strands bind complementary to specific regions of the crRNA. When both strands are present, they form a stable complex with the crRNA, jointly activating the trans-cleavage activity of Cas12a. In the absence of a target molecule, the two cleaving strands exist independently in the system. Since neither strand possesses independent activation capability, the Cas12a system remains quiescent, thus significantly suppressing background signal leakage at the source. This ensures that the one-pot detection system has extremely low background noise and a high signal-to-noise ratio, a prerequisite for achieving high-sensitivity detection.

[0059] In some implementations, the extended fragment is single-stranded or double-stranded DNA, with a length of 3 to 12 nucleotides. Limiting the length to this range ensures that those skilled in the art can design cleavage activators with the desired inhibitory strength, avoiding blind design.

[0060] In some implementations, when the sequence of the first cleavage activation strand is fixed, introducing an extension fragment at the 3' end of the second cleavage activation strand has a stronger inhibitory effect on Cas12a activity than introducing an extension fragment at the 5' end; and / or, when the sequence of the second cleavage activation strand is fixed, introducing an extension fragment at the 5' end of the first cleavage activation strand has a stronger inhibitory effect on Cas12a activity than introducing an extension fragment at the 3' end. When one strand is fixed, introducing an extension fragment at a specific end (3' or 5') of the other strand produces a stronger inhibitory effect. Experiments were conducted using Pd-ss11 and Pp-ss9 as a basis, constructing single-stranded (ssDNA) or double-stranded (dsDNA) forms, respectively, and systematically extending the 5', 3', or double ends (3–12 nt) on one strand, as illustrated in the diagram. Figure 4AAs shown in –H, the experimental method involved a total reaction volume of 20 μL, including 20 nM Cas12a-crRNA complex (RNP), 10 nM cleavage activator (formed by mixing equimolar concentrations of Pd-ssx and Pp-ssy), 250 nM fluorescent probe (Reporter), 1× rCutSmart buffer, and 1 mM DTT, with the remainder made up with TE / Mg²⁺ buffer. Control groups were also included, with either Pd-ssx or Pp-ssy added separately, to assess the single-strand activation background. The reaction was carried out at 37 °C, and fluorescence signal changes were recorded in real time using a real-time quantitative PCR instrument. The results showed that the extension direction and strand state of the cleaving strand significantly affected Cas12a activity. First, the extension direction exhibited a clear asymmetry: when the Pp strand was immobilized, 3′ extension of the Pd strand significantly inhibited activity, while 5′ extension had a weaker effect; when the Pd strand was immobilized, 5′ extension of the Pp strand had the strongest inhibitory effect, while 3′ extension had a relatively smaller effect. Secondly, the differences in strand states are significant; double-stranded (dsDNA) extension generally produces a stronger inhibitory effect than single-stranded (ssDNA), and the degree of inhibition increases with the number of extended bases. Thirdly, simultaneous extension of both ends often induces a superimposed inhibitory effect, almost completely inhibiting Cas12a activation in some combinations. In the special case of Pp-terminal 3' extension, an anomalous increase in activation efficiency was observed, which is speculated to be achieved through inducing local conformational changes. These results indicate that through rational design of the direction and length of splitting strand extension, the activity of Cas12a can be continuously tunable, providing a new structural basis for its application in molecular computation and multi-level regulatory systems. This embodiment further systematically studies the influence of splitting strand extension direction and length on Cas12a activation efficiency.

