A method for improving gene editing efficiency in citrus based on cloning the citrus U6 promoter.
By cloning the endogenous U6 promoter CsU6.1 of citrus and constructing an sgRNA vector, the problem of low gene editing efficiency in citrus was solved, achieving 100% gene editing efficiency and supporting efficient and precise citrus variety improvement.
Patent Information
- Application Number
- CN202610329082.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-18
- Publication Date
- 2026-05-26
- Estimated Expiration
- 2046-03-18
AI Technical Summary
Current citrus gene editing technology is inefficient, making it difficult to achieve efficient and precise variety improvement.
By cloning the endogenous U6 promoter CsU6.1 in citrus to drive sgRNA expression, the pNGerRGEB32-CsU6.1-sgRNA gene editing vector was constructed, and citrus was transformed using Agrobacterium tumefaciens-mediated transformation to achieve efficient editing of the target site.
The expression level of sgRNA driven by the CsU6.1 promoter was upregulated by up to 2.31 times, and the gene editing efficiency reached 100%, realizing the efficient and precise improvement of the citrus CRISPR/Cas9 gene editing system.
Smart Images

Figure CN121852388B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a method for improving the efficiency of citrus gene editing based on cloning the citrus U6 promoter. Background Technology
[0002] Clustered regularly interspaced short palindromic repeats (CRISPR) are a complex autoimmune defense mechanism derived from bacteria and archaea, used to defend against invasion by bacteriophages or conjugation plasmids. The CRISPR / Cas system mainly consists of two parts: the CRISPR array and the Cas gene. Due to its ease of operation, high efficiency, and wide applicability, the CRISPR / Cas system has become a revolutionary tool in the life sciences, enabling the rapid creation of germplasm with beneficial traits and the development of sustainable agricultural systems. Currently, the CRISPR / Cas system is widely used in various plant species to generate heritable mutations through gene editing, such as monocotyledonous rice (Zhou et al., 2019), maize (Gao et al., 2020), and wheat (Zhang et al., 2018), as well as dicotyledonous Arabidopsis (Liu et al., 2018), tomato (Yuste-lisbona et al., 2020), and citrus (Peng et al., 2017).
[0003] In most CRISPR / Cas systems, transcription of crRNA or sgRNA is driven by RNA polymerase type III promoters U6 or U3. U6 and U3 promoters do not cap or polyadenylate when driving non-coding RNA transcription, making them particularly suitable for driving the transcription of small RNA molecules that require only transcription and not translation. Studies have shown that U6 and U3 promoters are species-specific, and using the species-specific U6 or U3 promoters to drive crRNA or sgRNA expression can achieve higher gene editing efficiency. Currently, two U6 promoters, CsU6-2 and CsU6-7, have been cloned in the citrus genome (Huang et al., 2020). The DNA sequences of the CsU6-2 and CsU6-7 promoters are 664 and 521 bp, respectively. Studies have shown that the transcriptional activity of the U6 promoter is inversely proportional to its sequence length (Lei et al., 2016). Therefore, further truncating the existing CsU6 promoter in citrus and finding the CsU6 promoter with the highest transcriptional activity is crucial for improving the efficiency of CRISPR / Cas-mediated citrus gene editing and has positive significance for the development of citrus gene breeding technology. Summary of the Invention
[0004] This invention aims to address the technical problem of improving the efficiency of citrus gene editing and achieving efficient and precise citrus variety improvement. The goal is to provide a method based on citrus U6 promoter cloning to enhance citrus gene editing efficiency. By driving the upregulation of sgRNA expression through the CsU6.1 promoter, the target site is edited, achieving a gene editing efficiency of 100%. Applied to the citrus CRISPR / Cas9 gene editing system, this method effectively improves gene editing efficiency, thereby enabling efficient and precise citrus variety improvement.
[0005] This invention is achieved through the following technical solution:
[0006] A method for improving citrus gene editing efficiency based on citrus U6 promoter cloning includes:
[0007] (1) The promoter CsU6.1 was amplified by PCR using the genomic DNA of Late Orange leaf as a template. The amplified fragment was recovered and ligated into the linearized pNGerRGEB32 vector to obtain the pNGerRGEB32-CsU6.1 vector containing the CsU6.1 promoter. The nucleotide sequence of the promoter CsU6.1 is SEQ ID NO.1.
