Nano antibody Nb116 for resisting salmonella enteritidis as well as application and preparation method of nano antibody Nb116

Abstract

The invention relates to the technical field of molecular biology, in particular to an anti-salmonella enteritidis nano antibody Nb116 as well as application and a preparation method thereof, and discloses a nucleotide sequence and an amino acid sequence of the anti-salmonella enteritidis nano antibody Nb116. Meanwhile, the invention relates to application of the anti-salmonella enteritidis nano antibody Nb116 in preparation of a product for reducing adhesion and invasion of salmonella enteritidis to IPEC-J2 cells, and a preparation method of the anti-salmonella enteritidis nano antibody Nb116. According to the anti-salmonella enteritidis nano antibody provided by the technical scheme, the adhesion and invasion of salmonella enteritidis to IPEC-J2 cells can be reduced.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, and particularly relates to a nanobody Nb116 against Salmonella enteritidis, and application and preparation method thereof. BACKGROUND

[0002] Salmonella is a Gram-negative short rod of Enterobacteriaceae, is a global important zoonotic pathogen, often parasitizes in the intestinal tract of human and poultry, is one of the primary causes of bacterial food poisoning, and accounts for about 42.6%-60% of such poisoning events. There are more than 2000 known serotypes, among which Salmonella enteritidis is the most prevalent, has strong invasiveness, and mainly contaminates meat, eggs, poultry and aquatic products. In the United States and Japan, food poisoning caused by Salmonella accounts for nearly 80%, and in China, Salmonella enteritidis is also the main epidemic serotype in large-scale chicken farms, which can cause the decline of chicken production performance, and pollutes the environment, water sources and crops through feces, and is transmitted to humans through the food supply chain. After human infection, symptoms such as gastroenteritis, diarrhea and fever often occur, and the risk is higher in infants, the elderly and immunocompromised individuals, which can cause serious complications such as sepsis, heart failure and even death. According to the WHO estimate, about 1.35 million people worldwide are infected each year, and the bacteria have been listed in the “Bacterial Priority Pathogen List” as high priority. Good production operation and HACCP management system can reduce pollution, and the development of rapid and sensitive detection methods and new prevention strategies are crucial to ensure food safety, public health and the healthy development of livestock and poultry farming.

[0003] Nanobody (Nb) is also called single-domain heavy-chain antibody (Variable domain of heavy-chain antibody, VHH), which is derived from camelids and cartilaginous fish, and was first discovered in camel blood by Belgian scientist Hamers R. Unlike traditional antibodies composed of two heavy chains and two light chains, this new type of antibody naturally lacks light chains and heavy chain constant region 1 (CH1), and its core functional structure is only a single heavy chain variable region, which is the smallest known antibody molecule that can bind to antigens.

[0004] The molecular weight of a nanobody is only 12-15 kDa, about 1 / 10 of that of a traditional monoclonal antibody or polyclonal antibody, and the volume is small (about 2x2x4 nm in size), and this unique structure gives it many advantages. Compared with traditional antibodies, nanobodies have significant performance advantages: first, they have high stability and good water solubility, and better environmental adaptability than traditional antibodies; second, their complementarity determining region 3 (CDR3 region) is longer, and the CDRs region has no complementary relationship with other domains of itself, has stronger flexibility and convexity, and can effectively penetrate the cracks and gaps on the surface of the antigen, overcome steric hindrance, and achieve efficient and specific recognition of complex structures of bacteria or macromolecular proteins and other antigens, with better antigen binding specificity and affinity; third, they can be synthesized and expressed in large quantities in microbial systems, laying a foundation for low-cost and efficient large-scale production. As a new type of antibody molecule optimized and developed through molecular biology techniques, nanobodies also have the characteristics of easy expression and the ability to recognize hidden epitopes, and have broad application prospects in the fields of pathogen diagnosis and anti-infection treatment, and have become one of the hot directions in the fields of biomedical research and biotechnology development.

