SSR (Simple Sequence Repeat) molecular marker for resisting fusarium verticillium ear rot of corn, application and detection method
By using SSR molecular markers SSR-46 and SSR-47 in maize, the problems of low throughput and poor accuracy in the detection of maize ear rot in existing technologies have been solved, enabling early genotyping identification and efficient breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-14
- Publication Date
- 2026-04-07
AI Technical Summary
Existing molecular markers for maize ear rot resistance have low throughput, making it difficult to meet the needs of high-throughput breeding. Furthermore, they are not tightly linked to disease resistance genes, resulting in low breeding efficiency and poor accuracy.
We provide SSR molecular markers SSR-46 and SSR-47, located on maize chromosome 3, to assist in resistance to Fusarium wilt in maize. These markers enable early genotyping and screening of resistant plants through PCR amplification and electrophoresis.
This technology enables early DNA detection of maize resistance to Fusarium wilt, improving breeding efficiency, reducing breeding costs, minimizing environmental interference, and enhancing breeding accuracy.
Smart Images

Figure CN121802084A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and more specifically, to SSR molecular markers for maize resistance to Fusarium wilt, their application, and detection methods. Background Technology
[0002] Corn ear rot is a highly destructive ear disease caused by various Fusarium fungi, among which Fusarium verticillioides is one of the main pathogens. This disease leads to the rotting of corn kernels, a severe decline in quality, and even the production of fungal toxins (such as fumonisin), posing a significant threat to food safety.
[0003] Currently, the control of maize ear rot mainly relies on chemical control and disease-resistant breeding. Traditional disease-resistant breeding methods depend on phenotypic identification after the plant is infected. This method has a long breeding cycle, usually requiring several years to complete a full breeding cycle, and is inefficient and easily affected by environmental factors, leading to inaccurate phenotypic identification results and thus affecting the accuracy of breeding.
[0004] In recent years, with the rapid development of molecular biology technology, molecular marker-assisted breeding has gradually become an important breeding method. Molecular marker-assisted breeding enables early selection through DNA-level detection, significantly reducing breeding costs and improving breeding efficiency.
[0005] However, in the existing technologies, most of the reported molecular markers for maize ear rot resistance are SSR markers or SSR markers with wide mapping ranges. Such SSR molecular markers have low detection throughput, which is difficult to meet the needs of high-throughput breeding. Furthermore, they are not tightly linked to disease resistance genes, and recombination can easily lead to detection bias in breeding, affecting the accuracy of breeding. Summary of the Invention
[0006] The technical problem to be solved by this invention is to provide an SSR molecular marker for maize resistance to Fusarium wilt, its application, and a detection method.
[0007] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: This invention provides an SSR molecular marker for maize resistance to Fusarium wilt, including two molecular markers closely linked to resistance or susceptibility QTLs, namely SSR-46 and SSR-47; SSR-46 is located at the bases between 156959134bp and 156959149bp on chromosome 3 of the maize reference gene sequence AGPv5, while SSR-47 is located at the bases between 156959170bp and 156959184bp on chromosome 3 of the maize reference gene sequence AGPv5.
[0008] Furthermore, the variety of corn mentioned is B73.
[0009] The present invention also provides the application of the above-mentioned SSR molecular markers in detecting maize genotypes resistant to Fusarium wilt or in maize breeding.
[0010] The present invention also provides a method for detecting the genotype of maize resistant to Fusarium wilt, wherein the two SSR molecular markers mentioned above are amplified in the genome of the maize sample, and when at least one of the amplified bands of the two SSR molecular markers is 105 bp, the maize sample is determined to have the genotype of resistance to Fusarium wilt.
[0011] Furthermore, when the amplification band of SSR-46 is 100bp and the amplification band of SSR-47 is 110bp, the maize sample is determined to have a susceptible genotype for Fusarium ear rot.
[0012] Furthermore, it also includes the following steps: S1. Obtain the total DNA of the leaf genome of the corn sample as a DNA template; S2. The DNA template was amplified by PCR using a primer set; S3. Perform electrophoresis on the amplification products to determine the genotypes of SSR-46 and SSR-47, and make a judgment.
[0013] Furthermore, the primer set used to amplify SSR-46 includes a first forward primer as shown in sequence SEQ ID NO.1 and a first reverse primer as shown in sequence SEQ ID NO.2.
[0014] Furthermore, the primer set used to amplify SSR-47 includes a second forward primer as shown in sequence SEQ ID NO.3 and a second reverse primer as shown in sequence SEQ ID NO.4.
