Small molecule compound A1 with good treatment effect on metabolism-related fatty liver disease

Abstract

The invention provides a small molecule compound A1 which has a good treatment effect on metabolism-related fatty liver diseases. The structural formula of the hydroxyl pyrene compound A1 is shown in the specification. The invention further provides a medicine for preventing and / or treating the metabolism-related fatty liver disease and application of the compound in vivo and in vitro. In-vivo and in-vitro experiments prove that A1 has a remarkable treatment effect on metabolism-related fatty liver diseases. Liver fatty degeneration can be improved, and a definite reversing effect on hepatic fibrosis is achieved. Meanwhile, the compound A1 has better safety, and provides an effective means for preventing and treating the metabolism-related fatty liver diseases.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of medicine, and provides a small molecule compound A1 prepared by a chemical synthesis method, derived from traditional Chinese medicine and capable of effectively improving metabolic-related fatty liver disease. BACKGROUND

[0002] Metabolic dysfunction-associated fatty liver disease (MAFLD) is a liver disease closely related to insulin resistance and metabolic dysfunction, and its core feature is excessive fat accumulation in the liver (hepatic steatosis). The severe form of MAFLD, metabolic dysfunction-associated steatohepatitis (MASH), mainly involves liver damage and can develop into fibrosis and cirrhosis, and even hepatocellular carcinoma. MAFLD is one of the common chronic liver diseases, affecting about 3 / 10 of the world's population, and has become a major public health problem; it is estimated that the incidence of MAFLD will further increase by 2030 and cause more serious public health problems.

[0003] The occurrence and development of MAFLD are complex and heterogeneous, and the pathogenesis has not been fully elucidated so far. The pathological mechanism involves lipid processing, oxidative stress and mitochondrial dysfunction. The main cause of MAFLD is the toxic effect of excessive fat accumulation, which triggers oxidative stress damage to hepatocytes. In addition to cirrhosis and liver cancer, MAFLD significantly increases the incidence of various extrahepatic complications, such as type 2 diabetes, chronic cardiovascular disease, chronic kidney disease and some extrahepatic malignancies. Clinically, the treatment of non-alcoholic fatty liver disease mainly focuses on changes in lifestyle such as diet and exercise, as well as drug therapy.

[0004] Although less than 10% of MAFLD patients have end-stage liver disease complications such as cirrhosis or hepatocellular carcinoma, due to the high prevalence of MAFLD, the absolute number of patients with end-stage liver disease is considerable, and the disease burden of MAFLD is increasing. Despite the great clinical treatment needs of MAFLD, no drugs specifically treating MAFLD have been approved by the drug evaluation agency in China. Pioglitazone and vitamin E are recommended drugs for MAFLD confirmed by biopsy, but their clinical application still has obvious limitations: long-term use of vitamin E may increase the risk of hemorrhagic stroke and prostate cancer, and pioglitazone has adverse reactions such as weight gain. This treatment gap is mainly due to the complex pathogenesis of MAFLD and the strict requirements for efficacy evaluation, that is, the drug not only needs to improve liver steatosis, but also needs to have a reversing effect on liver fibrosis. Currently, multiple targeted drugs including farnesol X receptor agonists, PPAR (Peroxisome proliferator-activated receptors) dual agonists, etc. are in the phase III clinical trial stage, but they still cannot fully meet the clinical needs. This situation highlights the urgency of developing new safe and effective treatment options and provides an important opportunity for the development of new drugs.

[0005] The development and application of drugs for treating MAFLD currently face multiple challenges: first, most of the currently researched drugs can only improve some pathological characteristics (such as simply reducing liver fat), but it is difficult to reverse the disease process comprehensively. For example, the approved Resmetirom can only improve steatosis, and has limited effect on fibrosis; second, drug safety issues are prominent, such as farnesol X receptor agonists may cause itching, thyroid hormone receptor agonists may have cardiovascular risks, and natural compounds generally have the defect of low bioavailability; in addition, clinical trial design faces difficulties such as slow disease progression, long-term observation needs, and invasive liver biopsy, resulting in high research and development costs; finally, long-term drug use may lead to drug resistance, and although multi-target combination therapy has broad prospects, it faces complex problems such as drug interactions, dose optimization, and safety stacking. These factors together result in a significantly lower success rate of MAFLD / MASH drug development than in other fields, and there is an urgent need to develop small molecule compounds with higher efficacy, more comprehensive anti-MAFLD effects, and more economical preparation costs. SUMMARY

[0006] The present application finds a hydroxyl pyrene small molecule compound A1 with good effect of improving metabolic-related fatty liver disease.

