Neuroprotective effect of DIRAS1 on Alzheimer's disease

Abstract

The invention provides a neuroprotective effect of DIRAS1 on Alzheimer's disease (AD), and belongs to the technical field of biological medicine. The invention provides application of a reagent for overexpressing a DIRAS1 gene in preparation of a medicine for preventing and / or treating AD by taking the DIRAS1 gene as a therapeutic target of AD. The treatment of a model mouse in the embodiment finds that the DIRAS1 gene is over-expressed in the brain of the AD mouse, and the cognitive function detection finds that the recognition memory, the working memory and the long-term spatial learning memory of the AD mouse can be remarkably improved; morphological and molecular biological detection finds that deposition of A beta and excessive phosphorylation of Tau protein are reduced, and Golgi staining and western blot detection finds that damage to a synaptic structure is reduced and expression of synaptic related protein is increased. Therefore, the cognitive function, pathological characteristics and synaptic plasticity of AD mice can be improved by a method of overexpressing the DIRAS1 gene.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically involving DIRAS1 Neuroprotective effects against Alzheimer's disease. Background Technology

[0002] Alzheimer's disease (AD) is a serious neurodegenerative disease that severely impacts the health of older adults. Its main clinical manifestations include progressive decline in learning and memory abilities, culminating in severe dementia in later stages. With the accelerating pace and extent of population aging, the prevalence and total number of AD patients will continue to increase, causing immense suffering for patients and placing a heavy burden on families, society, and the nation. In recent years, significant progress has been made in AD treatment targeting amyloid β-protein (Aβ), particularly with the market launch of lecanemab and FDA approval of donanemab for the treatment of early-stage symptomatic AD since 2023. However, the pathogenesis of AD remains unclear, and existing treatments are primarily used for patients with mild cognitive impairment (MCI) and mild dementia, and are relatively expensive. Therefore, in-depth exploration of new pathogenesis mechanisms of AD and the identification of effective therapeutic targets are of significant scientific and clinical value.

[0003] RAS-associated cell growth inhibitory factor 1 (RAS-associated cell growth inhibitory factor 1) DIRAS1 ) is a unique subfamily member of RAS GTPase. DIRAS1 Primarily expressed in the brain and heart, currently... DIRAS1 There is not much research on this topic, mainly focusing on oncology and neurology. Although there is already... DIRAS1 Studies related to neurological diseases have not yet been conducted. DIRAS1 Studies on its role and mechanisms in the course of Alzheimer's disease. Summary of the Invention

[0004] This invention provides DIRAS1 The neuroprotective effect against Alzheimer's disease, as described DIRAS1 It has a neuroprotective effect on AD and can be used as a target for AD treatment.

[0005] This invention provides an overexpression DIRAS1 The application of gene-based reagents in the preparation of drugs for the prevention and / or treatment of Alzheimer's disease.

[0006] In a preferred embodiment of the present invention, the overexpression DIRAS1 Genes including those overexpressed in the brain DIRAS1 Gene.

[0007] In a preferred embodiment of the present invention, the overexpression DIRAS1 Gene reagents include DIRAS1 Overexpression of adeno-associated virus.

[0008] In a preferred embodiment of the present invention, the... DIRAS1 Overexpression of adeno-associated virus contains a neuron-specific promoter.

[0009] This invention also provides a medicament for the prevention and / or treatment of Alzheimer's disease, wherein the active ingredient includes overexpression DIRAS1 Gene reagents.

[0010] In a preferred embodiment of the present invention, the overexpression DIRAS1 Gene reagents include DIRAS1 Overexpression of adeno-associated virus.

[0011] In a preferred embodiment of the present invention, the... DIRAS1 Overexpression of adeno-associated virus contains a neuron-specific promoter.

[0012] In a preferred embodiment of the present invention, the dosage form of the drug includes an injection.

[0013] In a preferred embodiment of the present invention, the injection contains... DIRAS1 The titer of adeno-associated virus overexpression was 1.7 × 10⁻⁶. 12 vg / ml.