[0005] Although the importance of nanobodies in biomedical research is increasingly prominent, the current manufacturing method still has the problems of slowness, high cost and unreliability. Most nanobodies are derived from camel immunization, and the preparation process is long and expensive, and animal-derived antibodies often cannot bind to conserved epitopes due to self-antigen immune tolerance, and conserved epitopes are crucial for protein-protein recognition and other key functions, so it is of great significance to quickly identify nanobodies targeting these sites. Previous studies have tried to combine phage display and synthetic libraries to identify nanobodies, but synthetic libraries need to rely on expensive commercial suppliers, and it is difficult to identify nanobodies that can specifically recognize defined conformations (which is an important application direction of animal-derived nanobodies), and although phage display can separate high-affinity binders, it still has challenges in identifying functional clones (such as conformation-selective nanobodies). In view of these problems, we applied a synthetic yeast display nanobody library, which was designed based on the alignment of known nanobodies in the Protein Data Bank (PDB). SUMMARY

[0006] The purpose of the present application is to provide a nanobody Nb116 against Salmonella enterica and its application and preparation method, which can effectively solve the problems in the background art.

[0007] To solve the above technical problems, the following technical solutions are adopted in the present application:

[0008] A nanobody Nb116 against Salmonella enterica, the nucleotide sequence of the nanobody is shown in SEQ ID NO. 1.

[0009] SEQ ID NO. 1 is as follows:

[0010] CAGGTTCAACTACAGGAGTCAGGCGGGGGGCTCGTACAAGCCGGTGGAAGCTTACGGCTTTCTTGTGCTGCATCCGGCTCTATATCTCTGCATCCGCAGATGGGTTGGTATAGGCAAGCGCCGGGAAAAGAACGCGAACTTGTGGCAGGTATCGCTACGGGAGGTAATACCAATTACGCCGATT CTGTAAAGGGTCGTTTCACAATTTCGCGAGACAATGCAAAAAACACTGTCTATCTGCAGATGAACAGCTTGAAGCCTGAGGATACAGCGGTTTACTACTGCGCCGTTAATGAGTATCATCCTAGGGCTATGTATGCGCTTTATATTATTGGGGGCAAGGCACCCAGGTCACAGTCAGTAGTTAA

[0011] A nanobody Nb116 for combating Salmonella enteritidis, the amino acid sequence of which is shown in SEQ ID NO.2.

[0012] SEQ ID NO.2 is as follows:

[0013] Gln Val Gln Leu Glu Ser Gly Gly Gly Val Gln Ala Gly Gly Ser Leu ArgLeu Ser Cys Ala Ala Ser Gly Ser Ile Ser Leu His Pro Gln Met Gly Trp Tyr ArgAla Pro Gly Lys Glu Arg Glu Leu Val Ala Gly Ile Ala Thr Gly Gly Asn Thr TyrAla Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr ValTyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala ValAsn Glu His Pro Arg Ala Met Tyr Ala Leu Tyr Ile Trp Gly Gln Gly Thr Gln ValThr Val Ser Ser

[0014] The aforementioned nanobody Nb116, which targets Salmonella enteritidis, specifically the fim type I fimbriae.

[0015] Meanwhile, this invention also relates to the application of the anti-Salmonella enteritidis nanobody Nb116 in the preparation of products that reduce the adhesion and invasion of IPEC-J2 cells by Salmonella enteritidis.

[0016] The preparation method of the above-mentioned anti-Salmonella enteritidis nanobody Nb116 includes the following steps:

[0017] Step S1: Compare and screen in a yeast-displaying nanobody library to determine the nucleotide and amino acid sequences of the anti-Salmonella enteritidis fim type I fimbrial nanobody, wherein the nucleotide sequence is shown in SEQ ID NO.1 and the amino acid sequence is shown in SEQ ID NO.2;

[0018] Step S2: Predict the signal peptide of the target gene determined in step S1, remove the signal peptide coding sequence of the target gene itself, optimize the codons of the target gene according to the codon preference of the Pichia pastoris expression system, and then artificially synthesize the optimized target gene and clone it into the expression vector to construct the target vector.