[0007] The first object of the present application is to provide a hydroxyl pyrene compound A1, the structural formula of which is .

[0008] A second object of the present application is to provide a medicament for preventing and / or treating metabolic associated fatty liver disease, which comprises the aforementioned hydroxyl pyrene compound A1 or a pharmaceutically acceptable salt thereof as an effective ingredient.

[0009] Further, the medicament further comprises a pharmaceutically acceptable excipient.

[0010] A third object of the present application is to provide the use of the aforementioned hydroxyl pyrene compound A1 in the preparation of an agent for reducing intracellular triglyceride levels and / or reducing intracellular lipid deposition.

[0011] A fourth object of the present application is to provide the use of the aforementioned hydroxyl pyrene compound A1 in the preparation of a medicament for preventing and / or treating metabolic associated fatty liver disease.

[0012] Further, the prevention and / or treatment of metabolic associated fatty liver disease comprises at least one of the following: improving liver enzyme profile, improving liver damage and fibrosis, improving hepatocyte steatosis.

[0013] The improvement of liver enzyme profile is to reduce glutamic-pyruvic transaminase and / or glutamic-oxaloacetic transaminase; The improvement of liver damage and fibrosis is to improve liver fibrosis degeneration; The hepatocyte steatosis is to reduce intracellular triglyceride, reduce intracellular lipid deposition, improve liver vacuolar degeneration, and improve liver morphology.

[0014] The technical scheme of the present application has the following beneficial effects: The present application provides a hydroxyl pyrene compound A1 which can effectively prevent and / or treat metabolic associated fatty liver disease. In vivo and in vitro experiments have confirmed that A1 has a significant therapeutic effect on MAFLD. Not only can it improve liver steatosis, but also has a clear reversing effect on liver fibrosis. At the same time, the compound A1 has good safety, providing an effective means for the prevention and treatment of metabolic associated fatty liver disease. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 The synthesis route of compound A1 is shown in the figure.

[0016] Figure 2 After stimulating AML-12 cells with 1 mmol / L FFA (Free Fatty Acid mixture, FFA) solution for 24 h, the intracellular triglyceride content was detected after stimulating the cells with compound A1 for 24 h.

[0017] Figure 3 After stimulating AML-12 cells with 1 mmol / L FFA solution for 24 h, the oil red O staining results after stimulating the cells with compound A1 for 24 h.

[0018] Figure 4 Nile red staining results of AML-12 cells after 24 h stimulation with 1 mmol / L FFA solution and 24 h stimulation with Compound A1.

[0019] Figure 5 Representative pictures of mouse liver at the end of the animal experiment.

[0020] Figure 6 Changes of serum triglyceride (A) and glutamic-pyruvic transaminase (B) levels of mice at the end of the animal experiment.

[0021] Figure 7 Representative pictures of H&E staining of paraffin sections of mouse liver at the end of the animal experiment.

[0022] Figure 8 Representative pictures of oil red O staining of frozen sections of mouse liver at the end of the animal experiment (A) and statistical chart of relative staining intensity (B).

[0023] Figure 9 Representative pictures of Sirius red staining of paraffin sections of mouse liver at the end of the animal experiment (A) and statistical chart of normalized protein expression (B).

[0024] Figure 10 Representative pictures of immunohistochemical staining of α-SMA (α-smooth muscle actin) of paraffin sections of mouse liver at the end of the animal experiment (A) and statistical chart of relative α-SMA expression (B).

[0025] Figure 11 Effects of Compound A1 on the levels of genes related to fat decomposition (A) and fibrosis (B, C) in mouse liver at the end of the animal experiment detected by RT-qPCR experiment.

[0026] Figure 12 Histopathological analysis results of heart, kidney and spleen. DETAILED DESCRIPTION

[0027] The present application will be further explained in conjunction with the following examples, but the examples do not limit the present application in any form.