[0014] This invention also provides a method for constructing a DIRAS1 overexpressing adeno-associated virus, comprising the following steps: ligating a target gene with a linearized plasmid to form a shuttle plasmid; the nucleotide sequence of the target gene is shown in SEQ ID No. 5; Cells were transformed using a plasmid system containing the shuttle plasmid to construct the... DIRAS1 Overexpression of adeno-associated virus.

[0015] The present invention also provides a method for constructing a product using the above-described construction method. DIRAS1 Overexpression of adeno-associated virus.

[0016] Beneficial effects: This invention uses DIRAS1 Genes have been found to be overexpressed as therapeutic targets for Alzheimer's disease. DIRAS1 This gene has a neuroprotective effect in Alzheimer's disease (AD). This invention, through in vivo experiments in mice, found that overexpression of this gene... DIRAS1 This gene can improve cognitive function in AD mice, delay the development of pathological features, and alleviate synaptic plasticity damage, providing new insights into the pathogenesis of AD and a theoretical basis for developing new treatment strategies. In in vivo experiments, this invention used stereotactic injection to overexpress the gene in the CA1 region of the hippocampus of 10-month-old AD mice. DIRAS1Adeno-associated virus (AAV) was administered to AD mice. Four weeks later, cognitive ability, pathological features, synaptic structures, and protein expression levels were examined in the AD mice. DIRAS1 Overexpression significantly improved cognitive memory, working memory, and long-term spatial learning memory in AD mice, reduced Aβ deposition and Tau protein hyperphosphorylation, alleviated synaptic structural damage, and increased the expression of synapse-related proteins. This invention is the first to discover... DIRAS1 It has a neuroprotective effect on AD, and it has also been found that... DIRAS1 This is a new therapeutic target for AD. Attached Figure Description