[0015] This invention also provides a method for molecular marker-assisted breeding of maize resistant to Fusarium wilt, comprising the following steps: S1. Select maize plants whose genome contains the SSR molecular marker disease resistance allele as described above as parents; S2. Cross the parent plants with the maize plants to be improved to obtain offspring plants; S3. Use the detection method described above to identify the genotype of the offspring plants, screen for plants with disease-resistant genotypes, and complete the breeding selection.
[0016] The beneficial effects of this invention are as follows: (1) The SSR molecular marker for maize resistance to Fusarium wilt of Verticillium in this invention is closely linked to the disease-resistant or susceptible QTL, has high stability, low recombination rate, and high marker stability, and can be used to track disease-resistant genes; (2) The SSR molecular marker of maize resistance to Fusarium wilt of Verticillium in this invention can be identified by DNA detection during the maize seedling stage without waiting for the plant to develop the disease; (3) The SSR molecular marker of maize resistance to Fusarium oxysporum ear rot of the present invention can be directly used in breeding links such as maize germplasm resource improvement, inbred line selection, and hybrid selection, which has important practical value for improving the breeding efficiency of maize resistance to Fusarium oxysporum ear rot. (4) The method of the present invention for detecting the genotype of maize resistant to Fusarium wilt is highly efficient and suitable for breeding. The SSR marker is a codominant marker that can distinguish between homozygous and heterozygous types. It requires a small amount of DNA sample, has low requirements for DNA, is simple to operate, has high reliability, has a large number of allelic differences, and does not require the use of radioactive isotopes. Attached Figure Description
[0017] Figure 1 In Embodiment 1 of the present invention, the CIM method was used to initially locate the QTL diagram of maize ear rot resistance; Figure 2 This is a gel image showing the expression of the SSR-46 molecular marker in the parent in Example 1 of the present invention; Figure 3 This is a gel image showing the expression of the SSR-47 molecular marker in the parent in Example 1 of the present invention; Figure 4 In Example 1 of the present invention, the SSR-46 molecular marker is located at F 3:4 Performance in a subset of groups; Figure 5 In Example 1 of the present invention, the SSR-47 molecular marker is located at F 3:4 Performance in a subset of groups; Figure 6 This is the linkage map of SSR-46 and SSR-47 molecular markers on chromosomes in Example 2 of the present invention. Detailed Implementation
[0018] The principles and features of the present invention are described below. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.
[0019] The present invention relates to SSR molecular markers for maize resistance to Fusarium wilt, comprising two molecular markers closely linked to resistance or susceptibility QTLs, namely SSR-46 and SSR-47; wherein, SSR-46 is located at a base position between 156959134bp and 156959149bp on chromosome 3 of the maize reference gene sequence AGPv5, and SSR-47 is located at a base position between 156959170bp and 156959184bp on chromosome 3 of the maize reference gene sequence AGPv5.
[0020] Specifically, the SSR molecular marker closely linked to the resistance QTL showed resistance to Fusarium verticillatum rot, denoted as A in genotyping, with a band length of 105 bp. The SSR molecular marker closely linked to the susceptibility QTL showed susceptibility to Fusarium verticillatum rot, denoted as B in genotyping, with a band length of 100 bp.
[0021] SSR-47, an SSR molecular marker closely linked to the resistance QTL, showed resistance to Fusarium wilt and was designated as A in genotyping, with a band size of 105 bp. SSR molecular marker closely linked to the susceptibility QTL showed susceptibility to Fusarium wilt and was designated as B in genotyping, with a band size of approximately 110 bp.
[0022] The SSR molecular markers of this invention, SSR-46 and SSR-47, are closely linked to the maize resistance gene against Fusarium wilt, located within the resistance functional region on chromosome 3 (156327595bp-157801329bp). Through F1 testing... 2:3 F 3:4 After multiple generations of population validation, the recombination rate is low, the marker stability is high, and the disease resistance gene can be tracked.
[0023] The aforementioned SSR molecular markers can be used to identify disease-resistant genotypes through DNA detection during the corn seedling stage, without waiting for the plants to develop symptoms. Seedling-stage detection can replace autumn disease selection, enabling early selection or elimination, which can greatly reduce field production costs, avoid environmental interference with phenotypic identification, and shorten the breeding cycle by 2-3 generations.
[0024] Preferably, the corn variety used in this invention is B73.
[0025] The aforementioned SSR molecular markers can be applied to maize breeding to obtain plants resistant to Fusarium wilt.
