Application of fgsg_09291 protein and its coding gene in improving plant disease resistance
By identifying the FGSG_09291 protein in Fusarium graminearum, the plant immune system was activated, solving the problem of Fusarium graminearum disease control and achieving efficient and safe plant disease control.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-17
- Publication Date
- 2026-06-09
AI Technical Summary
In the current technology, it is still unclear how Fusarium graminearum manipulates the host's immunity, and there is a lack of efficient and safe biological pesticides to control plant diseases caused by Fusarium graminearum.
The FGSG_09291 protein was identified from Fusarium graminearum. It can be developed into a plant immune inducer by activating the plant immune system, promoting the expression of PR1a and WRKY70 genes, increasing reactive oxygen species bursts and callose accumulation.
It significantly improves plant resistance to diseases, especially those caused by sugarcane mosaic virus, enhances the plant's basic immune response, and strengthens the control effect against diseases.
Smart Images

Figure CN121851132B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant immune induction technology, specifically to the application of an FGSG_09291 protein and its encoding gene in improving plant disease resistance. Background Technology
[0002] In agricultural production, various harmful organisms have always been a significant factor affecting crop yield and quality. Developing green and environmentally friendly biopesticides is a crucial measure to address this issue. Plant immune inducers, developed from plant immune elicitors, are a class of environmentally friendly biopesticides. They do not directly target harmful microorganisms but rather stimulate the plant's natural immune mechanisms and metabolic systems to resist pathogen invasion. Plant immune inducers have no toxic side effects and do not induce drug resistance in pathogens. Furthermore, some inducers can stimulate the plant's metabolic system, promoting the growth of roots, stems, and leaves, as well as chlorophyll synthesis, thereby increasing crop yield. These excellent properties make plant immune inducers the preferred agents for producing green agricultural products, providing a guarantee for the sustainable development of agriculture.
[0003] Fusarium graminearum is an important plant pathogenic fungus that infects not only cereal crops such as wheat, barley, and rice, but also other plants such as soybean, potato, and rapeseed. It can infect different parts of these plants, causing various plant diseases such as seedling rot, root rot, and ear rot. Predicting and cloning pathogenic fungal effectors that can activate plant immunity is crucial for studying the function of these effectors and the mechanisms of pathogen-plant interactions. The Fusarium graminearum genome encodes a large number of secreted effectors; however, how most of these effector proteins manipulate host immunity remains unknown. Therefore, identifying plant immune-activating proteins secreted by Fusarium graminearum can provide valuable assistance in reducing the use of agrochemicals and promoting sustainable agriculture. Summary of the Invention
[0004] In view of the above-mentioned prior art, the purpose of this invention is to provide an application of the FGSG_09291 protein and its encoding gene in improving plant disease resistance. This invention discovers a novel protein with plant immune activation function from Fusarium graminearum, which can be developed into a highly efficient and safe green control product for crop diseases, and has significant application value.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] A first aspect of the present invention provides the application of the FGSG_09291 protein in improving plant disease resistance; said FGSG_09291 protein is any one of the proteins shown in (A1)-(A3) below:
[0007] (A1) A protein consisting of the amino acid sequence shown in SEQ ID NO.1 of the sequence listing;
[0008] (A2) A protein consisting of the amino acid sequence shown in SEQ ID NO.3 of the sequence listing;
[0009] (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1) or (A2).
[0010] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0011] In the above applications, the FGSG_09291 protein enhances plant disease resistance by activating plant immunity; therefore, the FGSG_09291 protein can be used to prepare plant immune inducers.
[0012] Furthermore, the FGSG_09291 protein activates plant immunity through at least one of the following pathways (1)-(3):
[0013] (1) Promote PR1a Genes and WRKY70 Gene expression;
[0014] (2) Promotes the burst of reactive oxygen species in plants;
[0015] (3) Promotes the accumulation of callose in plants.
[0016] Preferably, the disease resistance is against diseases caused by sugarcane mosaic virus.
[0017] Preferably, the plant is corn or tobacco.
[0018] A second aspect of the present invention provides the application of the gene encoding the FGSG_09291 protein in improving plant disease resistance; the gene encoding the FGSG_09291 protein is a nucleic acid molecule as shown in i), ii), iii), or iv) below:
[0019] i) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.2;
[0020] ii) Nucleic acid molecules other than those in i) encoding the amino acid sequence shown in SEQ ID NO. 1;
[0021] iii) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.4;
[0022] iv) Nucleic acid molecules other than iii) that encode the amino acid sequence shown in SEQ ID NO.3.