[0017] Figure 1 for DIRAS1 Figure showing the results of decreased expression in AD patients, 3xTg-AD mice, and Aβ-treated AD cell models. In the figure, A represents the hippocampus of healthy controls and AD patients in the GSE29378 database. DIRAS1 mRNA levels; n=16~17, P <0.05; B: mRNA expression level in hippocampal tissues of WT and 3xTg-AD mice; C: Raw bands of DIRAS1 protein expression level in hippocampal tissues of WT and 3xTg-AD mice; D: Raw bands of DIRAS1 protein expression level in Aβ-treated AD cell models; E: Statistical graph of DIRAS1 protein expression level in hippocampal tissues of WT and 3xTg-AD mice; F: Statistical graph of DIRAS1 protein expression level in Aβ-treated AD cell models; BF, n=4~6, P <0.05, P <0.001; Figure 2 Hippocampal specific DIRAS1 Figure 1 shows the construction and validation results of the 3xTg-AD overexpression mouse model. Figure A: Schematic diagram of adeno-associated virus (AAV) stereotactic injection into the brain, targeting the CA1 region of the mouse hippocampus; Figure B: Fluorescence microscopy observation 4 weeks after viral injection shows that the GFP signal (green) is specifically localized in hippocampal neurons (scale bar: 250 µm); Figure C: Original bands of DIRAS1 protein expression levels in the hippocampus of the four groups of mice, validated by Western blot; Figure D: Statistical graph of DIRAS1 protein expression levels in the hippocampus of the four groups of mice (n=4). P <0.01, P <0.001; Figure 3 for DIRAS1The results of overexpression improving object recognition memory and working memory impairment in 3xTg-AD mice are shown in the figure. Figure A: Bar chart of recognition index statistics for the four groups of mice in the object recognition experiment; B: Bar chart of spontaneous alternation accuracy statistics for the four groups of mice in the Y-maze experiment; C: Bar chart of total number of arm advances in the Y-maze; n=9. P <0.05, P <0.001; Figure 4 for DIRAS1 The figure shows the results of overexpression improving spatial learning and memory impairment in 3xTg-AD mice. Figure A: Line graph showing the change in escape latency during the Morris water maze navigation experiment over 5 consecutive days (n=9). P <0.05, P <0.001: AD-Vec vs WT+Vec; # P <0.05, ## P <0.05, ### P <0.05: AD-OE vs AD-Vec); B: Bar chart showing the number of times mice crossed the platform after platform removal; C: Bar chart showing the percentage of time mice spent in the target quadrant during spatial exploration; D: Bar chart showing the time mice took to reach the platform during the visible platform experiment; E: Line graph showing the swimming speed of mice during the 6-day experiment; F: Original swimming trajectory of mice in the spatial exploration experiment, with large circles representing the water maze, small circles representing the escape platform, and red curves representing the trajectory; n=9. P <0.05, P <0.01, P <0.001; Figure 5 for DIRAS1 The results of overexpression significantly reduced Aβ plaque deposition and decreased Aβ oligomer levels in the hippocampus of 3xTg-AD mice. Figure A: Immunofluorescence staining, 6E10 antibody-labeled Aβ plaques (red), DAPI-labeled cell nuclei (blue), scale bar: 100 μm; B: Statistical bar chart of the percentage of immunopositive Aβ plaque area; C: Original bands of Aβ protein expression levels in mouse hippocampus detected by D54D2 antibody; D: Statistical bar chart of quantitative analysis of Aβ protein detected by D54D2 antibody; n=4. P <0.01, P <0.001; Figure 6The figure shows the results of DIRAS1 overexpression inhibiting abnormal phosphorylation of Tau protein in the hippocampus of 3xTg-AD mice. Figure A: Immunofluorescence images of p-Tau protein in the hippocampus of each group of mice; red represents p-Tau protein bound to Tau (Thr231) antibody, and blue represents cell nuclei bound to DAPI; scale bar is 50 µm. Figures BC: Statistical bar charts of the percentage of p-Tau protein-positive area and the number of positive cells. Figure D: Raw bands of phosphorylated Tau protein at different sites and total Tau protein expression in the hippocampus of each group of mice detected by Western blot. Figures EG: Statistical bar charts of Tau protein expression at different sites of Thr217 and Thr231 and the total Tau protein Tau5 expression. n=4. P <0.05, P <0.01, P <0.001; Figure 7 The image shows the results of DIRAS1 overexpression improving the morphology and expression levels of synaptic-related proteins in the hippocampus of 3xTg-AD mice. Figure A: Golgi staining reveals the morphology of hippocampal neuron dendrites; first row scale bar: 500 μm, second row scale bar: 50 μm, third row scale bar: 10 μm; B: Dendritic spine density histogram; C: Sholl analysis showing the number of intersections of four groups of dendritic branches at different distances from the cell body, n=4. P <0.05, P <0.01: AD-Vec vs WT+Vec; # P <0.05: AD-OE vs AD-Vec; D: Original morphological images of CA1 dendritic spines in the hippocampus of four groups of mice, scale bar: 10μm; E: Original bands of expression levels of synaptic-associated proteins PSD-95 and SYN in the hippocampus of each group of mice detected by Western blot; FG: Statistical bar chart of quantitative analysis of synaptic-associated proteins PSD-95 and SYN; n=4-5 P <0.05, P <0.01. Detailed Implementation

[0018] This invention provides an overexpression DIRAS1 The application of gene-based reagents in the preparation of drugs for the prevention and / or treatment of Alzheimer's disease.

[0019] This invention is based on DIRAS1 Genes serve as therapeutic targets for Alzheimer's disease (AD), when the aforementioned DIRAS1 When the gene originates from a human source, the gene ID is 148252; when it originates from a mouse source, the gene ID is 208666. In the embodiments of this invention, mice are used as a model for research, therefore mouse-derived genes are selected for experiments. However, the purpose of this invention is subsequent clinical treatment and translation, so the scope of protection of this invention should not be limited to mouse model-related content, but should also include corresponding drugs derived from human genes.