[0061] In some implementations, the entropy-driven DNA circuit module includes a triple-stranded complex and a fuel strand. The triple-stranded complex comprises a first strand, a second strand, and a third strand bound together by partial complementary hybridization. A portion of the second strand's sequence is complementary to the target nucleic acid, and the third strand serves as the trigger strand. By designing a triple-stranded complex containing a first strand (S0), a second strand (S1), and a third strand (S2), and utilizing the partial complementarity of the second strand with the target nucleic acid, this structure ensures that the target molecule can specifically trigger the entire circuit via a toehold-mediated strand substitution reaction. The released third strand (S2), as a defined "trigger strand," becomes the sole and necessary bridge connecting upstream target recognition and downstream CRISPR / Cas12 activation, achieving efficient and directional transduction of the signal from recognition to amplification. This avoids the signal leakage or low conversion efficiency problems that may exist in the prior art. In the absence of a target, the triple-stranded complex structure is stable, and the trigger strand (S2) is firmly locked within the complex and cannot be released. The downstream Cas12a system, lacking a trigger chain for bridging, cannot be effectively activated even in the presence of a cleavage activator, thus achieving a near-zero leakage background. This "off" state is guaranteed by the specific structure of the entropy-driven DNA circuit module, which is the foundation for achieving a high signal-to-noise ratio in the entire detection system. The entropy-driven DNA circuit module provides a stable and predictable target response and primary amplification; the released trigger chain (S2) works in conjunction with the programmable cleavage activator module to precisely regulate the trans-cleavage activity of Cas12a, performing secondary amplification and generating a detectable signal. This modular and clearly defined design allows the entire reaction to proceed efficiently under single-tube, isothermal conditions, without the need for physical separation or complex operations, ultimately achieving high sensitivity.

[0062] The hybridization of the target nucleic acid with the second strand triggers a chain displacement reaction, causing the second strand to be released from the three-stranded complex. The released second strand exposes a new toehold region on the first strand, driving the fuel strand to undergo a further chain displacement reaction, thereby releasing the third strand. This step, converting the presence of the target molecule into the release of the trigger strand (S2), is a key technical step in precisely coupling non-enzymatic signal amplification with CRISPR detection. The released third strand can interact with the first and second cleavage activation strands and the crRNA to form an activation structure, thereby activating the trans-cleavage activity of Cas12a. Firstly, this avoids signal attenuation or interruption due to unclear intermediate product functions, a crucial foundation for achieving high-sensitivity detection. Secondly, by limiting the interaction of the third strand with a specific programmable cleavage activator and crRNA, the controllability and specificity of the activation process are further enhanced, ensuring that the trans-cleavage activity of Cas12a is only triggered when all the correct components are present, thus further suppressing non-specific background signals at the molecular level.

[0063] In some implementations, the isothermal condition is 37°C, a common temperature for nucleases such as Cas12a to maintain optimal trans-cleavage activity, ensuring efficient and stable cascade reactions. The reporter molecule is a single-stranded DNA probe labeled with a fluorescent group and a quencher group at both ends. When Cas12a is activated, its non-specific trans-cleavage activity cleaves the reporter molecule, causing the fluorescent group and quencher group to separate, resulting in a significantly enhanced fluorescence signal. This "fluorescence recovery" signal mode has low background noise and a high signal-to-noise ratio, and is compatible with commercially available real-time quantitative PCR instruments or simple fluorescence detectors. The target nucleic acid is miRNA, DNA, or RNA.

[0064] In some embodiments, a biosensor system for one-pot detection of a target nucleic acid is provided, comprising: a reaction vessel; and a detection reagent assembly disposed within the reaction vessel or provided separately, the detection reagent assembly comprising:

[0065] a) Cas12a-crRNA-ribonucleoprotein complex;

[0066] b) A programmable splitting activator module comprising a first splitting activation strand and a second splitting activation strand, wherein at least one strand has an extension fragment of 3 to 12 nucleotides in length at its 5' end and / or 3' end;

[0067] c) An entropy-driven DNA circuit module containing a nucleic acid component capable of undergoing a strand displacement reaction with the target nucleic acid and releasing the trigger strand;

[0068] d) Reporter molecules that can be trans-cleaved by Cas12a;

[0069] The entropy-driven DNA circuit module includes a three-stranded complex and a fuel chain. The three-stranded complex includes a first strand, a second strand, and a third strand that are bound together by partial complementary hybridization. The third strand serves as the trigger strand, and the trigger strand can co-activate Cas12a with the programmable cleavage activator module and crRNA.

