Avian adenovirus serum type 4 ORF43 gene deleted strain FAdV-4 delta ORF43 as well as construction and application thereof
The use of CRISPR/Cas9 gene editing technology to construct the avian adenovirus serotype 4 ORF43 gene-deleted strain FAdV-4 ΔORF43 solves the problems of rapid transmission and high mortality rate of avian adenovirus 4 in existing technologies, providing a safer and more efficient vaccine development approach and reducing economic losses in poultry farming.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-11
- Publication Date
- 2026-04-10
AI Technical Summary
Current technologies lack effective prevention and control measures to control the spread of avian adenovirus type 4 (FAdV-4), especially since vaccines against this virus are not very effective, leading to rapid infection and spread, high mortality, and huge economic losses to poultry farming.
A strain of avian adenovirus serotype 4 with the ORF43 gene deleted, FAdV-4ΔORF43, was constructed. The ORF43 gene was knocked out using CRISPR/Cas9 gene editing technology. This strain was developed for use in genetically engineered vaccines and attenuated vaccines. This strain was used as a candidate vaccine strain to reduce its pathogenicity and transmission rate.
It significantly reduced the pathogenicity of FAdV-4, slowed the infection rate, provided a safer and more efficient foundation for vaccine development, provided a new target for the control of avian adenovirus type 4, and reduced the mortality rate and economic losses from infection.
Smart Images

Figure CN121825905A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a strain of fowl adenovirus serotype 4 ORF43 gene and its constructed gene deletion strain FAdV-4 ΔORF43 and application, belonging to the field of biotechnology. BACKGROUND
[0002] Fowl adenovirus serotype 4 (FAdV-4) belongs to the C species of group I avian adenovirus, and is the main pathogenic agent of hepatitis-hydropericardium syndrome (HHS). The disease first broke out in Pakistan in 1987, causing huge economic losses. In the 1990s, HHS spread to India, with a virus mortality rate of 30-80%, causing devastating damage to intensive chicken farming in India. Subsequently, HHS broke out in various parts of the world, including the Middle East, Russia, the United States, Poland, Chile, Japan, and South Korea. Since June 2015, HHS has first broken out in large areas in Shandong, Henan, Jiangsu, and Anhui provinces in China, with obvious clinical symptoms, rapid onset, high mortality rate, and fast transmission speed, causing great panic to the local poultry farming environment. Subsequently, HHS rapidly spread across the country, causing huge economic losses to the national poultry industry.
[0003] The disease mainly infects 3-6 week old broilers, and the infected chickens show clinical symptoms such as depression, loss of appetite, disheveled and dull feathers, and greenish and watery feces, followed by sudden death, with a mortality rate of up to 80%. In addition to broilers, the disease can also infect laying hens, ducks, geese, pigeons, peacocks, and black-necked cranes. Autopsy mainly shows typical lesions such as a large amount of yellowish effusion in the pericardium, yellow and swollen liver, and hyperemia and swelling of the glandular stomach. FAdV-4 spreads quickly and can spread horizontally and vertically. In infected chicken flocks, it can spread through the fecal-oral route and aerosol route. Since the virus titer in feces is relatively high in various excretions, direct contact between animals and feces in the flock is an important route for horizontal transmission of FAdV-4. In addition, vertical transmission is also a major route of FAdV-4 transmission and an important cause of FAdV-4 prevalence. Some breeders are subclinically infected and can vertically transmit the virus to the next generation through breed eggs or chicken embryos, leading to the spread of FAdV-4.
[0004] There is currently no ideal prevention and control measure for FAdV-4 infection to control the spread of the virus. The current vaccines against fowl adenovirus type 4 are all inactivated vaccines, and there is an urgent need to develop better attenuated vaccines and subunit vaccines to improve the prevention and control effect of FAdV-4 infection and transmission. SUMMARY
[0005] In view of the deficiencies of the prior art, the present application provides an avian adenovirus serotype 4 ORF43 gene deletion strain FAdV-4 ΔORF43 based on the current epidemic strain in China and a construction method and application thereof.