[0028] Example 1 Chemical synthesis method of Compound A1 BBr3(12 mL, 12 mmol) was added to a solution of 8-methoxypyrene (430 mg, 2 mmol) in DCM (dichloromethane, DCM). After the reaction was confirmed to be completed by TLC (Thin-Layer Chromatography, TLC) analysis, 2 M NaOH (Sodium Hydroxide, NaOH) was added to adjust the pH to 7~8, and then extracted with ethyl acetate. The organic layer was washed with brine and dried over anhydrous Na2SO4(Sodium Sulfate, Na2SO4) overnight, filtered, and the filtrate was concentrated to obtain 8-hydroxypyrene (372 mg, yield 78%) as a white solid. 1 H-NMR (500 MHz, CDCl3) delta 7.79 (1H, d, J = 9.6 Hz), 7.70 (1H, d, J = 2.3 Hz), 7.26 (1H, s), 6.80 (1H, d, J = 2.3 Hz), 6.36 (1H, d, J = 9.6 Hz), 6.08 (1H, s). J 7.79 (1H, d, J = 9.6 Hz), 7.70 (1H, d, J = 2.3 Hz), 7.26 (1H, s), 6.80 (1H, d, J = 2.3 Hz), 6.36 (1H, d, J = 9.6 Hz), 6.08 (1H, s). J 7.79 (1H, d, J = 9.6 Hz), 7.70 (1H, d, J = 2.3 Hz), 7.26 (1H, s), 6.80 (1H, d, J = 2.3 Hz), 6.36 (1H, d, J = 9.6 Hz), 6.08 (1H, s). J 7.79 (1H, d, J = 9.6 Hz), 7.70 (1H, d, J = 2.3 Hz), 7.26 (1H, s), 6.80 (1H, d, J = 2.3 Hz), 6.36 (1H, d, J = 9.6 Hz), 6.08 (1H, s). J 7.79 (1H, d, J = 9.6 Hz), 7.70 (1H, d, J = 2.3 Hz), 7.26 (1H, s), 6.80 (1H, d, J = 2.3 Hz), 6.36 (1H, d, J = 9.6 Hz), 6.08 (1H, s). Compound 8-hydroxypyrene (200 mg, 1 mmol) was dissolved in THF, PPh3(128 mg, 1.5 mmol), DIAD (Tetrahydrofuran, THF) (343 mg, 1.5 mmol) was added, and then ethanolamine (150 mg, 1.5 mmol) was added, and the reaction was allowed to proceed overnight. After the reaction was completed by LC-MS (Liquid Chromatography-Mass Spectrometry, LC-MS) detection, it was concentrated under reduced pressure, extracted with ethyl acetate, dried over anhydrous sodium sulfate, and then concentrated to remove the solvent to obtain a crude product, which was purified by column chromatography (PE:EA = 6:1) to obtain white product A1 (137 mg, yield 60%). 1 H NMR (500 MHz, MeOD) delta 8.08 (d, J = 9.6 Hz, 1H), 7.93 (d, J = 2.3 Hz, 1H), 7.68 (s, 1H), 7.02 (d, J = 2.3 Hz, 1H), 6.43 (d, J = 9.6 Hz, 1H), 4.65 (t, J = 5.0 Hz, 2H), 3.48 (t, J = 5.0 Hz, 2H). J 8.08 (d, J = 9.6 Hz, 1H), 7.93 (d, J = 2.3 Hz, 1H), 7.68 (s, 1H), 7.02 (d, J = 2.3 Hz, 1H), 6.43 (d, J = 9.6 Hz, 1H), 4.65 (t, J = 5.0 Hz, 2H), 3.48 (t, J = 5.0 Hz, 2H). J 8.08 (d, J = 9.6 Hz, 1H), 7.93 (d, J = 2.3 Hz, 1H), 7.68 (s, 1H), 7.02 (d, J = 2.3 Hz, 1H), 6.43 (d, J = 9.6 Hz, 1H), 4.65 (t, J = 5.0 Hz, 2H), 3.48 (t, J = 5.0 Hz, 2H). J 8.08 (d, J = 9.6 Hz, 1H), 7.93 (d, J = 2.3 Hz, 1H), 7.68 (s, 1H), 7.02 (d, J = 2.3 Hz, 1H), 6.43 (d, J = 9.6 Hz, 1H), 4.65 (t, J = 5.0 Hz, 2H), 3.48 (t, J = 5.0 Hz, 2H). J 8.08 (d, J = 9.6 Hz, 1H), 7.93 (d, J = 2.3 Hz, 1H), 7.68 (s, 1H), 7.02 (d, J = 2.3 Hz, 1H), 6.43 (d, J = 9.6 Hz, 1H), 4.65 (t, J = 5.0 Hz, 2H), 3.48 (t, J = 5.0 Hz, 2H). J 8.08 (d, J = 9.6 Hz, 1H), 7.93 (d, J = 2.3 Hz, 1H), 7.68 (s, 1H), 7.02 (d, J = 2.3 Hz, 1H), 6.43 (d, J = 9.6 Hz, 1H), 4.65 (t, J = 5.0 Hz, 2H), 3.48 (t, J = 5.0 Hz, 2H). J= 5.0 Hz, 2H).(As Figure 1 as shown).