[0070] In some implementations, a kit for one-pot nucleic acid detection is provided, comprising a biosensor system for one-pot detection of a target nucleic acid.

[0071] In the implementation of this invention, the DNA and RNA oligonucleotides used were synthesized by Shanghai Sangon Biotech Co., Ltd. and purified by HPLC. Cas12a (Cpf1, 100 μM) and 10× rCutSmart buffer [50 mM potassium acetate, 20 mM Tris-acetic acid, 10 mM magnesium acetate, 100 μg / mL recombinant albumin, pH 7.9] were purchased from New England Biolabs. The buffer system included TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and TE / Mg²⁺ buffer (10 mM Tris-HCl, 1 mM EDTA, 12.5 mM MgCl₂, pH 8.0). Dithiothreitol (DTT) was freshly prepared before the experiment. All real-time fluorescence signal detection was performed in a BIOER FQD-96A real-time quantitative PCR instrument, with the reaction temperature maintained at 37℃. The green channel was used for signal monitoring.

[0072] Example 1:

[0073] This embodiment provides a general one-pot nucleic acid detection method. See also... Figure 1 and 5 This method was performed in a single reaction vessel with a reaction volume of 20 μL, comprising 20 nM Cas12a-crRNA complex (RNP), 10 nM cleavage activation strand, 250 nM fluorescent probe (Reporter), 1× rCutSmart buffer, and 1 mM DTT, with the remainder made up by TE / Mg²⁺ buffer. The mixture was placed in a real-time quantitative PCR instrument and reacted at 37 ℃, with fluorescence signal changes acquired in real time. Experimental results showed that a single cleavage strand could not activate Cas12a, but when two cleavage strands were present simultaneously, their synergistic effect significantly enhanced the trans-cleavage rate and fluorescence signal intensity of Cas12a, demonstrating a significant binary synergistic activation effect. Further investigation by systematically adjusting the extension direction (5′ end, 3′ end, or paired ends) and length of the cleavage strands revealed that the extension direction, number, and strand state have a significant impact on the activation kinetics of Cas12a. These experiments validated the feasibility of using cleavage activation strand design to achieve fine-tuned activity control in the Cas system, laying the foundation for the subsequent construction of a low-background, high-signal-to-noise ratio one-pot detection system.

[0074] After completing the construction of the splitting activation chain regulation system, this invention further proposes an entropy-driven DNA circuit module, also known as the EDC module. This module is responsible for target recognition and primary signal amplification. Its core is a triple-stranded complex (S0-S1-S2) formed by partial complementary hybridization of three DNA strands (S0, S1, S2) and a fuel chain. A portion of the S1 strand's sequence is complementary to the target nucleic acid, while the S2 strand serves as the "trigger chain" connecting the upstream circuit and the downstream CRISPR system. The triple-stranded complex (S0-S1-S2) undergoes an entropy-driven chain displacement reaction with the fuel chain (F), enabling the upstream reaction product triggered by the target to directly activate the downstream splitting Cas12a, achieving efficient signal amplification and real-time transduction. The reaction system had a volume of 20 μL and contained 100 nM triple-stranded complex, 100 nM fuel chain, 80 nM RNP, 100 nM optimized cleavage activation chain (e.g., Pd-ss11+5′ / 3′(3)), 250 nM Reporter, 1× rCutSmart buffer, 1 mM DTT, and different concentrations of miRNA-21 target. All components of the reaction system were added at once without stepwise operation. After thorough mixing, the system was incubated at 37 ℃ for real-time fluorescence monitoring.