[0008] (2) Using pNGerRGEB32-CsU6.1 as a template, primers containing the target sequence were designed for PCR amplification, the amplified product fragment was recovered, and the linearized pNGerRGEB32-CsU6.1 vector was ligated to obtain the pNGerRGEB32-CsU6.1-sgRNA gene editing vector containing the target sequence.
[0009] (3) Transform citrus fruits with the pNGerRGEB32-CsU6.1-sgRNA gene editing vector.
[0010] Furthermore, in step (1), the PCR amplification uses specific primers CsU6.1-F1 and CsU6-R1 containing homologous recombination arms, with nucleotide sequences SEQ ID NO.4 and SEQ ID NO.3, respectively.
[0011] Further, the recovery of the amplification product and ligation into the linearized pNGerRGEB32 vector in step (1) specifically involves:
[0012] The pNGerRGEB32 plasmid was double-digested with HindIII and AvrII, and ligated with the amplified fragment using In-fusion homologous recombinase. The ligation product was transformed into E. coli DH5α and single clones were picked for sequencing to obtain the pNGerRGEB32-CsU6.1 vector containing the CsU6.1 promoter.
[0013] Further, in step (2), the PCR amplification uses CsU6-R2 containing the target sequence as the downstream primer and CsU6.1-F1 as the upstream primer, and the nucleotide sequence of CsU6-R2 is SEQ ID NO.5.
[0014] Further, in step (2), the amplified product fragment is recovered and ligated into the linearized pNGerRGEB32-CsU6.1 vector as follows:
[0015] The pNGerRGEB32-CsU6.1 plasmid was double-digested with HindIII and AvrII, and ligated with the amplified fragment using In-fusion homologous recombinase. The ligation product was transformed into E. coli DH5α, and single clones were picked for sequencing to obtain the pNGerRGEB32-CsU6.1-sgRNA gene editing vector containing the target sequence.
[0016] Further, in step (3), the pNGerRGEB32-CsU6.1-sgRNA gene editing vector was genetically transformed into citrus using Agrobacterium tumefaciens-mediated transformation.
[0017] Furthermore, the Agrobacterium tumefaciens-mediated method specifically includes:
[0018] The pNGerRGEB32-CsU6.1-sgRNA gene editing vector was transformed into Agrobacterium tumefaciens EHA105 via freeze-thaw method, and then citrus epicotyl explants were transformed using Agrobacterium tumefaciens-mediated transformation. Adventitious buds growing from the explant wounds were identified by GFP green fluorescence, grafting, and PCR to obtain transgenic citrus plants.
[0019] Furthermore, the primers used for PCR identification of transgenic citrus plants are Cas9-F and Cas9-R, with nucleotide sequences SEQ ID NO.6 and SEQ ID NO.7, respectively.
[0020] Furthermore, the study also included the analysis of sgRNA expression levels in transgenic citrus plants using qRT-PCR, with primers sgRNA-F and sgRNA-R, whose nucleotide sequences are SEQ ID NO.8 and SEQ ID NO.9, respectively.
[0021] Furthermore, it also includes the detection of mutations at target sites in transgenic plants to verify gene editing efficiency.
[0022] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0023] 1. This invention clones the citrus endogenous U6 promoter CsU6.1 from citrus. This promoter is only 72 bp in length and can effectively drive the expression of downstream sgRNA. Compared with the expression level of sgRNA driven by the CsU6-7 promoter of the same origin, the expression level of sgRNA driven by CsU6.1 is upregulated by up to 2.31 times.