[0026] Preferably, the above-mentioned SSR molecular markers can be directly used in breeding processes such as maize germplasm resource improvement, inbred line selection, and hybridization, and have the advantage of wide application range. They also have important practical value in improving the breeding efficiency of maize resistance to Fusarium wilt.
[0027] The primer set of the present invention includes primers for detecting SSR molecular markers as described above.
[0028] The preferred and specific primers are as follows: (1) Primer set for amplifying SSR-46: The first forward primer is TTTAACACACCACACACGCC (SEQ ID NO.1); this specific sequence is designed based on the 156959134bp site on chromosome 3.
[0029] The first reverse primer is GTCAAGAAACGGACAAGGGC (SEQ ID NO.2); this specific sequence is designed based on the 156959149bp site on chromosome 3.
[0030] (2) Primer set for amplifying SSR-47: The second forward primer is TTTAACACACCACACACGCC (SEQ ID NO.3); the specific sequence is designed based on the 156959170bp site on chromosome 3.
[0031] The second reverse primer is GTCAAGAAACGGACAAGGGC (SEQ ID NO.4); this specific sequence is designed based on the 156959184bp site on chromosome 3.
[0032] The method of the present invention for detecting the genotype of maize resistant to Fusarium wilt involves using the above-mentioned primer set to detect the genotypes of SSR-46 and SSR-47 in the genome of maize samples, and determining whether the maize samples have the genotype of resistant Fusarium wilt based on the results.
[0033] The detection method of the present invention is based on SSR technology. SSR markers are co-dominant markers that can distinguish between homozygous and heterozygous types. It requires a small amount of DNA sample, has low requirements for DNA, is simple to operate, has high reliability, has a large number of allelic differences, and does not require the use of radioactive isotopes.
[0034] Preferably, the specific process for determining the genotype of resistance to Fusarium wilt is as follows: When the genotype of SSR-46 in a maize sample is A (resistant) and / or the genotype of SSR-47 is A (resistant), the maize sample is determined to have a genotype resistant to Fusarium wilt. If both SSR-46 and SSR-47 in a maize sample are genotype B (susceptible), then the maize sample is determined to be a susceptible genotype for Fusarium ear rot.
[0035] The above detection method includes the following specific steps: Step 1: Extract total genomic DNA from maize leaves using the CTAB method as a DNA template.
[0036] Step 2: Use the above primer set to perform PCR amplification on the DNA template.
[0037] The PCR amplification system included 1.5 μL of 50 ng / μL DNA template, 1 μL of primers, 5 μL of 2×M5 HiPerplus Taq HiFi PCR mix, and 2.5 μL of ddH2O.
[0038] The PCR reaction program was as follows: pre-denaturation at 94℃ for 3 min; 35 cycles (94℃ for 30 s, 55-60℃ for 30 s, 72℃ for 2 min), extension at 72℃ for 10 min, and storage at 4℃.
[0039] Step 3: Genotyping the PCR amplification products using 8% polyacrylamide gel electrophoresis.
[0040] Step 4: Determine the genotype of the maize sample based on the typing results.
[0041] The method for molecular marker-assisted breeding of maize resistant to Fusarium wilt of Verticillium spp. of the present invention includes the following steps: S1. Select maize plants whose genome contains the SSR molecular marker disease resistance allele as described above as parents; S2. Cross the parent plants with the maize plants to be improved to obtain offspring plants; S3. Use the detection methods described above to identify the genotype of the offspring plants, and screen for plants that carry both SSR-46 and SSR-47 disease resistance alleles to complete the breeding selection.
[0042] The present invention will be illustrated by specific embodiments below.
[0043] Example 1: Obtaining and Validating SSR Molecular Markers F2 populations were constructed by crossing the inbred line Liao 3012 (resistant parent) and the susceptible inbred line Liao C468 (susceptible parent) resistant to Fusarium wilt. Quantitative trait loci (QTLs) were mapped using a 10K liquid microarray, and the resistance functional region was preliminarily identified as 149016912-161602963 bp on chromosome 3.
[0044] The QTL positioning process is as follows: Liao 3012 was selected as the donor material for resistance to Fusarium verticillatum ear rot, and the susceptible material Liao C468 was used as the control parent. F2 segregating populations were bred through artificial hybridization. After standardized planting of this population, 275 F2 individual plants suitable for experimentation were successfully obtained. These individual plants were then inoculated with Fusarium verticillatum. After the disease characteristics stabilized, an AI recognition system was used to accurately assess the disease level of each individual plant's ear.