[0075] In the absence of a target, all components coexist stably in the system. Cas12a remains quiescent due to ineffective activation of the splitting strand, resulting in a low and stable fluorescence signal. When the target miRNA-21 is present, it binds to the triple-stranded complex via a toehold-mediated strand displacement reaction, causing S1 to be released from the S0-S1-S2 structure. The release of S1 exposes a new toehold region on S0, driving further strand displacement of the fuel chain F, generating a new intermediate complex and releasing S2 and the target. The released S2 acts as a bridging element, joining crRNA and the splitting activation strand to construct the complete Cas12a activation structure, thereby triggering the trans-cleavage activity of Cas12a. The activated Cas12a non-specifically cleaves the fluorescent reporter molecule within the system, separating the fluorophore from the quencher group, generating a significantly enhanced fluorescence signal, enabling real-time visual detection of the target.

[0076] This system's detection process requires no exogenous enzymes and does not rely on multi-step reaction switching, thus exhibiting excellent stability and convenience. By optimizing the extension structure of the splitting strand and the RNP concentration, background leakage can be effectively reduced, the signal-to-noise ratio improved, and quantitative detection from nM to pM levels can be achieved. Further experiments show that this detection platform can accurately distinguish single-base mismatched miRNA sequences in specificity tests, demonstrating excellent resolution and clinical application potential.

[0077] This application is the first to achieve the controllable integration of activation rate and automated signal amplification in a CRISPR system. The system architecture is rationally designed, easy to operate, highly sensitive, and highly specific, enabling rapid nucleic acid detection without complex equipment. It has broad application prospects in POCT molecular diagnostics, pathogen detection, and clinical nucleic acid monitoring.

[0078] Example 2: Nine pairs of splitting ssDNA combinations truncated at different sites (Pd-ssx and Pp-ssy, where x and y represent different lengths) were designed and synthesized. Figure 1 A schematic diagram illustrating the mechanism by which splitting ssDNA activates Cas12a is shown. The splitting strand assembly used consists of Pd-ssx and Pp-ssy, where x and y represent different cutoff sites of 6–14 base pairs, respectively. The specific structure is shown below. Figure 2 As shown, the preparation method of the experimental system is consistent with the aforementioned biosensor construction method.

[0079] The total reaction volume was 20 μL, including 20 nM Cas12a-crRNA complex (RNP), 10 nM cleavage activator (formed by mixing equimolar concentrations of Pd-ssx and Pp-ssy), 250 nM fluorescent probe (Reporter), 1×rCutSmart buffer, and 1 mM DTT, with the remainder made up with TE / Mg²⁺ buffer. A control group was also included, with either Pd-ssx or Pp-ssy added separately, to assess single-strand activation background. The reaction was incubated at 37°C, and fluorescence signal changes were recorded in real-time using a real-time quantitative PCR instrument.

[0080] pass Figure 3 The experimental screening results showed that the combination of Pd-ss11 and Pp-ss9 exhibited the most ideal characteristics: when either exists alone, it produces almost no background signal, while when both exist together, it can efficiently activate Cas12a, with an activation efficiency comparable to that of the complete activation chain. Therefore, Pd-ss11 and Pp-ss9 were determined to be the optimal basal cleavage activator pair.

[0081] Building upon this, to endow it with "programmable" controllability, the effects of introducing extension fragments of different lengths (3-12 nt, which can be single-stranded or double-stranded) at the 5' or 3' end of Pd-ss11 or Pp-ss9 on the activation efficiency of Cas12a were systematically studied. Experimental results are as follows: Figure 4AAs shown in –H, the experimental method involved a total reaction volume of 20 μL, including 20 nM Cas12a-crRNA complex (RNP), 10 nM cleavage activator (formed by mixing equimolar concentrations of Pd-ssx and Pp-ssy), 250 nM fluorescent probe (Reporter), 1× rCutSmart buffer, and 1 mM DTT, with the remainder made up with TE / Mg²⁺ buffer. A control group was also included, with either Pd-ssx or Pp-ssy added separately, to assess the single-strand activation background. The reaction was incubated at 37°C, and fluorescence signal changes were recorded in real-time using a real-time quantitative PCR instrument.