[0019] Step S3: Linearize the target vector to obtain a linearized vector. After purifying and recovering the linearized vector, electroporate it into Pichia pastoris competent cells and culture it to obtain Pichia pastoris transformants.

[0020] Step S4: Positive screening, expression trials, and expression identification were performed on the Pichia pastoris transformants to obtain expression transformants; the expression transformants were then cultured on a large scale, the culture products were collected, and the protein was purified to obtain the anti-Salmonella enteritidis nanobody Nb116.

[0021] The anti-Salmonella nanobody Nb116 provided in the above technical solution can reduce the adhesion and invasion of Salmonella enterica to IPEC-J2 cells. Compared with the control group, the adhesion rate of Salmonella enterica in the 50 μg / mL nanobody treatment group was significantly reduced, and the adhesion rate in the 100 μg / mL nanobody treatment group was extremely significantly reduced. The invasion rate of Salmonella enterica in the 50 μg / mL nanobody treatment group was lower than that in the control group, and the invasion rate in the 100 μg / mL treatment group was significantly reduced. Attached Figure Description

[0022] Figure 1 Example 1 shows the colony PCR results detected by agarose gel electrophoresis;

[0023] Figure 2 The expression of the target protein was detected by Coomassie brilliant blue staining in Example 1;

[0024] Figure 3 The Western blot analysis of the target protein expression in Example 1;

[0025] Figure 4 The purification results of the nanobody protein in Example 1;

[0026] Figure 5 The results of the test on the adhesion rate of IPEC-J2 intestinal epithelial cells in the Salmonella enteritidis and nanobody treatment group in Example 2 are shown.

[0027] Figure 6 The results of the test on the invasion rate of IPEC-J2 intestinal epithelial cells by the Salmonella enteritidis and nanobody treatment group in Example 3 are shown. Detailed Implementation

[0028] To make the objectives and advantages of this invention clearer, the invention will be specifically described below with reference to embodiments. It should be understood that the following text is merely used to describe one or more specific embodiments of the invention and does not strictly limit the scope of protection specifically claimed by the invention.

[0029] Example 1: Cloning and expression of anti-Salmonella enteritidis nanobodies

[0030] 1) Screening of anti-Salmonella enteritidis nanobody sequences

[0031] The nucleotide sequence (SEQ ID NO.1) and amino acid sequence (SEQ ID NO.2) of the anti-Salmonella enteritidis fim type I fim nanobody were determined by comparison and screening in a yeast display nanobody library.

[0032] 2) Construction of expression carrier

[0033] The target gene signal peptide was predicted using SignalP 4.0 and 5.1, and the signal peptide sequence was removed. Codon optimization was performed based on the Pichia pastoris expression system to avoid the SacI restriction site. The gene was synthesized into pPICZαA, with the target gene immediately adjacent to the vector α-factor and a 6×His terminus at the C-terminus.

[0034] 3) Plasmid electroporation of Pichia pastoris

[0035] Linearization of the target vector: Prepare the vector digestion system according to the following steps: plasmid (5-10 μg), 10×buffer 5 μL, SacI 1 μL, ddH2O to make up to 50 μL; digest overnight at 37℃; detect by agarose gel electrophoresis, with undigested plasmid as a control; after successful digestion, inactivate at 65℃ for 20 min.

[0036] Linearized vector purification and recovery: Prepare the vector purification system according to the following steps: 50 μL of enzyme digestion product, 10 μL of nucleic acid precipitation aid, 6 μL of 3 M NaAc pH=5.2, and 165 μL of anhydrous ethanol; incubate at -20℃ for at least 35 min; centrifuge at 12000 rpm at 4℃ for 15 min, discard the supernatant, at which point a white precipitate can be observed on the wall; resuspend the precipitate in 400 μL of pre-cooled 80% ethanol; centrifuge at 12000 rpm at 4℃ for 10 min, discard the supernatant, open the cap and dry; add 10 μL of ddH2O to dissolve the precipitate.