[0020] In this embodiment of the invention, it was found that in AD patients DIRAS1 Decreased expression levels in the hippocampus of APPswe / PS1M146V / TauP301L triple transgenic AD model (3xTg-AD) mice DIRAS1 The expression level was also significantly reduced; 10-month-old 3xTg-AD mice were selected, and DIRAS1-overexpressing adeno-associated virus was injected into the CA1 region of the hippocampus of the mice using stereotaxic techniques, 2 µL per side, with a titer of 1.7 × 10⁻⁶. 12 vg / ml. Four weeks later, object recognition, Y-maze, and water maze tests were performed to assess the cognitive behavior of the mice. After the behavioral experiments, mouse brain tissue was collected, frozen sections were stained with immunofluorescence, and pathological features were detected. Fresh hippocampal tissue was collected from mice, proteins were extracted, and protein expression levels were detected. Fresh brain tissue was collected from mice, and dendritic morphology was examined using Golgi staining. Results showed overexpression. DIRAS1 Subsequently, the cognitive, working, and spatial learning memory abilities of AD mice were significantly improved; the hyperphosphorylation of Aβ plaques and Tau protein in the brains of AD mice was significantly reduced; and the synaptic structural damage and decreased expression of synaptic-related proteins in AD mice were significantly alleviated. Therefore, overexpression of DIRAS1 can exert a neuroprotective effect on AD, delay the development of pathological features in the brains of AD mice, and improve their cognitive and synaptic plasticity impairment.

[0021] The overexpression described in this invention DIRAS1 Gene reagents include DIRAS1 Overexpression of adeno-associated virus, and the DIRAS1 Overexpression of adeno-associated virus contains a neuron-specific promoter. This invention describes... DIRAS1 A method for constructing an adeno-associated virus (AAV) overexpression includes the following steps: ligating a target gene with a linearized plasmid to form a shuttle plasmid; the nucleotide sequence of the target gene is shown in SEQ ID No. 5; transforming cells using a plasmid system containing the shuttle plasmid to construct the desired AAV overexpression. DIRAS1 Overexpression of adeno-associated virus.

[0022] This invention also provides a medicament for the prevention and / or treatment of Alzheimer's disease, wherein the active ingredient includes overexpression DIRAS1 Gene reagents.

[0023] The overexpression described in this invention DIRAS1 Gene reagents include DIRAS1 Overexpression of adeno-associated virus, the DIRAS1 Overexpression of adeno-associated virus contains a neuron-specific promoter.

[0024] The drug of the present invention includes an injection, wherein the titer of the DIRAS1-overexpressing adeno-associated virus in the injection is 1.7 × 10⁻⁶. 12 vg / ml.

[0025] The present invention also provides DIRAS1 A method for constructing an overexpressing adeno-associated virus includes the following steps: ligating a target gene with a linearized plasmid to form a shuttle plasmid; the nucleotide sequence of the target gene is shown in SEQ ID No. 5; Cells were transformed using a plasmid system containing the shuttle plasmid to construct the... DIRAS1 Overexpression of adeno-associated virus.

[0026] This invention uses the pHBAAV-hsyn-MCS-T2A-ZsGreen vector as the basic vector, which was purchased from Hanbio Biotechnology in the examples, catalog number HH20240207SXLXB-AAV01. The basic vector was linearized by KpnI digestion, and the target gene shown in SEQ ID No. 5 was ligated to the linearized vector fragment. SEQ ID No. 5: .