[0006] To achieve the above-mentioned object, the technical scheme adopted by the present application is:
[0007] The avian adenovirus serotype 4 ORF43 gene deletion strain FAdV-4 ΔORF43 has a preservation number of CGMCC No. 46652.
[0008] The ORF43 gene sequence deleted in the gene deletion strain FAdV-4 ΔORF43 is shown as SEQ ID NO. 1.
[0009] The gene deletion strain FAdV-4 ΔORF43 deletes a fragment with a length of 378 bp by gene editing against ORF43, and the molecular marker site of the gene deletion is: the 35999th to 36377th positions on the genome.
[0010] The construction method of the avian adenovirus serotype 4 gene deletion strain FAdV-4 ΔORF43 is constructed by knocking out part of the ORF43 gene sequence using the CRISPR / Cas9 gene editing technology.
[0011] The avian adenovirus serotype 4 ORF43 gene is applied in the preparation of a genetic engineering vaccine, a attenuated vaccine and an inactivated vaccine.
[0012] The avian adenovirus serotype 4 gene deletion strain FAdV-4 ΔORF43 is applied in the preparation of an inactivated vaccine or a attenuated vaccine.
[0013] The beneficial effects of the present application
[0014] 1. The parent strain of the ORF43 gene deletion strain FAdV-4 ΔORF43 provided by the present application is FAdV-4 ZZ, which is isolated from a sample of a clinically diseased chicken in 2016, and through virus whole genome sequencing and genetic evolution analysis, 18-day-old chicken challenge experiment and pathogenicity analysis, etc., it is determined that the strain is the avian adenovirus serotype 4 dominant strain currently prevalent in chicken flocks in China, and the source and genetic background are clear, and the pathogenicity is clear.
[0015] 2、The application successfully constructs the ORF43 gene knockout virus strain FAdV-4 ΔORF43, the gene knockout virus strain has a slower in vitro proliferation speed, and the pathogenicity to chickens is significantly reduced, which indicates that the ORF43 gene is an important virulence gene of the avian adenovirus serotype 4, provides a new target for the development of genetic engineering vaccines and attenuated vaccines, and the constructed FAdV-4 ΔORF43 strain can be used as a potential vaccine candidate strain and can be used for the development of gene deletion inactivated vaccines or attenuated vaccines.
[0016] 3、The application provides the virus particles and nucleic acids of the ORF43 gene deletion strain FAdV-4 ΔORF43, and a multi-gene deletion genetic engineering vaccine can be constructed on the basis of the virus particles and nucleic acids by using CRISPR / Cas9 and other gene editing technologies, which lays an important foundation for the development of safer and more efficient vaccines. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 FAdV-4 ZZ strain ORF43 gene editing gRNA target point schematic diagram.
[0018] Wherein: FAdV-4 ZZ strain MN337322.1 is a schematic diagram of the whole genome and all ORFs of the FAdV-4 ZZ strain; gRNA207 represents an upstream gRNA targeting the ORF43 gene; gRNA585 represents a downstream gRNA targeting the ORF43 gene; 35999 and 36377 are two sites for cutting the ORF43 gene of the FAdV-4 ZZ strain genome by the upstream and downstream gRNAs.
[0019] Figure 2 FAdV-4 ΔORF43 strain PCR amplification identification result.
[0020] Wherein: A represents the editing effect of the gRNA expression plasmid combination gR157 / gR308, gR157 / gR585, gR207 / gR308, gR207 / gR585 and gR308 / gR585 on the ORF43 gene of the FAdV-4 ZZ strain; B represents the PCR amplification identification result of the ORF43 gene of the FAdV-4 ZZ strain and the edited ORF43 gene of the FAdV-4 ZZ strain; C represents the PCR amplification identification result of the FAdV-4 ΔORF43 strain for the ORF43 gene.
[0021] M, Marker with DNA molecular weight of 2000; FAdV-4 ZZ, FAdV-4 ZZ parental strain; FAdV-4 ΔORF43, FAdV-4 ΔORF43 gene edited deletion strain; FAdV-4 ΔORF43 P 3-10, FAdV-4 ΔORF43 strain with 3-10 times of continuous passage in chicken hepatoma cells.
[0022] Figure 3 FAdV-4 ZZ and FAdV-4 ΔORF43 strain ORF43 gene interval nucleotide sequence analysis and alignment results.