[0023] In the above applications, plant disease resistance is improved by promoting the expression of the gene encoding the FGSG_09291 protein.
[0024] Preferably, the substance that promotes the expression of the gene encoding the FGSG_09291 protein is any one of the following:
[0025] C1) Expression cassette containing the gene encoding the FGSG_09291 protein;
[0026] C2) A recombinant vector containing the gene encoding the FGSG_09291 protein, or a recombinant vector containing the expression cassette described in C1);
[0027] C3) Recombinant microorganisms containing the gene encoding the FGSG_09291 protein, or recombinant microorganisms containing the expression cassette described in C1), or recombinant microorganisms containing the recombinant vector described in C2).
[0028] Preferably, the disease resistance is against diseases caused by sugarcane mosaic virus.
[0029] The beneficial effects of this invention are:
[0030] This invention discovers a novel FGSG_09291 protein from Fusarium graminearum with plant immune activation function. This protein can promote reactive oxygen species (ROS) bursts and callose accumulation in plants, providing a basic immune response; it can also induce... PR1a Gene, WRKY70 Genes and LOX3 High expression of genes, PR1a and WRKY70 The gene is involved in the salicylic acid pathway, and increased salicylic acid levels can enhance broad-spectrum resistance in plants. Experiments have verified that exogenous application of FGSG_09291 protein can enhance the control of maize dwarf mosaic virus. Attached Figure Description
[0031] Figure 1 FGSG_09291 can induce an immune response in tobacco. In the figure, A shows the accumulation of reactive oxygen species and callosity after FGSG_09291 and GFP were expressed on tobacco for 2 days, respectively; B shows the SA pathway after FGSG_09291 and GFP were expressed on tobacco for 2 days, respectively. PR1a and WRKY70 Relative gene expression levels. This indicates a significant difference at the 1% level.
[0032] Figure 2 : Detection results of purified protein FGSG_09291; In the figure, EV is an empty vector.
[0033] Figure 3 After exogenous application of purified protein FGSG_09291, the salicylic acid pathway was detected at different time points. LOX3 Relative gene expression levels. This indicates a significant difference at the 1% level.
[0034] Figure 4 Exogenous application of purified protein FGSG_09291 can enhance resistance to maize dwarf mosaic virus. In the figure, A shows the disease incidence of maize inoculated with sugarcane mosaic virus after exogenous application of purified protein FGSG_09291; B shows the accumulation of SCMV-CP in the upper leaves of maize after inoculation with sugarcane mosaic virus following exogenous application of purified protein FGSG_09291; C shows the relative expression level of SCMV-CP in the upper leaves of maize after inoculation with sugarcane mosaic virus following exogenous application of purified protein FGSG_09291, detected by RT-qPCR. This indicates a significant difference at the 1% level. Detailed Implementation
[0035] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0036] As mentioned earlier, plant pathogens manipulate the host plant's immune response by secreting a large number of effectors, while plants can activate their own immunity by recognizing these effectors. Identifying extracellular effectors of pathogens that can induce plant immunity is of great significance for the creation of novel plant immune inducers.
[0037] Therefore, this invention has conducted in-depth research on Fusarium graminearum. FGSG_09291 is a pectin lyase B precursor in Fusarium graminearum, its amino acid sequence is shown in SEQ ID NO.1, and the sequence of the encoding gene is shown in SEQ ID NO.2, as follows:
[0038] amino acid sequence:
[0039] M KFLGLLNLAALASAVPTPTVQQVGKTLGKRAAITDAANIGYATENGGTTGGAGGATVTVSSLAEFSKAAESDEKQVIYVKGQLTGNNKIRVKSDKTIVGAAGASLENIGLYINKQKNVIVRNLAIKNVVAANGDAIGIQKSTNVWVDHCELSSDFSKDKDFFDGLLDVTHASDWVTISNTYFHDHHKASLVGHSDSNAAEDTGALHVTYANNHWTNIGSRAPSVRFGTVHVFNNYYEDISVTGVNSRMGAQVLVESSAFSNAKKALISKDSKQTGSISVNDVDLGGSTNDAPKGTISKSDIPYKYSLVGSSKVKAAVVGVAGNTLKL。