[0045] In the process of acquiring population molecular marker data, a dual filtering of markers and population samples is first implemented to eliminate invalid information. Then, based on the genetic theory that "recombination and exchange mostly occur in the form of fragments", SMOOTH software is used to combine the gene background information upstream and downstream of specific loci to complete the correction of potential errors in offspring genotypes and the supplementation of some missing loci.
[0046] After the above processing, the haplotype origin of each individual plant can be clearly identified, thus providing a direct understanding of the genetic material origin information of different plants. The genetic linkage map was constructed using the `mstmap` function in the `ASMap` package of the R language. This map not only clearly marks the genetic location of each molecular marker but also presents the marker distribution density through color differences—the color of each 1cM interval is calculated by dividing "30cM by the total number of markers within 15cM upstream and downstream of that interval," and the color intensity directly reflects the marker density. QTL mapping adopted a composite region mapping (CIM) strategy. Using the `cim` function in the R / qtl software, a specific scanning step size was set for the disease severity trait to perform whole-genome region mapping, with LOD=3 used as the threshold for determining the presence of QTLs.
[0047] The location results are presented as a LOD value curve. Figure 1 In the figure, the horizontal axis corresponds to the genetic position of chromosomes (linkage groups), and the vertical axis is the LOD value. The blue curve represents the dynamic change of the LOD value, the short black vertical line below it indicates the marker position, and the red dashed line is the threshold line of LOD=3. The analysis results show that the LOD value of the interval 149016912-161602963 bp on chromosome 3 significantly exceeds the threshold. This interval is the candidate interval for maize rot resistance genes screened in this study.
[0048] The expression of the SSR-46 molecular marker in the parents is shown in the gel image. Figure 2 As shown, the band indicated by the arrow on the left, at 105 bp, represents the genotype band containing the QTL for resistance to Fusarium wilt, while the band on the right, at approximately 100 bp, represents the genotype band not containing the QTL for resistance to Fusarium wilt.
[0049] The expression of the SSR-47 molecular marker in the parents is shown in the gel image. Figure 3As shown. The band at approximately 105 bp on the left (arrow) represents the genotype band containing the QTL for resistance to Fusarium wilt, while the band at approximately 110 bp on the right represents the genotype band not containing the QTL for resistance to Fusarium wilt.
[0050] Further utilize F 2:3 F 3:4 The population was finely targeted, and SSR-46 and SSR-47, which were significantly associated with disease resistance, were screened by developing SSR markers and combining them with phenotypic association analysis.
[0051] Specifically, the F2 population, constructed by crossing disease-resistant and susceptible parents, is used to derive the F1 generation through single-seed propagation. 2:3 and F 3:4 Family groups, all of which undergo uniform artificial inoculation and precise identification of disease resistance phenotypes.
[0052] Based on the initial localization information, novel SSR markers were developed within the target chromosomal region. New polymorphic SSR markers were screened using parental DNA, followed by PCR amplification and gel electrophoresis genotyping of the entire population. Finally, through genetic linkage analysis and chi-square test, the genotype data of the population were correlated with disease resistance phenotype data, identifying SSR-46 and SSR-47 markers with extremely high cosegregation to the disease resistance trait.
[0053] Using F 3:4 The SSR-46 and SSR-47 molecular markers were validated in 63 exchange strains (out of a total of 4375 isolates) of the population, as follows: Leaf DNA was extracted using the CTAB method and used as a DNA template; the DNA template was then amplified by PCR.
[0054] The PCR amplification system consisted of 1.5 μL of 50 ng / μL DNA template, 1 μL of primers, 5 μL of 2×M5 HiPer plusTaq HiFi PCR mix, and 2.5 μL of ddH2O.
[0055] The PCR reaction program was as follows: pre-denaturation at 94 °C for 3 min; 35 cycles (94 °C, 30 s; 55–60 °C, 30 s; 72 °C, 2 min); extension at 72 °C for 10 min; and storage at 4 °C.
[0056] SSR molecular markers in F 3:4 Performance in some groups, such as glucographs Figure 4 , Figure 5 As shown.
[0057] As can be seen, after molecular markers SSR-46 and SSR-47 were subjected to polyacrylamide gel electrophoresis, the presence of resistance to Fusarium oxysporum rot QTLs could be determined by the position of the bands in the population. A band of approximately 105 bp (containing resistance to Fusarium oxysporum rot QTLs) was denoted as A, and bands of approximately 100 bp and 110 bp (not containing resistance to Fusarium oxysporum rot QTLs) were denoted as B. SSR-46 containing both 105 bp and 100 bp bands was denoted as H, and SSR-47 containing both 105 bp and 110 bp bands was denoted as H.