[0023] A: nucleotide sequence analysis of FAdV-4 ΔORF43 strain ORF43 gene PCR amplification product; B: FAdV-4 ZZ strain and FAdV-4 ΔORF43 gene edited deletion strain ORF43 gene sequence alignment analysis results. DSB, DNA double-strand break caused by gene editing; sgRNA207 and sgRNA585, gRNA targeting the upstream and downstream of ORF43 gene; PAM, target gene's protospacer adjacent motif. FAdV-4 ZZ, parental strain; FAdV-4 ΔORF43, gene edited deletion strain.
[0024] Figure 4 FAdV-4 ZZ and FAdV-4 ΔORF43 proliferation ability comparison results in chicken hepatoma cells.
[0025] A: FAdV-4 ZZ strain and FAdV-4 ΔORF43 gene edited deletion strain's median cell infective dose at 24, 36, 48, 60 and 72h time points after infecting chicken hepatoma cells; B: FAdV-4 ZZ strain and FAdV-4 ΔORF43 gene edited deletion strain's DNA copy number at 24, 36, 48, 60 and 72h time points after infecting chicken hepatoma cells.
[0026] FAdV-4 ZZ, parental strain; FAdV-4 ΔORF43, gene edited deletion strain.
[0027] Figure 5 FAdV-4 ZZ and FAdV-4 ΔORF43 infection of chicken organs viral load analysis results.
[0028] Control, negative control group; FAdV-4 ZZ, FAdV-4 ZZ strain infection positive control group; FAdV-4 ΔORF43, FAdV-4 ΔORF43 gene edited deletion strain infection group.
[0029] Figure 6 Results of analysis of IFN-β protein levels in serum of chickens infected with FAdV-4 ZZ and FAdV-4 ΔORF43.
[0030] Wherein: FAdV-4 ZZ represents the FAdV-4 ZZ strain positive control group; FAdV-4 ΔORF43 represents the gene editing deletion strain infection group.
[0031] Figure 7 Survival curve of SPF chickens infected with FAdV-4 ZZ and FAdV-4 ΔORF43.
[0032] Wherein: Control represents the negative control group; FAdV-4 ZZ represents the FAdV-4 ZZ strain positive control group; FAdV-4 ΔORF43 represents the gene editing deletion strain infection group. DETAILED DESCRIPTION
[0033] The technical solutions of the present application are described in further detail below in combination with specific examples.
[0034] Materials possibly used in the examples
[0035] Streptomycin and Rainbow 180 broad-spectrum protein Marker (11-180 KD) were purchased from Beijing Solabio Technology Co., Ltd.; Fetal bovine serum, Opti-MEM reduced serum medium and DMEM / F-12 culture medium were purchased from Gibco Company; Lipofectamine 2000 transfection reagent was purchased from Invitrogen Company; Roche protease inhibitor cocktail and Fast Start Universal SYBR Green Master (ROX) Kit were purchased from Roche Company; BbsI-HF (#R3539) high-fidelity restriction endonuclease and T4 DNA Ligase (#M0202) were purchased from NEB Company; Gel Extraction Kit (#D2500) was purchased from Omega Company; Viral genomic RNA / DNA extraction kit (#9766), Ex Taq™ Version 2.0 (#RR003) and DL2000 DNA Marker (#3427) were purchased from TAKARA Company; Chicken interferon beta (IFNβ) detection kit (#SEA222Ga) was purchased from Wuhan Yunclone Technology Co., Ltd.; Other conventional chemical reagents were purchased from the National Pharmaceutical Group.
[0036] Example 1. Isolation and whole genome sequencing analysis of FAdV-4 ZZ strain
[0037] Chickens diagnosed with hepatitis-pericardial effusion syndrome were collected from a chicken farm in Zhengzhou (Xinzheng), Henan Province. After dissection, tissues including the heart, liver, spleen, lungs, and kidneys were collected and frozen at -40 ℃. Subsequently, under aseptic conditions, a suitable amount of the tissue was taken, thoroughly ground in sterile phosphate buffer containing penicillin and streptomycin, and subjected to three freeze-thaw cycles between -80 ℃ and room temperature. After centrifugation at 10000 r / min for 15 min, the supernatant was filtered through a 0.22 μm filter for sterilization and then inoculated into pre-prepared chicken liver cancer cells. The cells were blindly passaged three times. After the appearance of typical cytopathic effects such as cell enlargement, rounding, fragmentation, and detachment, PCR identification confirmed the acquisition of the FAdV-4 isolate ZZ strain.