[0082] The results showed that the extension direction of the splitting strands exhibited a specific asymmetric effect: when the Pp-ss9 strand was fixed, extension at the 3' end of the Pd-ss11 strand significantly inhibited Cas12a activity more strongly than extension at the 5' end. Conversely, when the Pd-ss11 strand was fixed, extension at the 5' end of the Pp-ss9 strand showed the strongest inhibitory effect. This finding provides clear guidance for targeted inhibition design. The influence of strand state and length: under the same direction, double-strand extension produced a stronger inhibitory effect than single-strand extension. The inhibitory strength showed a gradient increasing trend with the increase of the extension fragment length, achieving continuous regulation of Cas12a activity from partial inhibition to near-complete shutdown. Synergistic superposition effect: Simultaneous introduction of extension fragments at specific ends of the two splitting strands can produce a synergistic inhibitory effect, and in some combinations, can almost completely block Cas12a activation.

[0083] After clarifying the activation rules of cell division, these rules were applied to construct a one-pot detection method synergistically using entropy-driven DNA circuit modules and Cas12a to achieve low-background, high-sensitivity nucleic acid detection, such as... Figure 5 As shown.

[0084] The total volume of the reaction system was 20 μL, including 100 nM triplet complex (S0-S1-S2), 100 nM fuel chain (F), 80 nM RNP, 100 nM splitting activator Pd-ss11+5′ / 3′(3), 250 nM Reporter, 1× rCutSmart buffer and 1 mM DTT.

[0085] The reaction was carried out at 37°C, and the fluorescence signal was recorded in real time. The results are as follows: Figure 6 As shown, the one-pot biosensor constructed in this invention exhibits extremely low background signal in the absence of a target, only showing strong fluorescence enhancement in the presence of a target. This result verifies the feasibility and effectiveness of the proposed splitting strand elongation regulation strategy in the one-pot EDC-CRISPR / Cas12a system.

[0086] Example 3:

[0087] This embodiment details the entropy-driven DNA circuit module cascaded with the programmable division activator module, which consists of a three-stranded complex (S0-S1-S2) and a fuel chain. The S1 strand contains regions complementary to the target and regions complementary to S0 and S2. In the absence of a target, the three strands stably hybridize.

[0088] When the target molecule appears, it binds to the complementary region of S1, stripping S1 from the complex via a thermodynamically driven chain displacement reaction. After S1 is replaced, a short sequence region on the previously masked S0 chain is exposed; this region is called the "toe." The fuel chain is designed so that one end is completely complementary to this toe. The fuel chain binds to S0 via a toe-mediated chain displacement reaction, gradually displacing the S2 chain completely from the complex. This process is entropy-driven, enabling signal amplification without consuming the enzyme. Ultimately, the target molecule is cyclically released, triggering new reaction cycles, while the S2 chain is released in large quantities as the output product of this module.

[0089] The released S2 strand is a crucial messenger. Its sequence is designed to specifically bind to both the crRNA in the Cas12a-crRNA complex and the programmable cleavage activator modules (such as Pd-ss11 and Pp-ss9) described in Example 2. Only in the presence of S2 can it "bring together" the two cleaving activation strands and, under the guidance of crRNA, form the complete nucleic acid complex structure necessary for Cas12a activation. Therefore, the release of S2 directly determines whether the downstream CRISPR system can be activated, thereby translating the presence of the target into Cas12a cleavage activity.

[0090] Example 4:

[0091] This embodiment aims to demonstrate the performance of the one-pot biosensor system described in this invention through specific experimental data, including its feasibility, sensitivity, specificity, and linear range, and to illustrate its application scenarios.

[0092] First, after clarifying the activation mechanism of cell division, it was applied to construct a one-pot detection system synergistic between entropy-driven catalysis (EDC) and Cas12a to achieve low-background, high-sensitivity nucleic acid detection, such as... Figure 5 As shown.