[0027] In this embodiment of the invention, the target gene is obtained by PCR amplification. In one embodiment, cDNA is used as a template, and primer pairs AAV-M-Diras1-F and AAV-M-Diras1-R are used for amplification. The amplification system, in 50 μL, includes: 25 μL of 2×PCR Buffer, 1 μL of dNTPs mix (10 mM each), 2 μL each of 10 μM forward and reverse primers, 1 μL of 200 ng / μL template DNA, 18 μL of ddH2O, and 1 μL of phanta Super-Fidelity DNA Polymerase (Vazyme, P505-D1). The PCR reaction program includes: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55~72℃ annealing for 30 s, 72℃ extension for 30~60 s / kb, 27-35 cycles; 72℃ complete extension for 10 min; and storage at 12℃.

[0028] AAV-M-Diras1-F (SEQ ID No. 6): CTGAGAGCGCAGTCGAGAAGGTACCGCCACCATGCCAGAACAGAGCAA; AAV-M-Diras1-R (SEQ ID No. 7): CCTTGTAGTCACTTAAGCTTGGTACCGACATGAGCGCGCACTTGCCCTTG.

[0029] Utilizing HB infusion TM A one-step cloning ligation system (Hanbio Biotechnology, catalog number: HB-infusion-20T) was used to ligate the target fragment and the linearized vector. The ligation system, in 20 μL, included the following components: at least 100 ng of the target gene fragment, at least 50 ng of the linearized vector, 10 μL of 2×HB infusion™ Master mix, and the remainder ddH2O. The ligation reaction solution was incubated at 50°C for 30 min, then placed on ice for 5 min, and immediately transformed into DH5α. After verifying positive clones using bacterial PCR and sequencing, plasmid extraction was performed using a plasmid extraction kit (Plasmid DNApurification, purchased from MACHEY-NAGEL, catalog number: 740412).

[0030] The virus packaging process was performed using a three-plasmid adeno-associated virus (AAV) system. Specifically, the positive plasmid was used as the shuttle plasmid, and with the assistance of the pAAV-RC and pHelper vector plasmids, Hanheng's Lipofiter was employed. TM The three plasmids were co-transfected into AAV-293 cells using the transfection reagent, and the cell pellet was collected 72 h after transfection.

[0031] The present invention also provides a method for constructing a product using the above-described construction method. DIRAS1 Overexpression of adeno-associated virus.

[0032] The invention constructed DIRAS1 The adeno-associated virus overexpression was sterile, free from mycoplasma infection, and the viral titer was 1.7 × 10⁻⁶. 12 vg / ml.

[0033] To further illustrate the present invention, the following description, in conjunction with embodiments, explains the features provided by the present invention. DIRAS1 The neuroprotective effects on Alzheimer's disease are described in detail, but they should not be construed as limiting the scope of protection of this invention.

[0034] In this embodiment of the invention, DIRAS1The overexpressing adeno-associated virus was constructed and ordered from Shanghai Hanheng Biotechnology Co., Ltd., and tested to be sterile and free of mycoplasma infection, with a viral titer of 1.7 × 10⁻⁶. 12 vg / ml. RT-qPCR reagents were purchased from Beijing Polymer Biotechnology Co., Ltd., and primers were synthesized by Invitrogen (primer sequences are shown in Table 1). 6E10 antibody was purchased from Biolegend (USA), and Tau231 antibody was purchased from Abcam (UK).

[0035] Table 1 Primer Sequences

[0036] In this embodiment of the invention, the triple-transgenic AD model mouse (3xTg-AD) was established in 2003. It contains three gene mutations: PS1M146V, APPSwe, and tauP301L. It is the first AD animal model that can show two pathological features, senile plaques and neurofibrillary tangles, in the AD-related brain regions. The construction method is detailed in the literature (Salvatore Oddo, Antonella Caccamo, Jason D. Shepherd, M. Paul Murphy, ToddE. Golde, Rakez Kayed, Raju Metherate, Mark P. Mattson, Yama Akbari, and Frank M. LaFerla, Triple-Transgenic Model of Alzheimer's Disease with Plaquesand Tangles: Intracellular Aβ and Synaptic Dysfunction, Neuron, Vol. 39, 409–421, July 31, 2003).