[0038] After infecting chicken liver cancer cells with the obtained FAdV-4 ZZ strain virus, the virus was harvested after 72 hours and viral DNA was extracted using a viral genome RNA / DNA extraction kit. Whole genome next-generation sequencing was performed by Sangon Biotech (Shanghai) Co., Ltd. The results showed that the full-length genome of the FAdV-4 ZZ strain virus was 43725 bp, GenBank no. MN337322.1.
[0039] Example 2. Construction and identification of FAdV-4 ΔORF43 recombinant virus
[0040] (1) Design of gRNA for ORF43 gene of FAdV-4 ZZ strain
[0041] Based on the ORF43 gene sequence of FAdV-4 ZZ strain (sequence information shown in SEQ ID NO.1), upstream and downstream gRNA sequences targeting the ORF43 gene were designed using the online gRNA design platform Benchling. Two high-scoring gRNA sequences were selected from each of the upstream and downstream locations of the gene based on gRNA scores (gRNA target sites are shown in SEQ ID NO.1). Figure 1 As shown in the figure, after adding a Bbs I restriction site (CACC / AAAC) to the 5' end of the gRNA sequence, gRNA oligo sequences (SEQ ID NO.2~SEQ ID NO.9) targeting the 5' and 3' ends of the ORF43 gene were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and annealed using 10×Annealing Buffer at 95 ℃ for 3 min and 37 ℃ for 1 h. Annealing was completed in a PCR instrument and stored at -20 ℃ for later use.
[0042] Table 1. GRNA oligo sequences targeting the ORF43 gene
[0043]
[0044] (2) Construction of pX459-gRNA plasmid
[0045] The pX459 v2.0 vector plasmid was digested with Bbs I-HF enzyme at 37°C for 1 h. The digestion product was then recovered by 1% agarose gel electrophoresis. Subsequently, the annealed double-stranded gRNA was cloned into the pX459 v2.0 vector. The ligation reaction system was as follows: 1 µL each of gRNA annealing product, T4 DNA ligase, and 10×T4 DNA Ligase Buffer, 30 ng of pX459 vector, and finally, the reaction system was made up to 10 µL with deionized water.
[0046] Ligation was performed overnight at 16 ℃. After the reaction, the ligation product was transformed into Trans-5α competent cells, plated, and single colonies were picked for expansion culture and plasmid extraction to construct gRNA expression plasmids pX459-gRNA157, pX459-gRNA207, pX459-gRNA308, and pX459-gRNA585 (abbreviated as gR157, gR207, gR308, and gR585, respectively).
[0047] (3) Editing and identification of the ORF43 gene in FAdV-4 ZZ strain
[0048] Chicken hepatoma cells were seeded into 6-well plates at appropriate cell volumes and cultured overnight at 37°C in a 5% CO2 incubator. When the cell density reached approximately 80%, plasmid transfection was performed. To assess the viral editing effect of the constructed plasmids, gRNA expression plasmids were co-transfected using Lipofectamine 2000 transfection reagent in combinations of gR157 / gR308, gR157 / gR585, gR207 / gR308, gR207 / gR585, and gR308 / gR585, according to the manufacturer's instructions. Twelve hours after transfection, each well was inoculated with FAdV-4 ZZ virus at a MOI of 0.01. After 1-2 hours of inoculation, the culture medium was changed, and the cells were cultured for another 48 hours. Infected cells were then harvested and subjected to three freeze-thaw cycles at -80°C.