[0037] Preparation of yeast electrocompetent cells: Add 5 mL of YPD to a 50 mL centrifuge tube, inoculate with strain X-33, and incubate overnight at 30°C; transfer 50 μL of bacterial culture to a 250 mL Erlenmeyer flask containing 50 mL of YPD, and incubate overnight until OD600 = 1.3-1.5; centrifuge at 4°C and 4000 rpm for 5 min, resuspend in 10 mL buffer A (20 mL YPD + 2 mL 2 M HEPES pH=8.0, filtered and sterilized + 0.5 mL 1 M DTT filtered and sterilized), incubate in a 30°C water bath for 15 min, add pre-chilled sterile water to 50 mL; centrifuge at 4°C and 4000 rpm for 5 min, resuspend in 50 mL pre-chilled sterile water (containing 0.3 mL 2 M HEPES, pH=8.0); centrifuge at 4°C and 4000 rpm for 5 min, resuspend in 4 mL pre-chilled 1 M sorbitol; centrifuge at 4°C and 4000 rpm for 5 min, resuspend in 100 mL of sorbitol. Resuspend the bacterial culture in pre-chilled 1 M sorbitol (at which point the bacterial culture will be viscous), dispense 80 μL / tube, and place on ice.

[0038] Electroporation of yeast with linearized vector: Take 80 μL of competent cells, add 6 μg of linearized pPicZαA-GJS1, mix well, and transfer to a pre-chilled 0.2 cm electroporation cuvette; place on ice for 5 min; electroporate according to the yeast electroporation parameters (1.5 kV, 25 μF, 200 Ω); immediately add 2 mL of pre-chilled 1 M sorbitol + HEPES (10 mL 1 M sorbitol + 100 μL 2 M HEPES, pH=8.0), and transfer to a 2 mL sterile centrifuge tube; incubate at 30℃ for 1-2 h; dilute 5-fold, 10-fold, and 100-fold respectively, and spread 300 μL / plate on a 15 cm YPD plate containing 100 mg / L Zeocin, and culture at 30℃ until clones grow.

[0039] 4) Transformer screening

[0040] To determine whether the obtained transformants correctly inserted the target gene, eight transformants were randomly selected from the plates and stored on their respective plates for colony PCR. After PCR, 2 μL of each transformant was aspirated for agarose gel electrophoresis. The results showed that all eight clones contained the target gene band (364 bp). Figure 1 Preliminary assessment indicated that the target gene had been integrated into the yeast chromosome. Subsequently, the PCR product was sequenced, and the sequencing results showed that the target gene was correctly inserted into the yeast chromosome, and therefore could be used for downstream expression.

[0041] 5) Small-scale expression and identification of transformants

[0042] Use the 7 clones preserved in step 4) for expression trials. Prepare 7 50 mL Erlenmeyer flasks, add 5 mL of YPG medium to each, inoculate each with the verified clones, and incubate at 30℃ and 220 rpm for 1-2 days until saturation. Transfer to 50 mL centrifuge tubes, centrifuge at 4000 rpm for 5 min, and discard the supernatant. Resuspend the cells in 5 mL of BMMY medium, transfer to a new sterile 50 mL Erlenmeyer flask, add methanol to a final concentration of 0.75%, and incubate at 28℃ and 220 rpm for 6 days. Add methanol (final concentration 0.75%) every 24 h. On the morning of day 6, collect the bacterial culture, centrifuge at 4000 rpm for 5 min, collect the supernatant, and use it for expression identification.