[0029] Example 2 In vitro lipid-lowering effect study of compound A1 1. Experimental materials (1) Experimental drugs Compound A1.

[0030] (2) Experimental reagents Fetal bovine serum (KGL3002-50, KeyGEN BioTECH, Jiangsu, China), DMEM / F12 medium (KGL1601-500, KeyGEN BioTECH, Jiangsu, China), trypsin (KGL2102-100, KeyGEN BioTECH, Jiangsu, China), BCA kit (KGB2101-5000, KeyGEN BioTECH, Jiangsu, China), triglyceride kit (A110-1-1, Njicbio, Jiangsu, China), bovine serum albumin (BSA) (9048-46-8, Aladdin), sodium oleate (O7501, Sigma-Aldrich, Shanghai, China), sodium palmitate (P9767, Sigma-Aldrich, Shanghai, China), oil red (O104972, Aladdin, Shanghai, China), Nile red (HY-D0718, Medchemexpress, Shanghai, China), anti-fluorescence quenching mounting medium (containing DAPI) (HY-K1047, Medchemexpress, Shanghai, China).

[0031] (3) Experimental instruments Cell operation and culture equipment: clean bench (SW-CJ-2F, Suzhou, China), constant temperature incubator (BPN-50CH, Shanghai, China), CO2 cell incubator (Heracell 150i, Thermo, USA).

[0032] Detection and observation equipment: microplate reader (Infinite 200 Pro, Tecan, Switzerland), upright fluorescence microscope (Axio Imager A2, Zeiss, Germany), upright optical microscope (BX53, Olympus, Japan).

[0033] (4) Experimental cell lines Normal mouse hepatocytes AML-12 cells.

[0034] 2. Experimental Methods (1) Cell culture conditions AML-12 cells were passaged and cultured in DMEM / F12 medium containing penicillin (final concentration 100 U / mL), streptomycin (final concentration 100 μg / mL), and 10% fetal bovine serum (FBS). When the cells reached 90% confluence, the old medium was discarded, and the cells were washed twice with 2 mL PBS. After discarding the PBS, 2 mL of 0.25% trypsin-0.02% EDTA digestion solution was added, and the cells were digested in an incubator for 3 min. The cells were observed under a microscope, and when they became rounded, 2 mL of complete medium was quickly added to stop the digestion. The cells were gently pipetted and collected. The cells were centrifuged at 1100 rpm, 4℃, for 5 min, the supernatant was discarded, and the cells were resuspended in complete medium, cultured in separate flasks, and the medium was changed every other day.

[0035] (2) Establishment of MAFLD cell model Preparation of the free fatty acid mixture: Weigh 1 g BSA and dissolve it in 2.5 mL PBS, then sonicate. Weigh 20.5 mg sodium oleate (SO) and 9.3 mg sodium palmitate (SP) and dissolve them in 7.5 mL PBS, sonicate at 70°C for 20 min, and add the dissolved BSA mixture while still hot to prepare a 10 mmol / L FFA-BSA mixture. When using, draw 5 mL with a syringe, filter, and add to 40 mL of DMEM / F12 medium, then add 5 mL of FBS.