[0049] Viral DNA was extracted from an appropriate amount of sample according to the instructions of the TAKARA Viral Genomic RNA / DNA Extraction Kit. Chicken hepatoma cell culture supernatant was used as a negative control. The extracted DNA was analyzed by PCR using the FAdV-4 ZZ strain ORF43 gene-specific primers ORF43-F and ORF43-R (SEQ ID NO.10~SEQ ID NO.11) listed in Table 2. The PCR reaction system is shown in Table 3, and the PCR reaction procedure is shown in Table 4. The amplification products were analyzed by 1% (w / v) agarose gel electrophoresis to assess the editing effect of each group of gRNA plasmids on the FAdV-4 ZZ strain ORF43 gene.
[0050] Table 2 Primers for ORF43 gene identification
[0051]
[0052] Table 3 PCR reaction system
[0053]
[0054] Table 4 PCR reaction procedure
[0055]
[0056] Electrophoresis results as follows Figure 2 As shown in Figure A, the combinations of gR157 / gR308, gR157 / gR585, and gR207 / gR308 only amplified a 700 bp specific ORF43 gene band; the combinations of gR207 / gR585 and gR308 / gR585 amplified not only the 700 bp specific ORF43 gene band, but also gene editing bands of 300 bp and 400 bp, respectively; the positive control group infected with FAdV-4 ZZ strain amplified a 700 bp specific ORF43 gene band; the blank control group did not amplify any band.
[0057] (4) Purification, sequencing identification and passage stability analysis of FAdV-4 ΔORF43 gene editing deletion strain
[0058] The FADV-4 ZZ strain virus mixture edited from the above gR207 / gR585 plasmid combination was subjected to 10... -2 10 -3 10 -4 10 -5 and 10 -6 After dilution, the cells were infected with chicken liver cancer cells. One well was reserved as a negative control. After incubation at 37°C for 2 hours, the cells were washed three times with sterile PBS. 2 mL of a 1:1 mixture of cell culture medium containing 10% FBS and agarose was added to each well. After cooling and solidification, the cell culture plate was inverted in a cell culture incubator for culture. The viral plaques were observed daily.
[0059] Select cell wells with appropriate density and uniform plaques, and use a sterile pipette tip to pick up as many individual plaques as possible. Inoculate these plaques into pre-prepared 48-well chicken hepatoma cell plates and incubate at 37°C in a 5% CO2 cell culture incubator for 48-72 h. After harvesting the cells and performing three freeze-thaw cycles, extract nucleic acids and perform PCR identification and electrophoresis analysis using the ORF43 gene primers listed in Table 2.
[0060] The positive cell well samples were then purified again using the viral single plaque clone method described above. This purification and identification process was repeated until a single ORF43 gene editing band was observed in the identification results. Figure 2 B), after gel extraction and recovery, was ligated into the pMD-18T vector and transformed into Trans-5α competent cells. Single colonies were picked after plating, expanded cultured, and sequenced for analysis. Figure 3 A). Sequencing results were compared with the ORF43 gene of the parental strain FAdV-4 ZZ ( Figure 3 B). The results showed that after editing with the gR207 / gR585 plasmid combination, the ORF43 gene underwent precise splicing at the corresponding bases, and the length of the missing fragment was 378 bp, which was completely consistent with the expected results.
[0061] The validated FAdV-4 ΔORF43 gene-editing deletion strain was serially passaged in chicken hepatoma cells. Virus samples from passages 3-10 were collected for PCR identification and electrophoretic analysis to determine the stability of the ORF43 gene-editing deletion. Figure 2 C). The results showed that when the FAdV-4 ΔORF43 gene-editing deletion strain was passaged to chicken hepatocellular carcinoma cells for 10 generations, PCR amplification of the ORF43 gene still only yielded an edited product of about 300 bp; while the FAdV-4 ZZ strain positive control was able to amplify a product of the original length of about 700 bp; the chicken hepatocellular carcinoma cell negative control did not amplify any bands. This result indicates that the FAdV-4 ΔORF43 gene-editing deletion strain is stable in chicken hepatocellular carcinoma cells after passage.
[0062] The gene-deleted strain FAdV-4 ΔORF43 has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46652 on October 23, 2025.
[0063] Example 3. Replication ability of FAdV-4 ΔORF43 gene editing deletion strains
[0064] Chicken liver cancer cells were infected with FAdV-4 ZZ strain and FAdV-4 ΔORF43 gene-edited deletion strain at a dose of 0.001 MOI and cultured in a 37°C, 5% CO2 incubator. Cell samples were collected at 24, 36, 48, 60 and 72 h after infection, and after three freeze-thaw cycles, they were stored at -80°C.