[0037] Example 1 1. qRT-PCR and Western blot experiments The GSE29378 dataset was downloaded from the AlzData database and analyzed. Fresh mouse hippocampal tissue was collected, RNA was extracted, and reverse transcribed into cDNA. The cDNA was then used as a template for real-time quantitative PCR amplification. Separately, fresh mouse hippocampal tissue was used to extract proteins, and protein expression levels were detected by Western blot.

[0038] The results are as follows Figure 1As shown, DIRAS1 expression was decreased in AD patients, 3xTg-AD mice, and AD cell models treated with Aβ (β-amyloid, Aβ1-42, a synthetic polypeptide of Qiangyao Biotech, human). Analysis of the GSE29378 dataset in the AlzData database revealed decreased DIRAS1 mRNA levels in the hippocampus of AD patients. Figure 1 (A). A similar decrease in mRNA was observed in the hippocampus of 3xTg-AD mice. Figure 1 (B). Furthermore, Western blot analysis showed that DIRAS1 expression was decreased in both 3xTg-AD mice and Aβ-treated AD cell models. Figure 1 (CF in Chinese). Hint DIRAS1 It plays an important role in the occurrence and development of AD and has significant research value and translational potential.

[0039] 2. Stereotactic injection of the brain After anesthetizing 3xTg-AD mice and control WT mice, the mice were fixed in a stereotaxic instrument. The hair on their heads was shaved, and the skin was incised to expose the skull. The injection site in the CA1 region was confirmed using a stereotaxic atlas, and a microsyringe was used to administer the injection. DIRAS1 Overexpressing or controlling adeno-associated virus was injected into the target area, the skin was sutured, and antibiotics were applied. The experimental mice were divided into four groups: WT+ empty vector virus group (WT-Vec), WT+DIRAS1 overexpression group (WT-OE), 3xTg-AD+ empty vector virus group (AD-Vec), and 3xTg-AD+DIRAS1 overexpression group (AD-OE).

[0040] The results of the construction and validation of the hippocampus-specific DIRAS1 overexpression 3xTg-AD mouse model are as follows: Figure 2 As shown, fluorescence microscopy observation 4 weeks after viral injection revealed that GFP signal (green) was specifically localized in hippocampal neurons. Figure 2 (B), and Western blot analysis confirmed successful DIRAS1 overexpression. Figure 2 Medium CD).

[0041] 3. Behavioral experiments Object recognition experiment: divided into a familiarization period and a testing period. During the familiarization period, two identical objects were placed in an open area, allowing mice to explore freely for 10 minutes. After a 6-hour rest period, the testing period was conducted. One object was replaced with a new object of the same material but different color and shape. The mouse was then placed back in the same location and allowed to explore freely for 10 minutes. A camera above recorded the time the mouse spent exploring the new and old objects and calculated the recognition index. The results are as follows: Figure 3 As shown in Figure A, DIRAS1 overexpression significantly improved the object recognition and memory ability of 3xTg-AD mice.

[0042] Y-maze spontaneous alternation experiment: Mice were placed at the junction of the three arms and allowed to explore freely for 8 minutes. The total number of times the mouse entered an arm and the order in which it entered each arm were recorded. The accuracy rate of spontaneous alternation was calculated. The results are as follows: Figure 3 As shown in BC, DIRAS1 overexpression significantly improved working memory in 3xTg-AD mice.

[0043] Morris Water Maze: First, a navigational orientation experiment was conducted for 5 days, 4 times per day, recording the time it took for mice to find the underwater platform, their swimming speed, and trajectory. Next, a spatial exploration experiment was performed. On day 6, the underwater platform was removed, and the swimming time, trajectory, and number of platform crossings in each quadrant were recorded within 60 seconds. The percentage of time spent swimming in the target quadrant was calculated, and the daily swimming speed was recorded during this period. Finally, a visual platform experiment was conducted, recording the time it took for mice to reach the platform, eliminating differences in visual acuity and motor ability. Results are as follows: Figure 4 As shown in AC, DIRAS1 overexpression significantly improved long-term spatial learning and memory ability in 3xTg-AD mice, and the effect of DIRAS1 overexpression on spatial learning and memory ability in mice was not due to differences in vision and motor ability. Figure 4 DE).