[0036] AML-12 cells were collected and evenly inoculated in 96-well plates or 6-well plates, and after the cells adhered, one column was used as a blank group, one column was used as a model group, and one column was used as a drug administration group. The culture medium of the model group and the drug administration group was replaced with a culture medium containing 1 mmol / L FFA. After 24 hours, it was observed that the triglyceride was significantly up-regulated (P<0.05 compared with the control group), and oil red O staining could clearly observe the formation of lipid droplets in the cells, indicating that the modeling was successful. After replacing with fresh complete culture medium, the A1 compound was given for treatment, and the final concentration was 10 μM.

[0037] (3) Intracellular triglyceride content determination RIPA lysis solution was prepared (phosphatase inhibitor was added at a ratio of 1:100, and protease inhibitor was added at a ratio of 1:1000), and the prepared lysis solution was added at a content of 20 μL per well. After standing on ice for 15 min, centrifugation was performed. BCA working solution (A solution: B solution = 50:1) was prepared, and 200 μL per well was added. After centrifugation, 20 μL of the upper clear liquid was added to the working solution. Incubation at 37°C for 30 min, and the absorbance was measured at a wavelength of 562 nm. 20 μL of RIPA lysis solution was added per well, and after standing on ice for 15 min, centrifugation was performed. 250 μL of working solution was added per well. After centrifugation, 2.5 μL of the upper clear liquid was added to the working solution. Incubation at 37°C for 10 min, and the absorbance was measured at a wavelength of 500 nm. According to the protein standard curve and the absorbance, the protein content was calculated. Triglyceride content = (A 样本 -A 空白 ) / (A 标准 -A 空白 )*C 标准 (sample concentration) / Cpr (protein concentration).

[0038] In this experiment, mean ± SD was used to represent the data (n=6 biological replicates), and the statistical difference marking rules were as follows: the asterisk (*) indicates the significance level of the difference between the control group / drug administration group and the model group: ** P<0.01. The results show that compound A1 can effectively reduce the intracellular triglyceride level Figure 2

[0039] (4) Oil red O staining ​Oil red O dye preparation: Take about 0.7 g of oil red powder, grind it thoroughly in a mortar, take 0.5 g of it and dissolve in 100 mL of isopropyl alcohol to prepare a stock solution (store in the dark). Mix the oil red O stock solution and dd water in a ratio of 3:2, filter, and prepare the oil red O working solution (prepare fresh before use). Take out the cells, discard the culture medium, wash with PBS three times, fix with 4% paraformaldehyde for 10 min, immerse in oil red O for 15 min, rinse with 60% isopropyl alcohol, and wash with dd water three times; immerse in hematoxylin dye solution for 40 s, rinse with tap water three times, and observe under a microscope.

[0040] The results show that compound A1 can effectively reduce lipid deposition in cells Figure 3 ).

[0041] (5) Nile red staining Prepare a suitable amount of Nile red with DMSO to prepare a 1 mM stock solution, dilute it with PBS to prepare a Nile red working solution at a ratio of 1:1000. Prepare cell slides. Take out the cells, discard the culture medium, wash with PBS three times, fix with 4% paraformaldehyde for 10 min, add 1 mL of Nile red working solution to each well and incubate in the dark for 10 min, then discard the working solution and wash with PBS. Take out the cell slides, add 10 μL of DAPI dye containing blocking agent to mount the slides.

[0042] The results show that compound A1 can effectively reduce lipid deposition in cells Figure 4 ).

[0043] Example 3 In vivo lipid-lowering effect of compound A1 1. Experimental materials (1) Experimental drugs Compound A1, positive drug benzbromar.

[0044] (2) Experimental reagents General feed (protein, 21.5%; lipid, 11.1%; carbohydrate, 67.4%; 1010001 NC, Jiangsu Xietong, China), high cholesterol high-fat feed (protein, 14%; lipid, 42%; carbohydrate, 42%; cholesterol, 2%; XT310, Jiangsu Xietong, China), alanine aminotransferase test kit (C009-2-1, Njjcbio, Nanjing, China); triglyceride kit (A110-1-1, Njjcbio, Nanjing, China), anhydrous ethanol (100092683, Sinoreagent, Shanghai, China), xylene (1330-20-7, Shlfhx, Shanghai, China), hematoxylin staining solution (BA4041, Baso, Guangdong, China), eosin dye (BA4099, Baso, Guangdong, China), differentiation fluid (DH0085, Leagene, Beijing, China), neutral gum (100092683, 10004160, Shanghai, China), oil red O dye (O104972, Aladdin, Shanghai, China), isopropyl alcohol (40064360, Sinoreagent, Shanghai, China), Sirius red staining solution (G1018, Servivebio, Jiangsu, China), a-SMA antibody (67735, Proteintech, Wuhan, China), HiScript III RT SuperMix for qPCR kit (R323, Vazyme, Nanjing, China), ChamQ Universal SYBR qPCR Master Mix (R101, Vazyme, Nanjing, China), immunohistochemical kit (PV-9000, ZSGB-BIO, Beijing, China).