[0065] Chicken hepatoma cells were passaged and seeded into 96-well cell culture plates and cultured overnight at 37°C in a 5% CO2 incubator. In a biosafety cabinet, 100 μL of virus solution was added to sterile 1.5 mL centrifuge tubes. 900 μL of DME / F12 cell maintenance medium containing 2% FBS was added to each tube, and the mixture was thoroughly mixed. The mixture was then serially diluted 10-fold using cell maintenance medium until a final concentration of 10⁻⁶ was reached. -10 Then, the diluted virus solution was added sequentially from left to right to 96-well cell culture plates, 100 μL per well. Cell maintenance medium was added to the last two wells as a negative control. After adding all samples, the cell culture plates were placed in a 37°C, 5% CO2 cell culture incubator for 3-5 days, observing and recording the cytopathic effect daily. After the virus culture was completed, the viral titer, i.e., the half-maximal dose (TCID), was calculated according to the Reed-Muench method based on the recorded cytopathic effect. 50 ).
[0066] Viral DNA was extracted from viral fluids collected at different time points using a viral genome RNA / DNA extraction kit according to the instructions. The extracted DNA was amplified by qPCR using the SYBR Green I real-time quantitative PCR primers FAdV-4-DL-F and FAdV-4-DL-R (SEQ ID NO.12~SEQ ID NO.13) for the Hexon gene of the FAdV-4 ZZ strain listed in Table 5, and the expression of the Hexon gene of the two viruses at different time points was determined.
[0067] Table 5 Primers for qPCR amplification of FAdV-4 Hexon gene
[0068]
[0069] The results showed that Figure 4 A represents the viral titer TCID measured at different time points. 50 ; Figure 4 B represents the viral copy number detected by qPCR. It can be seen that in the later stages of infection, the viral titer and genomic DNA copy number of the FAdV-4 ΔORF43 strain were significantly lower than those of the parent strain FAdV-4 ZZ, indicating that the replication ability of the FAdV-4 ΔORF43 gene-edited deletion strain on chicken liver cancer cells was significantly lower than that of the original strain FAdV-4 ZZ.
[0070] Example 4. Pathogenicity analysis of FAdV-4 ΔORF43 gene editing deletion strains
[0071] To investigate the pathogenicity of the FAdV-4 ΔORF43 gene-edited deletion strain in chickens, 30 14-day-old SPF chickens were randomly divided into three groups: a positive control group (FAdV-4 ZZ strain), a FAdV-4 ΔORF43 gene-edited deletion strain group, and a negative control group (chicken hepatocellular carcinoma cell culture medium), with 10 chickens in each group. The challenge group was inoculated intramuscularly with 1×10⁻⁶ ppm of the strain. 5 TCID 50 Two viruses were administered at 100 μL each, and the negative control group was inoculated with an equal volume of chicken liver cancer cell culture medium. Both were housed in isolators. The mental state and clinical symptoms of the chickens were observed daily, and their survival status was recorded. Starting the day after challenge, blood was randomly collected from three chickens in each group, and serum was separated and collected for three consecutive days for analysis of serum interferon concentration. Simultaneously, chickens that died from the disease underwent necropsy, and the heart, liver, spleen, lungs, kidneys, proventriculus, and intestines were collected for analysis of viral load in the tissues. The survival status of chickens in each group was recorded daily. The experiment ended two days after all chickens in the positive control group had died. All surviving chickens were euthanized, and survival curves were plotted based on the mortality rates of each group.
[0072] Because FAdV-4 infection can cause lesions in multiple organs of chickens, especially typical pericardial effusion, liver icterus, and congestion and swelling of other organs, organ and tissue samples were collected after necropsy of dead chickens for virus content detection. qPCR results showed ( Figure 5 In the heart, liver, spleen, lung, kidney, proventriculus and intestine samples collected, the viral load in the liver and spleen of dead chickens in the FAdV-4 ΔORF43 gene-edited deletion strain group was significantly lower than that in the FAdV-4 ZZ strain group, while the viral load in other tissues and organs was not significantly different.