[0040] Coding gene sequence:
[0041] ATG AAGTTCCTCGGTCTCCTCAACCTCGCTGCTCTGGCCAGCGCCGTTCCTACTCCTACCGTCCAGCAAGTTGGCAAGACTCTCGGCAAGCGAGCTGCCATCACCGATGCTGCCAACATTGGCTATGCTACCGAGAATGGAGGTACCACTGGTGGTGCCGGAGGAGCTACCGTGACTGTTTCTTCCCTTGCTGAGTTCAGCAAGGCCGCCGAGTCGGACGAGAAGCAGGTCATTTACGTCAAGGGCCAGCTCACCGGTAACAACAAGATCCGTGTCAAGTCCGACAAGACCATCGTCGGTGCCGCTGGTGCTTCTCTCGAGAACATCGGCCTCTACATCAACAAGCAGAAGAACGTCATCGTCCGCAACTTGGCCATCAAGAACGTTGTCGCTGCCAACGGCGACGCCATCGGCATCCAAAAGTCCACCAACGTCTGGGTCGACCACTGCGAGTTGTCCTCCGACTTCTCCAAGGACAAGGACTTCTTTGATGGTCTCCTCGATGTCACCCACGCTTCAGACTGGGTCACCATCTCCAACACCTACTTCCACGACCACCATAAGGCTTCTCTTGTCGGCCACTCCGACAGCAACGCTGCTGAGGACACTGGTGCTCTCCACGTCACCTACGCCAACAACCACTGGACCAACATTGGCTCTCGTGCTCCCTCTGTCCGCTTCGGTACCGTCCACGTCTTCAACAACTACTACGAGGACATCAGCGTCACTGGTGTCAACTCTCGCATGGGTGCTCAGGTTCTTGTTGAGTCGTCTGCTTTCAGCAACGCTAAGAAGGCTCTCATCTCCAAGGACTCCAAGCAGACCGGAAGCATCTCTGTCAACGATGTCGACCTCGGCGGCTCCACCAACGATGCCCCCAAGGGTACCATCTCCAAGTCCGACATTCCCTACAAGTACTCTCTTGTCGGCTCTTCCAAGGTCAAGGCGGCCGTGGTTGGTGTTGCTGGAAACACTCTCAAGCTGTAG。
[0042] Note: The bold and underlined regions in the sequence are signal peptides.
[0043] Current research on the function of FGSG_09291 is limited. To investigate the application of FGSG_09291 in inducing plant immunity, this invention first transiently expressed FGSG_09291 in tobacco. It was found that overexpression of FGSG_09291 could induce reactive oxygen species bursts and callose accumulation, and promote... PR1a and WRKY70 High gene expression enhances the plant's immune resistance.
[0044] Furthermore, this invention exogenously expressed FGSG_09291, removing the signal peptide from the expressed FGSG_09291. The amino acid sequence of FGSG_09291 after removing the signal peptide is shown in SEQ ID NO.3, and its encoding gene sequence is shown in SEQ ID NO.4. The effect of exogenously expressed FGSG_09291 on maize dwarf mosaic virus caused by sugarcane mosaic virus was then investigated. The results showed that FGSG_09291 significantly improved maize's resistance to maize dwarf mosaic virus, thus proposing this invention.
[0045] To enable those skilled in the art to more clearly understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments. The experimental materials used in the embodiments of this invention are all conventional experimental materials in the art and can be purchased through commercial channels. Wherein:
[0046] Sugarcane mosaic virus (SCMV), described in the journal article (A maize triacylglycerol lipase inhibits sugarcane mosaic virus infection. Plant Physiol. 2022 Jun 1;189(2):754-771.), is available to the public from the applicant for use in replicating this experiment.
[0047] LB liquid medium: Weigh 10g NaCl, 10g Tryptone, and 5g yeast extract and add them to 1000mL of ultrapure water. Stir and mix well, then dispense into containers. Sterilize in an autoclave at 121℃ for 20 minutes.
[0048] When preparing LB solid medium, add 15% agar powder to LB liquid medium.
[0049] Potato dextrose agar (PDA) medium: Weigh 46g of potato dextrose agar powder and add it to 1000mL of ultrapure water. Stir well, dispense into portions, and sterilize in an autoclave at 121℃ for 20min.
[0050] The primers used in the examples are shown in Table 1:
[0051] Table 1: Primer sequences used in the embodiments of this invention
[0052]
[0053] Example 1: Investigation of the immune response to tobacco stimulated by FGSG_09291
[0054] 1. Test method:
[0055] (1) Vector construction and Agrobacterium-mediated transient expression
[0056] The full-length coding sequence of FGSG_09291 (SEQ ID NO.2) was inserted into the pCAMbia0390 binary expression vector to obtain the pCambia-FGSG_09291 overexpression vector, which was then transformed into the GV3101 Agrobacterium (Biovector) strain. The GFP sequence was inserted into the pCambia0390 binary expression vector to obtain the pCambia-GFP overexpression vector, which was used as a negative control and transformed into the GV3101 Agrobacterium (Biovector) strain.