[0043] Coomassie staining and Western blot identification: Take 40 μL of protein solution, add an appropriate amount of protein loading buffer, and boil at 100℃ for 5-10 min; centrifuge at 12000 rpm for 2 min, and take 20 μL of each for protein electrophoresis. First run the stacking gel at 80 V, then run at 100 V until the end of electrophoresis; one gel is used for Coomassie brilliant blue staining, and the other is used for membrane transfer at 100 V for 90 min; after the transfer, wash the PVDF membrane once with TBST for 10 min, and discard the TBST; block with TBST containing 5% skim milk powder, and block on a shaker at 50 rpm for 1 h at room temperature; dilute the primary antibody with blocking buffer containing 5% skim milk powder, and hybridize the membrane on a shaker at low speed at room temperature for 4 h; wash the membrane three times with TBST for 10 min each time; dilute the secondary antibody with blocking buffer containing 5% skim milk powder, and hybridize the membrane on a shaker at low speed at room temperature for 45 min; wash the membrane three times with TBST for 10 min each time; after ECL exposure, scan the membrane.

[0044] The results showed that clone 3 was successfully expressed ( Figures 2-3 ).

[0045] 6) Optimal transformant expands expression

[0046] To increase the expression level of the target protein, clone 3 was selected for amplified expression. 50 mL of YPG medium was added to a 250 mL Erlenmeyer flask, and the optimal expression transformant was inoculated. The flask was incubated at 30℃ and 220 rpm for 1-2 days until saturation. The culture was then transferred to a 50 mL centrifuge tube, centrifuged at 4000 rpm for 5 min, and the supernatant was discarded. The cells were resuspended in 50 mL of BMMY medium and transferred to a new sterile 250 mL Erlenmeyer flask. Methanol was added to a final concentration of 0.5%, and the flask was incubated at 28℃ and 220 rpm for 6 days. Methanol was added every 24 hours (final concentration 0.75%). On the morning of day 6, the culture was collected, centrifuged at 4000 rpm for 5 min, and the supernatant was collected for expression identification.

[0047] 7) Protein purification and identification

[0048] To obtain a large amount of purified target protein, the expanded expression protein was purified using Ni-NTA beads, and the purified protein was detected by Western blotting (same as in 5), and its concentration was determined by BCA method.

[0049] Protein purification: 5 mL Ni-NTA beads were packed into a 30 mL gravity column; the column was equilibrated with 5 mL Lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH=8.0, filtered sterile) for 3 times; 50 mL of protein solution was filtered twice; 10 mL Wash buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM Mimidazole, pH=8.0, filtered sterile) was added for washing, repeated 5 times; 5 mL Elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH=8.0, filtered sterile) was added for elution, yielding the purified protein. The results showed that the protein sample was successfully purified, with no other contaminants present. Figure 4 ).

[0050] Protein concentration determination: Protein concentration was determined using the BCA method; the procedure was followed according to the instructions, and the determination was performed using an ELISA plate method; a standard curve was plotted in Excel with the average absorbance at A562 as the ordinate and the corresponding protein concentration as the abscissa; the protein concentration of the diluted sample was calculated, and then the original sample protein concentration was calculated based on the dilution factor. The results showed that the measured concentration was approximately 133 μg / mL.

[0051] Example 2: Effect of Nb116 nanobody on the adhesion of Salmonella enteritidis to IPEC-J2 intestinal epithelial cells

[0052] IPEC-J2 cells were pipetted into a single-cell suspension using 1640 medium containing 10% FBS. 500 μL of this suspension was seeded into 24-well cell culture plates and cultured until a monolayer of approximately 10⁵ cells was formed. Salmonella enteritidis ATCC13076 purified to an OD₆₀₀ of 0.4 was used. The cells were divided into two groups. The treatment groups were pre-incubated with 50 μg / mL and 100 μg / mL nanobodies, respectively, at 37°C for 30 min. After washing three times with PBS, the cells were placed on ice, and 1 × 10⁷ cells were seeded into each well. The cells were incubated at 37°C for 2 h. After washing three times with PBS, 300 μL of trypsin was added to each well, and the mixture was incubated for 5 min. Cells were then mixed with 5% BSA-PBS, transferred to EP tubes, diluted with 15% glycerol-PBS, plated, and incubated overnight. Cell adhesion rates were calculated for different cell types. The results showed that, compared with the control group, the adhesion rate of Salmonella enteritidis was significantly reduced in the 50 μg / mL nanobody treatment group, and the adhesion rate was significantly reduced in the 100 μg / mL nanobody treatment group. Figure 5 ).