[0024] 2. This invention utilizes the CsU6.1 promoter to drive sgRNA expression for target site editing. Sanger sequencing revealed a gene editing efficiency of 100%. However, using the CsU6-7 promoter to drive the same sgRNA expression resulted in a gene editing efficiency of 40%. These results validate the activity of the CsU6.1 promoter and its feasibility for application in citrus CRISPR / Cas9 gene editing systems. Therefore, the CsU6.1 promoter cloned in this invention can be effectively applied to citrus CRISPR / Cas9 gene editing systems, thereby achieving efficient and precise citrus variety improvement. Attached Figure Description
[0025] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below. It should be understood that the following drawings only show some embodiments of the present invention and should not be considered as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort. In the drawings:
[0026] Figure 1 A diagram illustrating the construction of a citrus gene editing vector that drives sgRNA expression via the CsU6.1 promoter;
[0027] Figure 2 The relative expression levels of sgRNA in transgenic plants; where CsU6-7-1, CsU6-7-2, CsU6-7-3, CsU6-7-4 and CsU6-7-5 represent the numbers of 5 transgenic plants containing the CsU6-7 promoter; CsU6.1-1, CsU6.1-2, CsU6.1-3 and CsU6.1-4 represent the numbers of 4 transgenic plants containing the CsU6.1 promoter described in this invention.
[0028] Figure 3 Sequencing analysis of target sites in CsU6.1-1, CsU6.1-2, CsU6.1-3 and CsU6.1-4 mutant plants. Detailed Implementation
[0029] To make the objectives, technical solutions, and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the illustrative embodiments and descriptions of the present invention are only used to explain the present invention and are not intended to limit the present invention.
[0030] The following detailed description, with appropriate reference to the accompanying drawings, outlines an embodiment of the method for improving citrus gene editing efficiency based on citrus U6 promoter cloning. However, unnecessary details may be omitted. For example, detailed descriptions of well-known facts and repetitive descriptions may be omitted. This is to avoid unnecessarily lengthy explanations and to facilitate understanding by those skilled in the art.
[0031] The "scope" disclosed in this invention is defined in the form of a lower limit and an upper limit. A given scope is defined by selecting a lower limit and an upper limit, which define the boundaries of the specific scope. The scope defined in this way can include or exclude end values, and can be arbitrarily combined; that is, any lower limit can be combined with any upper limit to form a scope.
[0032] Unless otherwise specified, all embodiments and optional embodiments of the present invention can be combined with each other to form new technical solutions.
[0033] Unless otherwise specified, all technical features and optional technical features of this invention can be combined to form new technical solutions.
[0034] Unless otherwise specified, the terms "comprising" and "including" as used in this invention can be open-ended or closed-ended. For example, "comprising" and "including" can mean that other substances not listed may also be included, or that only the listed substances may be included.
[0035] Unless otherwise specified, all steps of the present invention may be performed sequentially or randomly, preferably sequentially. For example, the method includes steps (a) and (b), indicating that the method may include steps (a) and (b) performed sequentially, or it may include steps (b) and (a) performed sequentially. For example, the mention that the method may also include step (c) indicates that step (c) may be added to the method in any order. For example, the method may include steps (a), (b), and (c), or it may include steps (a), (c), and (b), or it may include steps (c), (a), and (b), etc.
[0036] The technical solution of the present invention will be further described in detail below with reference to the embodiments.
[0037] It should be noted that, unless otherwise specified, the experimental methods used in the embodiments are conventional methods. Unless otherwise specified, the materials, reagents, methods, and instruments used are all conventional materials, reagents, methods, and instruments in the art, and can be obtained commercially by those skilled in the art.
[0038] Example 1
[0039] Cloning of the citrus CsU6.1 promoter
[0040] Genomic DNA was extracted from 100 mg of late-blooming orange leaves using a DNA extraction kit (Adley, CAT: DN15). The promoter fragments of CsU6-7 (521 bp) and its truncated CsU6.1 (72 bp) from the citrus genome were amplified by PCR in a 50 μl reaction system using the high-fidelity enzyme PrimeSTAR Max DNA Polymerase. The primer pairs used were CsU6-7-F1 (SEQ ID NO.2) / CsU6-R1 (SEQ ID NO.3) and CsU6.1-F1 (SEQ ID NO.4) / CsU6-R1 (SEQ ID NO.3), respectively. After agarose gel electrophoresis, the agarose gel containing the target fragment was cut off under UV light with a clean blade, and the amplified fragment was recovered using a gel recovery kit (BioFlux, CAT: BSC02M1). PCR reaction conditions: 95℃ for 3 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 32 cycles; 72℃ for 10 min.