[0057] Positive transformants of Agrobacterium were incubated in 3 ml of LB broth supplemented with kanamycin (50 μg / ml) at 220 rpm and 28-30 °C for 48 h. The cells were then collected by centrifugation at 4000 rpm for 4 min, resuspended in 10 mM MgCl2, and this process was repeated three times. The final volume was then adjusted to OD using 10 mM MgCl2. 600 =0.4-0.6. Take tobacco leaves that have grown for 6-8 weeks and are fully expanded from the third to the sixth leaf from the top for inoculation with Agrobacterium. Make a small wound on the lower epidermis of the tobacco leaf with a needle, and use a 1 mL needleless syringe to infiltrate 30-50 μL of Agrobacterium suspension into the tobacco leaf.
[0058] (2) Detection of defense-related genes
[0059] Samples were taken from tobacco plants 2 days after transient expression of Agrobacterium, following the instructions provided with the Total RNA Purification System kit (Invitrogen). Quantitative real-time PCR was used to detect defense-related genes. PR1a (GeneBank:LOC542352) and WRKY70The expression level of (GeneBank: LOC109942268) was determined; quantitative real-time PCR was performed according to ABI 7300 Sequence Detection System (Applied Biosystems, USA) software and guidelines.
[0060] (3) Detection of reactive oxygen species
[0061] Two days after Agrobacterium expression, the injected tobacco leaves were removed and placed in DAB staining solution (10 mmol / L). -1 Incubate in MES (pH=6.5, containing 0.1% DAB) for 8 hours, then expose to light for another 8 hours until brown spots appear; remove the staining solution, add anhydrous ethanol to remove chlorophyll until the leaves are colorless and transparent, suspend in water, examine under a microscope, and photograph.
[0062] (4) Callose test
[0063] Prepare the decolorization solution in advance: 10 mL phenol, 10 mL glycerol, 10 mL lactic acid, 10 mL water, and 80 mL ethanol. Carefully cut tobacco leaves injected with Agrobacterium two days after expression, taking care not to damage the leaf surface. Immediately immerse the cut leaves in the decolorization solution, then place them in a 60℃ oven for 1 hour to remove chlorophyll. After rinsing the leaves with water, stain them in 0.05% aniline blue staining solution (150 mmol / mL K2PO4, pH 9.5) in the dark for 20 minutes, rinse with distilled water, suspend in water, and examine and photograph them under a fluorescence microscope with UV excitation (excitation light 330-385 nm, emission light 420 nm).
[0064] 2. Test Results:
[0065] The results are as follows Figure 1 As shown, FGSG_09291 is overexpressed in tobacco. PR1a and WRKY70 High gene expression, which induces reactive oxygen species bursts and callose accumulation, can provide plant inducers with durable resistance for production. PR1a and WRKY70 The gene is a gene of the salicylic acid pathway, and the increase of salicylic acid can enhance the broad-spectrum resistance of plants. Reactive oxygen species and callose are the basic immune responses of plants, which indicates that FGSG_09291 can induce the basic immunity of plants and thus enhance the disease resistance of tobacco.
[0066] Example 2: Removal of exogenous expression of signal peptide FGSG_09291
[0067] 1. Test method:
[0068] The coding region of FGSG_9291 (excluding the signal peptide, sequence as shown in SEQ ID NO.4) was inserted into the pET-28a vector. The recombinant protein was expressed in *E. coli* Rosetta (DE3) and induced for 10 h at 16°C using 0.2 mM isopropyl-β-d-thiogalactoside (IPTG). After induction, cells were collected by centrifugation and resuspended in phosphate-buffered saline (PBS, pH 7.5) containing 30 mM imidazole and 1× protease inhibitor (to inhibit protein degradation). The suspended cells were sonicated and centrifuged (10,000 g, 10 min) to obtain the supernatant. The supernatant was then purified using Ni-NTA resin affinity chromatography. The target protein was eluted with 250 mM imidazole, and the eluted sample was dialyzed overnight at 4°C using a 3500 pore size Spectrum / Por dialysis membrane, with buffer changes made multiple times during the process. Protein concentration was determined using the ultraviolet absorption method (A280 method). Proteins were identified by 12% SDS-PAGE; empty vector (EV) was used as a control.