[0053] Example 3: Effect of Nb116 nanobody on Salmonella enteritidis invading IPEC-J2 intestinal epithelial cells

[0054] IPEC-J2 cells were pipetted into a single-cell suspension using 1640 medium containing 10% FBS. 500 μL of the suspension was seeded into a 24-well cell culture plate and cultured until a monolayer of cells was formed. Approximately 10⁵ cells were used. The purified Salmonella enteritidis ATCC13076 culture was adjusted to an OD600 of 0.4 and divided into two groups. The bacteria in the treatment group were pre-incubated with 50 μg / mL and 100 μg / mL nanobodies at 37°C for 30 min, respectively. After washing three times with PBS, the culture was placed on ice, and 1 × 10⁷ bacteria were inoculated into each well. The culture was incubated at 37°C for 2 h. After washing three times with PBS, the culture medium was replaced with 100 μg / mL gentamicin 1640 medium and incubated at 37°C in a 5% CO₂ incubator for 90 min to kill extracellular bacteria. The cells were then washed three times with PBS, and 1 mL of sterile double-distilled water was added to lyse the cells and release the bacteria. The lysate was transferred to EP tubes, diluted with 15% glycerol PBS, plated, and incubated at 37°C for 18 h for counting. The invasion rate of the bacteria on IPEC-J2 intestinal epithelial cells was calculated as the number of invading bacteria / inoculated bacteria. The results showed that the infection rate of Salmonella enteritidis in the 50 μg / mL nanobody treatment group was lower than that in the control group, and the infection rate in the 100 μg / mL treatment group was significantly reduced. Figure 6 ).

[0055] The embodiments of the present invention have been described in detail above with reference to the examples. However, the present invention is not limited to the above embodiments. For those skilled in the art, after learning the contents described in the present invention, several equivalent changes and substitutions can be made without departing from the principle of the present invention. These equivalent changes and substitutions should also be considered to fall within the protection scope of the present invention.

Claims

1. A nanobody Nb116 against Salmonella enteritidis, characterized in that: The nucleotide sequence of the nanobody Nb116 is shown in SEQ ID NO.

1.

2. A nanobody Nb116 against Salmonella enteritidis, characterized in that: The amino acid sequence of the nanobody Nb116 is shown in SEQ ID NO.

2.

3. A nanobody Nb116 against Salmonella enteritidis as described in claim 1 or 2, characterized in that: Target Salmonella enteritidis type I fimbriae.

4. The use of the anti-Salmonella enteritidis nanobody Nb116 as described in claim 1 or 2 in the preparation of products that reduce the adhesion and invasion of IPEC-J2 cells by Salmonella enteritidis.

5. A method for preparing a nanobody Nb116 against Salmonella enteritidis, characterized in that, Includes the following steps: Step S1: Compare and screen in a yeast-displaying nanobody library to determine the nucleotide and amino acid sequences of the anti-Salmonella enteritidis fim type I fimbrial nanobody, wherein the nucleotide sequence is shown in SEQ ID NO.1 and the amino acid sequence is shown in SEQ ID NO.2; Step S2: Predict the signal peptide of the target gene determined in step S1, remove the signal peptide coding sequence of the target gene itself, optimize the codons of the target gene according to the codon preference of the Pichia pastoris expression system, and then artificially synthesize the optimized target gene and clone it into the expression vector to construct the target vector. Step S3: Linearize the target vector to obtain a linearized vector. After purifying and recovering the linearized vector, electroporate it into Pichia pastoris competent cells and culture it to obtain Pichia pastoris transformants. Step S4: Positive screening, expression trials, and expression identification were performed on the Pichia pastoris transformants to obtain expression transformants; the expression transformants were then cultured on a large scale, the culture products were collected, and the protein was purified to obtain the anti-Salmonella enteritidis nanobody Nb116.

Images