[0045] (3) Experimental instruments Upright fluorescence microscope (IX73, Olympus, Japan), microplate reader (Infinite 200 Pro, Tecan, Switzerland), dehydrator (TP1020, Leica, Germany), paraffin embedding machine (EG1150, Leica, Germany), pathology slide machine (RM2235, Leica, Germany), RT-qPCR instrument (QuantStudio 5, Thermo, USA), upright optical microscope (BX53, Olympus, Japan).

[0046] (4) Laboratory animals C57BL / 6J mice, 6 weeks old, weighing 18-22 g, provided by Vital River, animal qualification certificate number: 20231124Abzz0600000664, were housed in an environment of 22 ± 2℃ with free access to food and water.

[0047] Experimental methods Establishment of MAFLD animal model After a week of acclimatization, a one-month dietary induction program was initiated for both the model group and the drug-treated group. Their basal diet was gradually replaced with a high-cholesterol, high-fat diet using a gradient replacement method (completed within one week). After two months of continuous feeding, blood samples were collected via the fundus venous plexus, and serum triglyceride concentrations were measured using a specific kit. Based on the successful modeling criteria (i.e., serum triglyceride levels in the model animals must be significantly higher than those in the normal control group), qualified individuals were selected, and further randomized block designs were implemented based on the lipid measurement results to ensure baseline lipid levels were balanced across experimental groups.

[0048] Experimental Groups Control group: Normal feed was given, and equal amounts of solvents (10% DMSO, 40% PEG300, 5% Tween 80, 45% physiological saline) were administered by gavage every two days for 8 consecutive weeks (n=9).

[0049] Model group: fed a high-cholesterol, high-fat diet and gavaged with an equal amount of solvent (10% DMSO, 40% PEG300, 5% Tween 80, 45% physiological saline) every two days for 8 consecutive weeks (n=9).

[0050] Positive drug group: fed a high-cholesterol, high-fat diet and administered bezafibrate (20 mg / kg) by gavage every two days for 8 consecutive weeks (n=9).

[0051] Low-dose group: fed a high-cholesterol, high-fat diet and administered A1 (5 mg / kg) by gavage every two days for 8 consecutive weeks (n=9).

[0052] Medium dose group: high cholesterol high fat diet, intragastric administration of A1 (10 mg / kg), twice a day, for 8 weeks (n=9).

[0053] High dose group: high cholesterol high fat diet, intragastric administration of A1 (20 mg / kg), twice a day, for 8 weeks (n=9).

[0054] Liver observation at the end of the animal experiment At the end of the experiment, after the mice were taken blood from the plexus ophthalmic vein and euthanized, the complete liver was quickly dissected. After the tissue was perfused and washed with pre-cooled physiological saline and dried with filter paper, it was photographed and observed for gross morphology.

[0055] The representative pictures of the liver at the end of the animal experiment show that compound A1 can effectively improve the morphological changes of the liver caused by high cholesterol high fat diet Figure 5 ).

[0056] Measurement of serum biochemical indicators At the end of the experiment, the supernatant was obtained by centrifugation, and the triglyceride and alanine aminotransferase levels in the serum were detected using the corresponding reagent kit of Nanjing Jiancheng.

[0057] In this experiment, the data were represented by mean ± SD (n=9 biological replicates), and the statistical difference marking rules were as follows: the asterisk (*) indicates the significance level of the difference between the control group / dose group and the model group: **** P<0.0001, *** P<0.001, ** P<0.01. The serum biochemical indicators show that compound A1 can effectively improve the increase of serum triglyceride and alanine aminotransferase caused by high cholesterol high fat diet Figure 6 ).