[0073] Blood samples were randomly collected from three infected chickens daily on days 2, 3, and 4 post-infection, and serum was separated. The IFN-β protein content in the serum was detected by ELISA. It was found that the IFN-β protein content in the serum of SPF chickens increased continuously with the time of infection, and the IFN-β protein level was higher in the virus-deficient group. Figure 6 ).
[0074] Survival curve results showed that all chickens in the negative control group survived; all 10 SPF chickens in the positive control FAdV-4 ZZ strain group died 6 days after infection, with the peak mortality period being 3-4 days after infection; while the 10 SPF chickens in the FAdV-4 ΔORF43 gene editing deletion strain group showed a slower mortality rate and higher survival rate after infection compared to the FAdV-4 ZZ strain group. Figure 7 ).
[0075] In summary, this invention successfully constructed a FAdV-4 ΔORF43 gene-edited deletion strain with a complete deletion of the ORF43 gene using the FAdV-4 ZZ strain as the parent strain. This strain exhibits significantly reduced replication ability in chicken liver cancer cells. Animal pathogenicity experiments show that the deletion of the ORF43 gene slows down the mortality rate of chickens infected with FAdV-4 virus, making it a potential candidate vaccine strain for FAdV-4.
[0076] SEQ ID NO. 1: 669 bp ORF43 gene sequence of FAdV-4 ZZ strain
[0077] ATGGCCGAAGAGTGGCTCGACCTTTTCCACCCCTCCACTTCGCCGAATCCAGAAGGAGAAGGTGAGGACATGTCCCTCGAGACCGAGTGCCATGCCCCTCTTCAATATATTTCCATGCTGTCTTTTGATGACCTCCTGGCGGCTGCCGGTCCCCCGGACTACTCTCC GGAAGAGAACCAGGAAACACCGCCGATCGAAACCATAGAGGTAGGAGACATCATGGCCGAACTCGGTATTCCGATAGAGGGACCTCCGACCAGCCCTTCCGACTCTTCCTCCAGTTTGGATTCAGTACTTTTCTCCGGTGTCGACTTGTATGACTTAGACTATACCA TTTGTCTTTTCCCGACTCCGTGAGTTTTGGCAATCGCACGGCGCATACTTGAAAACCGTAGCTTCGCTCGAGTGCATGCAAAACGACAGGAAATTTCAGGAAGCATACTGCTCACTGGTGAGAATGCACGCCGTTTCCGAAGATGCCAAAGAGCATCTCAATGAACTC TTACTAGACGAACCAACTACCAACATTGCGAACCCCTCAATGACATGTTGGACTTGGGATTCCGGTGGCTCAATGACCTAAAAGGAGGAATAATGGAGTGGTGCATGGACACTGCCCTGGATCGCGCATCAAAAGTCATGCCTCTGACTGACTATCAACCACAATAA
Claims
1. A avian adenovirus serotype 4 ORF43 gene-deleted strain FAdV-4 ΔORF43, characterized in that, The preservation number of the aforementioned strain is: CGMCC No.46652.
2. The gene-deleted strain FAdV-4 ΔORF43 as described in claim 1, characterized in that, The missing ORF43 gene sequence is shown in SEQ ID NO.
1.
3. The gene-deleted strain FAdV-4 ΔORF43 as described in claim 3, characterized in that, A 378 bp segment was deleted by gene editing targeting ORF43. The molecular marker sites for the gene deletion were positions 35999 to 36377 on the genome.
4. A method for constructing the avian adenovirus type 4 gene-deleted strain FAdV-4 ΔORF43 as described in claim 1, characterized in that, It was constructed by knocking out a portion of the ORF43 gene sequence using CRISPR / Cas9 gene editing technology.
5. The application of the avian adenovirus serotype 4 ORF43 gene as described in claim 1 in the preparation of genetically engineered vaccines, attenuated vaccines, and inactivated vaccines.
6. The use of the avian adenovirus serotype 4 gene-deleted strain FAdV-4 ΔORF43 as described in claim 1 in the preparation of inactivated or attenuated vaccines.