[0058] Results verified that the DSI (Disease Severity Index) of the disease-resistant homozygous plant (A) was significantly lower than that of the disease-susceptible homozygous plant (B) and heterozygous plant (H), with an accuracy rate of over 90%.
[0059] Using part of F 3:4 The accuracy of population-based detection of molecular markers SSR-46 and SSR-47 was assessed by calculating the disease index (DSI) for each population, including those with and without disease-resistant QTLs. 3:4 The population with DSI containing disease-resistant QTLs was larger than that without disease-resistant QTLs, and the overall population showed resistance to Fusarium wilt, demonstrating the high accuracy of SSR markers.
[0060] Example 2: Chain Strength Verification This embodiment verifies the linkage strength of SSR-46 and SSR-47 obtained in Example 1, and the results are as follows: Figure 6 As shown.
[0061] according to Figure 6 It can be seen that SSR-46 and SSR-47 are tightly linked, indicating that they are highly stable as SSR molecular markers for maize resistance to Fusarium wilt. The linkage of other molecular markers is significantly lower.
[0062] Example 3: Application in Assisted Breeding This technology was used to improve the susceptible maize inbred line Liao 50518 using molecular markers. The inbred line Liao 3012, which carries the SSR molecular marker disease resistance allele, was crossed with the susceptible inbred line Liao 50518 to obtain the F1 generation. The F1 generation was obtained by backcrossing Liao 50518 to obtain the first backcross generation (BC1F1). The method of this invention was used to test 200 F2 plants, and 30 plants carrying two SSR molecular marker disease resistance alleles were selected. These plants were backcrossed again to obtain the BC2F1 generation. After inoculation with Fusarium verticillatum in the field, the proportion of disease-resistant plants reached 90%, which was significantly higher than that of the randomly selected population.
[0063] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.
Claims
1. An SSR molecular marker for maize resistance to Fusarium wilt, characterized in that, This includes two molecular markers closely linked to disease resistance or disease susceptibility QTLs, namely SSR-46 and SSR-47; SSR-46 is located at the bases between 156959134bp and 156959149bp on chromosome 3 of the maize reference gene sequence AGPv5, while SSR-47 is located at the bases between 156959170bp and 156959184bp on chromosome 3 of the maize reference gene sequence AGPv5.
2. The SSR molecular marker for maize resistance to Fusarium wilt according to claim 1, characterized in that, The corn variety mentioned is B73.
3. The application of the SSR molecular marker as described in claim 1 or 2 in detecting maize genotypes resistant to Fusarium wilt or in maize breeding.
4. A method for detecting the genotype of maize resistant to Fusarium verticillatum ear rot, characterized in that, In the genome of a maize sample, the two SSR molecular markers as described in claim 1 or 2 are amplified. When at least one of the amplified bands of the two SSR molecular markers is 105 bp, the maize sample is determined to have a disease-resistant genotype for Fusarium wilt.
5. The method for detecting the genotype of maize resistant to Fusarium wilt according to claim 4, characterized in that, When the amplified band of SSR-46 is 100bp and the amplified band of SSR-47 is 110bp, the maize sample is determined to have a susceptible genotype for Fusarium ear rot.
6. The method for detecting the genotype of maize resistant to Fusarium wilt according to claim 4, characterized in that, It also includes the following steps: S1. Obtain the total DNA of the leaf genome of the corn sample as a DNA template; S2. The DNA template was amplified by PCR using a primer set; S3. Perform electrophoresis on the amplification products to determine the genotypes of SSR-46 and SSR-47, and make a judgment.
7. The method for detecting the genotype of maize resistant to Fusarium wilt according to claim 6, characterized in that, The primer set used to amplify SSR-46 includes a first forward primer as shown in sequence SEQ ID NO.1 and a first reverse primer as shown in sequence SEQ ID NO.
2.
8. The method for detecting the genotype of maize resistant to Fusarium wilt according to claim 6, characterized in that, The primer set used to amplify SSR-47 includes a second forward primer as shown in sequence SEQ ID NO.3 and a second reverse primer as shown in sequence SEQ ID NO.
4.
9. A method for molecular marker-assisted breeding of maize resistant to Fusarium wilt, characterized in that, Includes the following steps: S1. Select maize plants whose genome contains the SSR molecular marker disease resistance allele as described in claim 1 or 2 as parents; S2. Cross the parent plants with the maize plants to be improved to obtain offspring plants; S3. The offspring plants are genotyped using the detection method described in any one of claims 4-8, and plants with disease-resistant genotypes are screened to complete the breeding selection.