[0041] The pNGerRGEB32 plasmid was double-digested with HindIII and AvrII, and the vector backbone sequence was recovered. The two recovered amplified fragments were ligated into the linearized pNGerRGEB32 vector using in-fusion homologous recombination enzyme. The ligation products were transformed into *E. coli* DH5α, and single colonies were picked for sequencing, yielding pNGerRGEB32-CsU6-7 and pNGerRGEB32-CsU6.1 vectors containing the CsU6-7 and CsU6.1 promoters, respectively. The homologous recombination system consisted of: 1 µL in in-fusion, 2 µL of linearized pNGerRGEB32 plasmid, 5 µL of PCR product, and 2 µL of ddH2O. The reaction program was 50 °C for 30 min.
[0042] The nucleotide sequences involved in this embodiment are as follows:
[0043] pNGerRGEB32 vector nucleotide sequence (SEQ ID NO.14):
[0044]
[0045] Promoter CsU6.1 nucleotide sequence (SEQ ID NO.1):
[0046] GAACTAAATCCCACATCGTCTAGTTGCGCTTCGTTGAGAGTCTTAATATAATCATAACCAACCAGTGCGATT
[0047] Amplification primer CsU6-7-F1 nucleotide sequence (SEQ ID NO.2):
[0048] GATTACGCCaagcttTGTTGTGCGGGATCTTTTAA
[0049] Amplification primer CsU6-R1 nucleotide sequence (SEQ ID NO.3):
[0050] CTCTAAAACCCTAGGAATCGCACTGGTTGG
[0051] Amplification primer CsU6.1-F1 nucleotide sequence (SEQ ID NO.4):
[0052] GATTACGCCAAGCTTGAACTAAATCCCACATCGTC.
[0053] Example 2
[0054] Construction of Citrus Gene Editing Vector
[0055] Using pNGerRGEB32-CsU6-7 and pNGerRGEB32-CsU6.1 as templates, PCR amplification was performed using homologous recombination primer pairs CsU6-7-F1 / CsU6-R2 (SEQ ID NO.5) and CsU6.1-F1 / CsU6-R2, respectively. The amplification products were recovered, yielding DNA fragments containing CsU6-7 and target sequences, as well as CsU6.1 promoter and target sequences. The PCR reaction conditions and fragment recovery were performed using the same methods described above. The pNGerRGEB32-CsU6-7 and pNGerRGEB32-CsU6.1 plasmids were double-digested with HindIII and AvrII, respectively. The backbone sequence of the vector was recovered. The recovered amplified fragments were ligated with linearized pNGerRGEB32-CsU6-7 and pNGerRGEB32-CsU6.1 vectors respectively using in-fusion homologous recombinase. The ligation products were transformed into E. coli DH5α, and single clones were picked for sequencing to obtain pNGerRGEB32-CsU6-7-sgRNA and pNGerRGEB32-CsU6.1-sgRNA vectors containing the target sequence. The homologous recombination system and reaction procedure were the same as above. The pNGerRGEB32-CsU6-7-sgRNA and pNGerRGEB32-CsU6.1-sgRNA plasmids were transformed into Agrobacterium strain EHA105 by freeze-thaw method for genetic transformation of citrus. The construction diagram of the citrus gene editing vector with CsU6.1 promoter-driven sgRNA expression in this invention is shown in the figure. Figure 1 As shown.
[0056] The nucleotide sequences involved in this embodiment are as follows:
[0057] CsU6-R2 nucleotide sequence (SEQ ID NO.5):
[0058] GCTATTTCTAGCTCTAAAACCTCTCTCCGCCGCCTATAGTCAATCACTACTTCGACTCTAG
[0059] Example 3
[0060] Gene editing vector for genetic transformation of citrus
[0061] Wash the fruit of the late-ripening orange, surface sterilize with 75% alcohol, and aseptically extract the seeds. Peel off the seed coat and inoculate them onto MS medium (PhytoTechnology Laboratories™, M519) supplemented with 30 g / L sucrose and 8 g / L agar. Incubate in the dark at 28°C for 2 weeks, followed by 1 week of culture under a 16 h light / 8 h dark photoperiod. Under aseptic conditions, cut the epicotyl of the germinating seedlings into stem segments of about 1 cm for Agrobacterium tumefaciens-mediated citrus genetic transformation.