[0093] The total volume of the reaction system was 20 μL, including 100 nM triplet complex (S0-S1-S2), 100 nM fuel chain (F), 80 nM RNP, 100 nM cleavage activator Pd-ss11+5′ / 3′(3), 250 nM Reporter, 1× rCutSmart buffer, and 1 mM DTT. The reaction was carried out at 37 °C, and the fluorescence signal was recorded in real time. Figure 6 As shown, the one-pot biosensor constructed in this invention exhibits extremely low background signal in the absence of a target, only producing strong fluorescence enhancement in the presence of a target. This result verifies the feasibility and effectiveness of the proposed chain elongation regulation strategy in the one-pot EDC-CRISPR / Cas12a system.

[0094] Secondly, to obtain the optimal detection performance of the biosensor, key parameters in the cascade system were optimized. With other conditions in the reaction system fixed, the sequence design of the fuel chain and the concentration of the RNP complex were optimized. The optimal parameters were determined by comparing the fluorescence signal intensity in the presence of the target and the background signal intensity without the target under different fuel chain sequences and different RNP concentrations. The reaction conditions were then optimized. The optimization results are as follows: Figure 7 and Figure 8 As shown, the system achieves the highest signal-to-noise ratio (SNR) when the fuel chain employs a specific sequence design. Furthermore, RNP concentration optimization experiments demonstrate that an RNP concentration of 80 nM ensures optimal SNR while maintaining high signal strength. Therefore, all subsequent performance analyses utilize fuel chain F4 (i.e., F) and an 80 nM RNP concentration as the optimal conditions.

[0095] Evaluate the sensor's sensitivity under optimized conditions. For example... Figure 9 As shown, different concentrations (5 nM to 10 pM) of miRNA-21 were detected, and the fluorescence signal intensity increased with increasing target concentration. Figure 10 The results show that within the concentration range of 10 pM to 1 nM, the fluorescence signal exhibits a good linear relationship with the logarithm of the target concentration, with the linear regression equation being y = 13.84107x + 2262.3848 (R² = 0.99834). Based on three times the standard deviation of the blank control signal, the detection limit of this method is calculated to be as low as 1.24 pM.

[0096] Finally, the specificity of the sensor is tested. For example... Figure 11As shown, tests were conducted using perfectly matched miRNA-21, single-base mismatched sequences (SM), double-base mismatched sequences (DM), and other non-target miRNAs. The results showed that only perfectly matched miRNA-21 produced a strong fluorescent signal; the signals produced by other sequences were indistinguishable from the blank control. This indicates that the sensor of this invention has a strong sequence recognition capability and can effectively distinguish single-base differences.

[0097] In summary, this embodiment demonstrates that the one-pot biosensor constructed by the present invention is not only easy to operate, but also possesses high sensitivity, wide linear range, and excellent specificity. It is highly suitable for the rapid and accurate detection of trace nucleic acid biomarkers (such as miRNA, pathogen DNA / RNA) in clinical samples, and has broad application prospects in the fields of molecular diagnostics and point-of-care testing.

[0098] The above examples illustrate the present invention only to aid in understanding it and are not intended to limit the scope of the invention. Those skilled in the art can make various simple deductions, modifications, or substitutions based on the principles of this invention.

Claims

1. A one-pot detection method for regulating the trans-cleavage activity of CRISPR / Cas12a, characterized in that, Includes the following steps: The sample containing the target nucleic acid is mixed with a reaction system comprising: a) Cas12a-crRNA-ribonucleoprotein complex; b) A programmable cleavage activator module, comprising a first cleavage activation strand and a second cleavage activation strand, wherein at least one strand has an extension fragment at its 5' end and / or 3' end, the extension fragment regulating the trans-cleavage activity of the Cas12a-crRNA complex through a steric hindrance effect. c) An entropy-driven DNA circuit module comprising a nucleic acid component capable of undergoing a strand displacement reaction with the target nucleic acid, the strand displacement reaction releasing a trigger strand that binds to the programmable cleavage activator module to activate Cas12a. d) Reporter molecules that can be trans-cleaved by Cas12a; Incubation was carried out under constant temperature conditions; and The signal generated by the cleavage of the reporter molecule is detected, and the intensity of the signal is correlated with the concentration of the target nucleic acid.