[0058] H&E staining The prepared liver tissue paraffin sections were placed in an electrically heated constant temperature drying oven and baked at 60°C for 3 hours; the dried paraffin sections were subjected to conventional xylene dewaxing, descending gradient ethanol hydration, and distilled water washing; the nuclei were stained with hematoxylin for 2 min, differentiated with hydrochloric acid alcohol for a few seconds, and washed with water to return blue; the sections were stained with eosin solution for 1 min, and the residual staining solution was washed off with water; the sections were dehydrated and dried with gradient alcohol, transparent with xylene, and sealed with neutral gum; a upright optical microscope was used to take pictures at 630x magnification.

[0059] The H&E staining results show that compound A1 can effectively improve the vacuolar degeneration of the liver caused by high cholesterol high fat diet Figure 7 ).

[0060] Oil red O staining After the prepared frozen sections were washed in 60% isopropanol for 5 min, they were placed in freshly prepared oil red O staining solution and stained in the dark for 10 min, differentiated with 60% isopropanol for 1 min, washed with distilled water for 2 min, placed in hematoxylin staining solution and stained for 2 min, washed with distilled water for 2 times, mounted with glycerol gelatin, and photographed under 630x magnification using an upright optical microscope.

[0061] In the experiment, mean ± SD was used to represent the data (n = 3 biological replicates), and the statistical difference marking rules were as follows: the asterisk (*) indicated the significance level of the difference between the control / drug group and the model group: **** P < 0.0001, *** P < 0.001, ** P < 0.01. The oil red O staining results showed that compound A1 could effectively improve the liver lipid deposition caused by high cholesterol and high-fat diet Figure 8 ).

[0062] Sirius red staining The prepared liver tissue paraffin sections were placed in an electrically heated constant temperature drying oven and baked at 60°C for 3 hours; the dried paraffin sections were subjected to conventional xylene dewaxing, descending gradient ethanol hydration, and distilled water washing; the sections were stained in saturated sirius red staining solution for 8 min; anhydrous alcohol was rinsed for several minutes, and after baking in a 60°C oven and transparentizing in xylene for 5 min, neutral gum was used for mounting. An upright optical microscope was used to take photographs at 400x magnification.

[0063] In the experiment, mean ± SD was used to represent the data (n = 3 biological replicates), and the statistical difference marking rules were as follows: the asterisk (*) indicated the significance level of the difference between the control / drug group and the model group: **** P < 0.0001. The sirius red staining results showed that compound A1 could effectively improve the fibrosis caused by high cholesterol and high-fat diet Figure 9 ).

[0064] α-SMA immunohistochemistry The prepared liver tissue paraffin sections were placed in an electric heating constant temperature drying oven, baked at 60°C for 3 hours; the dried paraffin sections were subjected to conventional xylene dewaxing, descending gradient ethanol hydration, distilled water washing; 0.2% Trion X100 covering for 10 min; PBS washing for 3 times, 5 min each time; using hydrogen peroxide solution to block endogenous peroxidase activity, 10 min, PBS washing for 3 times, 5 min each time, serum blocking, 30 min, avoiding light during blocking. Primary antibody was incubated at 4°C overnight, PBS washing for 3 times, 5 min each time; secondary antibody was incubated for 10 min, PBS washing for 3 times, 5 min each time; DAB coloration for 10 s, hematoxylin staining for 2 min, after ending, tap water flushing, section color reverse blue; 0.1% hydrochloric acid ethanol differentiation for 10-15 s, immersion in tap water to terminate differentiation; dehydrated in gradient according to the sequence of previous dehydration step, neutral balsam mounting. Using upright optical microscope, photographing under 630x magnification.

[0065] In this experiment, the data were represented by mean ± SD (n=3 biological replicates), and the statistical difference marking rules were as follows: the asterisk (*) indicated the significance level of the difference between the control / drug group and the model group: ** P<0.01, * P<0.05. The results of α-SMA immunohistochemistry showed that compound A1 could effectively improve the fibrosis degeneration caused by high cholesterol high-fat diet Figure 10 ).