[0069] 2. Test Results:
[0070] The detection results of purified protein FGSG_09291 are as follows: Figure 2 As shown, the results indicate that the FGSG_09291 protein was successfully expressed in this invention. Sequencing confirmed that the amino acid sequence of the exogenously expressed FGSG_09291 with the signal peptide removed is shown in SEQ ID NO. 3.
[0071] Example 3: Investigation on the control effect of external application of FGSG_09291 on maize dwarf mosaic virus
[0072] 1. Test method:
[0073] The experiment was divided into two groups: a control group without protein application and a treatment group treated with 2 μM of FGSG_09291 protein prepared in Example 2 for 5 days. SCMV-GFP-infected maize leaves were then collected, and pre-cooled phosphate buffer was added at a ratio of 1:10 (w / v). After thorough grinding, 20 μL of the supernatant was collected and inoculated onto the first fully expanded upper leaf of maize leaves in both the control and treatment groups. After exogenous application of purified FGSG_09291 protein, the salicylic acid pathway was detected at different time points. LOX3 Relative gene expression levels; after inoculation with SCMV-GFP, the symptoms and GFP fluorescence intensity of the upper leaves of maize were observed and recorded regularly; the accumulation of SCMV-CP in the upper leaves of maize was detected by western blotting and RT-qPCR using CP antibody.
[0074] 2. Test Results:
[0075] After exogenous purification of protein FGSG_09291 LOX3 Gene expression status, such as Figure 3 As shown, the results indicate that FGSG_09291 can induce the expression of the maize-related defense gene LOX3, thereby enhancing maize's resistance.
[0076] Disease control status on day 7 after SCMV-GFP inoculation is as follows: Figure 4 As shown, the results indicate that compared with the control group, the symptoms of the disease in the treatment group were significantly reduced, and the SCMV virus accumulation was significantly lower in the treatment group than in the control group.
[0077] In summary, exogenous application of FGSG_09291 protein can enhance the control effect of maize against maize dwarf mosaic virus.
[0078] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.
Claims
1. The application of FGSG_09291 protein in improving plant disease resistance, characterized in that, The FGSG_09291 protein is any one of the proteins shown in (A1)-(A3) below: (A1) A protein consisting of the amino acid sequence shown in SEQ ID NO.1 of the sequence listing; (A2) A protein consisting of the amino acid sequence shown in SEQ ID NO.3 of the sequence listing; (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1) or (A2); The disease resistance refers to resistance to diseases caused by sugarcane mosaic virus; The plant in question is corn.
2. The application according to claim 1, characterized in that, The FGSG_09291 protein enhances plant disease resistance by activating plant immunity.
3. The application according to claim 2, characterized in that, The FGSG_09291 protein activates plant immunity through at least one of the following pathways (1)-(3): (1) Promote PR1a Genes and WRKY70 Gene expression; (2) Promotes the burst of reactive oxygen species in plants; (3) Promotes the accumulation of callose in plants.
4. The application of the gene encoding the FGSG_09291 protein in improving plant disease resistance, characterized by: The gene encoding the FGSG_09291 protein is a nucleic acid molecule as shown in i), ii), iii), or iv) below: i) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.2; ii) Nucleic acid molecules other than those in i) encoding the amino acid sequence shown in SEQ ID NO. 1; iii) The nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.4; iv) Nucleic acid molecules other than iii) encoding the amino acid sequence shown in SEQ ID NO. 3; Enhance plant disease resistance by promoting the expression of the gene encoding the FGSG_09291 protein; The disease resistance refers to resistance to diseases caused by sugarcane mosaic virus; The plant in question is corn.
5. The application according to claim 4, characterized in that, The substance that promotes the expression of the gene encoding the FGSG_09291 protein is any one of the following: C1) Expression cassette containing the gene encoding the FGSG_09291 protein; C2) A recombinant vector containing the gene encoding the FGSG_09291 protein, or a recombinant vector containing the expression cassette described in C1); C3) Recombinant microorganisms containing the gene encoding the FGSG_09291 protein, or recombinant microorganisms containing the expression cassette described in C1), or recombinant microorganisms containing the recombinant vector described in C2).
Citation Information
Patent Citations
Pectin degrading enzymes from macrophomina phaseolina and uses thereof
CN104837991A
Plant immune induced resistance protein FgPII1 secreted by fusarium graminearum and application of plant immune induced resistance protein FgPII1
CN110922457A