2. The one-pot detection method for regulating CRISPR / Cas12a trans-cleavage activity according to claim 1, characterized in that, Both the first and second cleavage activation strands bind complementary to specific regions of the crRNA. When the first and second cleavage activation strands are present simultaneously, they together form a stable complex structure with the crRNA, jointly activating the trans-cleavage activity of Cas12a.

3. The one-pot detection method for regulating CRISPR / Cas12a trans-cleavage activity according to claim 1 or 2, characterized in that, The extended fragment is single-stranded or double-stranded DNA, with a length of 3 to 12 nucleotides.

4. The one-pot detection method for regulating CRISPR / Cas12a trans-cleavage activity according to claim 1, characterized in that, When the sequence of the first splitting activation chain is fixed, the inhibitory effect of introducing an extension fragment at the 3' end of the second splitting activation chain on Cas12a activity is stronger than that of introducing an extension fragment at the 5' end; and / or, When the sequence of the second splitting activation chain is fixed, the inhibitory effect of introducing an extension fragment at the 5' end of the first splitting activation chain on Cas12a activity is stronger than that of introducing an extension fragment at the 3' end.

5. The one-pot detection method for regulating CRISPR / Cas12a trans-cleavage activity according to claim 1, characterized in that, The entropy-driven DNA circuit module includes a three-stranded complex and a fuel strand. The three-stranded complex comprises a first strand, a second strand, and a third strand that are bound together by partial complementary hybridization. A portion of the second strand is complementary to the target nucleic acid, and the third strand serves as the trigger strand.

6. The one-pot detection method for regulating CRISPR / Cas12a trans-cleavage activity according to claim 5, characterized in that, The hybridization of the target nucleic acid with the second strand triggers a strand displacement reaction, causing the second strand to be released from the three-stranded complex. The released second strand exposes a new toehold region on the first strand, driving the fuel chain to undergo a further strand displacement reaction, thereby releasing the third strand.

7. The one-pot detection method for regulating CRISPR / Cas12a trans-cleavage activity according to claim 6, characterized in that, The released third strand can interact with the first cleavage activation strand, the second cleavage activation strand, and the crRNA to form an activation structure, thereby activating the trans-cleavage activity of Cas12a.

8. The one-pot detection method for regulating CRISPR / Cas12a trans-cleavage activity according to claim 1, characterized in that, The isothermal condition is 37°C; the reporter molecule is a single-stranded DNA probe with fluorescent and quenching groups labeled at both ends; the target nucleic acid is miRNA, DNA, or RNA.

9. A biosensor system for one-pot detection of target nucleic acids, characterized in that, include: Reaction vessel; as well as A combination of detection reagents, provided either within the reaction vessel or separately, comprises: a) Cas12a-crRNA-ribonucleoprotein complex; b) A programmable splitting activator module comprising a first splitting activation strand and a second splitting activation strand, wherein at least one strand has an extension fragment of 3 to 12 nucleotides in length at its 5' end and / or 3' end; c) An entropy-driven DNA circuit module containing a nucleic acid component capable of undergoing a strand displacement reaction with the target nucleic acid and releasing the trigger strand; d) Reporter molecules that can be trans-cleaved by Cas12a; The entropy-driven DNA circuit module includes a three-stranded complex and a fuel chain. The three-stranded complex includes a first strand, a second strand, and a third strand that are bound together by partial complementary hybridization. The third strand serves as the trigger strand, and the trigger strand can co-activate Cas12a with the programmable cleavage activator module and crRNA.

10. A reagent kit for one-pot nucleic acid detection, characterized in that, The biosensor system for one-pot detection of target nucleic acids as described in claim 9.

Images