[0066] RT-qPCR experiment Three mice in each group were randomly selected, about 50 mg of frozen liver tissue was cut, and the total RNA of the tissue was separated by TRIZOL reagent (Vazyme). 1 μg of total RNA was used as a template for reverse transcription by RT kit (Vazyme), and qPCR experiment was performed by qPCR SYBR Kit (Vazyme). According to the 2 -ΔΔCt value, the relative mRNA level was calculated, compared with the respective control sample, and the β-actin mRNA level was normalized.

[0067] The primer sequences used in qPCR analysis are as follows (company: Jin Sui, China): β-actin, Forward: GTGACGTTGACATCCGTAAAGA (SEQ ID NO. 1), Reverse: GCCGGACTCATCGTACTCC (SEQ ID NO. 2); PPARa, Forward: TATTCGGCTGAAGCTGGTGTAC (SEQ ID NO. 3), Reverse: CTGGCATTTGTTCCGGTTCT (SEQ ID NO. 4); COL3A1, Forward: ACGTAAGCACTGGTGGACAG (SEQ ID NO. 5), Reverse: CCGGCTGGAAAGAAGTCTGA (SEQ ID NO. 6); CTGF, Forward: TGACCCCTGCGACCCACA (SEQ ID NO. 7), Reverse: TACACCGACCCACCGAAGACACAG (SEQ ID NO. 8).

[0068] The data in the experiment are represented by mean ± SD (n = 3 biological replicates), and the statistical difference marking rules are as follows: the asterisk (*) indicates the significance level of the difference between the control / drug administration group and the model group: **** P < 0.0001, *** P < 0.001, ** P < 0.01. The RT-qPCR results show that compound A1 can effectively improve the increase in the expression of CTGF and COL3A1 genes caused by high cholesterol and high-fat diet, and slow down the decrease in the expression of PPARa gene caused by high cholesterol and high-fat diet Figure 11 ).

[0069] Histopathological analysis The prepared paraffin sections of heart, kidney and spleen tissues were placed in an electrically heated constant temperature drying oven and baked at 60°C for 3 hours; the dried paraffin sections were subjected to conventional xylene dewaxing, gradient ethanol hydration and distilled water washing; the nuclei were stained with hematoxylin for 2 min, differentiated with hydrochloric acid ethanol for a few seconds and washed with water to return blue; the sections were stained with eosin solution for 1 min, washed with water to remove residual staining solution; the sections were dehydrated and dried with gradient alcohol, transparentized with xylene and sealed with neutral gum; a right optical microscope was used to take photos at 630x magnification.

[0070] Histological examination of the heart, kidney and spleen and other important organs showed that the morphology of the heart, kidney and spleen of the A1 administration group animals did not appear obvious pathological damage, which indicates that A1 does not have obvious toxic effect on important organs and has good safety Figure 12 ).

[0071] The above merely describes the preferred embodiments of the present application, and it should be pointed out that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered as falling within the protection scope of the present application.

Claims

1. A hydroxypyrene compound A1 characterized in that, The hydroxyl pyrene compound A1 has the structural formula .

2. A medicament for preventing and / or treating metabolic-related fatty liver disease, characterized by, The drug comprises the hydroxyl pyrene compound A1 or a pharmaceutically acceptable salt thereof as an effective ingredient.

3. The medicament according to claim 2, characterized in that, The drug further comprises a pharmaceutically acceptable excipient.

4. Use of the hydroxyl pyrene compound A1 in claim 1 in the preparation of a reagent for reducing intracellular triglyceride level and / or reducing intracellular lipid deposition.

5. Use of the hydroxyl pyrene compound A1 in claim 1 in the preparation of a drug for preventing and / or treating metabolic-related fatty liver disease.

6. Use according to claim 5, characterized in that, The prevention and / or treatment of metabolic-related fatty liver disease comprises at least one of the following: improving liver enzyme spectrum, improving liver damage and fibrosis, improving hepatocyte steatosis.

7. Use according to claim 6, characterized in that, The improvement of liver enzyme spectrum is to reduce glutamic-pyruvic transaminase and / or glutamic-oxaloacetic transaminase; the improvement of liver damage and fibrosis is to improve liver fibrosis degeneration; the hepatocyte steatosis is to reduce intracellular triglyceride, reduce intracellular lipid deposition, improve liver vacuolar degeneration, and improve liver morphology.

Images