[0044] 4. Immunofluorescence and Western blot experiments After freezing and sectioning mouse brain tissue, immunostaining blocking solution, target primary antibody (6E10 antibody or Tau231 antibody), fluorescent secondary antibody, and DAPI-containing anti-fluorescence quencher were added sequentially. After mounting, the expression of the target protein was analyzed under a fluorescence microscope.

[0045] The results are as follows Figure 5 The results showed that DIRAS1 overexpression significantly reduced Aβ plaque deposition and Aβ oligomer protein expression levels in the hippocampus of 3xTg-AD mice; Figure 6 The DIRAS1 overexpression shown inhibits abnormal phosphorylation of Tau protein in the hippocampus of 3xTg-AD mice.

[0046] 5. Golgi staining and Western blot experiment After removing blood from the brains of mice in each group, the treated tissue was completely immersed in Golgi staining solution and stained at room temperature in the dark for approximately two weeks. Following staining, the tissue was cut into 100 μm thick slices using a cryostat. The slices were transferred to gelatin-coated slides and then subjected to a gradient dehydration process in 50%, 75%, and 95% ethanol, followed by clearing in xylene. After mounting with mounting media, images were acquired using a 3DHISTECH scanner. The complexity of dendrites and the number of dendritic spines were analyzed using ImageJ software (Sholl). Furthermore, Western blot analysis was performed to detect the levels of synaptic-related proteins in the mouse hippocampus.

[0047] The results are as follows Figure 7 As shown, DIRAS1 overexpression can increase the density of dendritic spines and the complexity of dendritic branching in the hippocampus of 3xTg-AD mice. Figure 7 AD), can increase the expression of the synapse-associated protein PSD-95 ( Figure 7 (Zhong EG).

[0048] In summary, DIRAS1 overexpression significantly improved cognitive memory, working memory, and long-term spatial learning memory in AD mice, reduced Aβ deposition and Tau protein hyperphosphorylation, and alleviated hippocampal synaptic plasticity impairment in AD mice.

[0049] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An overexpression DIRAS1 The application of gene-based reagents in the preparation of drugs for the prevention and / or treatment of Alzheimer's disease.

2. The application according to claim 1, characterized in that, The overexpression DIRAS1 Genes including those overexpressed in the brain DIRAS1 Gene.

3. The application according to claim 1 or 2, characterized in that, The overexpression DIRAS1 Gene reagents include overexpression of the described DIRAS1 Adeno-associated virus (AAV) genes.

4. A drug for the prevention and / or treatment of Alzheimer's disease, characterized in that, Active ingredients include overexpression DIRAS1 Gene reagents.

5. The drug according to claim 4, characterized in that, The overexpression DIRAS1 Gene reagents include DIRAS1 Overexpression of adeno-associated virus.

6. The application according to claim 5, characterized in that, The DIRAS1 Overexpression of adeno-associated virus contains a neuron-specific promoter.

7. The drug according to claim 4, characterized in that, The dosage form of the drug includes injections.

8. The drug according to claim 7, characterized in that, The injectable drug DIRAS1 The titer of adeno-associated virus overexpression was 1.7 × 10⁻⁶. 12 vg / ml.

9. A kind DIRAS1 A method for constructing an overexpressing adeno-associated virus, characterized in that, Includes the following steps: The target gene is ligated to a linearized plasmid to form a shuttle plasmid; the nucleotide sequence of the target gene is shown in SEQ ID No. 5; Cells were transformed using a plasmid system containing the shuttle plasmid to construct the... DIRAS1 Overexpression of adeno-associated virus.

10. The method described in claim 9 that yields the following product DIRAS1 Overexpression of adeno-associated virus.

Images