[0062] Two days before transformation, Agrobacterium tumefaciens cultures containing pNGerRGEB32-CsU6-7-sgRNA and pNGerRGEB32-CsU6.1-sgRNA vectors were plated separately onto LB agar plates supplemented with 50 mg / L kanamycin. Single colonies of Agrobacterium tumefaciens were picked and inoculated into 10 mL of LB liquid medium containing the same antibiotic, and cultured overnight at 28°C and 220 rpm with shaking. The OD value of the bacterial suspension was measured using a spectrophotometer. The bacterial suspension was diluted with the above-mentioned LB liquid medium to a value of 0.1. Under the same conditions as above, the suspension was cultured with shaking, and the OD value of the bacterial suspension was monitored. When the OD value reached 0.5, the bacterial suspension was collected in a 50 mL sterile centrifuge tube and centrifuged at 5000 r / min for 15 min. The supernatant was discarded, and the suspension was resuspended in liquid medium containing 50 mM 2-(N-morpholino)ethanesulfonic acid, 10 mM magnesium chloride, and 20 μM acetylsyleugenone at pH 5.6. The suspension was then incubated at 28℃ in the dark for 3 h before being used for citrus genetic transformation.
[0063] Immerse approximately 1 cm long epicotyl stem segments of late-ripening orange in Agrobacterium tumefaciens solution for 13 min, gently agitating them during this time. After removing the stem segments, blot the surface of the bacterial solution with sterile filter paper. Transfer the stem segments to MS solid medium supplemented with 1 mg / L N6-isopentenyladenine, 0.5 mg / L indoleacetic acid (IAA), 1 mg / L 2,4-dichlorophenoxyacetic acid, 100 μM acetylsyleugenone, 30 g / L sucrose, and 8 g / L agar. Co-culture at 26°C in the dark for 3 days.
[0064] After co-culture, the epicotyls were transferred to MS solid medium supplemented with 2 mg / L 6-benzylaminopurine (6-BA), 0.5 mg / L IAA, 50 mg / L kanamycin, 500 mg / L cephalosporin, 30 g / L sucrose and 8 g / L agar. After 7 days of dark culture at 28°C, they were transferred to a photocycle of 28°C, 16 h light / 8 h dark, and subcultured every two weeks.
[0065] Adventitious buds sprouting from wounds at both ends of the epicotyl stem segment were identified by GFP fluorescence; those exhibiting green fluorescence were determined to be GFP-positive buds.
[0066] When the stem of the GFP-positive bud is about 0.5 cm long, cut it horizontally and micrograft it onto the trifoliate orange rootstock under sterile conditions. After the graft union has fully healed, cut the GFP-positive bud horizontally from the base of the trifoliate orange rootstock and graft it onto the field trifoliate orange rootstock according to the field grafting method. Keep it moist with a plastic bag for 2 weeks. Remove the plastic bag after it has taken root.
[0067] Example 4
[0068] PCR detection of transgenic plants
[0069] Three months after GFP-positive buds were grafted into the field, 100 mg of leaves were collected, and genomic DNA was extracted using a DNA extraction kit (Adley, CAT: DN15). PCR was then used to detect Cas9 gene integration. PCR reaction conditions were: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 32 cycles; 72℃ for 5 min. The detection primers were Cas9-F and Cas9-R, with nucleotide sequences shown in SEQ ID NO.6 and SEQ ID NO.7, respectively. Positive plants yielded a 755 bp amplified fragment, while wild-type Late Jin Orange plants showed no corresponding amplified band. PCR testing yielded 5 transgenic plants containing the CsU6-7 promoter (named CsU6-7-1, CsU6-7-2, CsU6-7-3, CsU6-7-4 and CsU6-7-5, respectively) and 4 transgenic plants containing the CsU6.1 promoter (named CsU6.1-1, CsU6.1-2, CsU6.1-3 and CsU6.1-4, respectively).
[0070] The nucleotide sequences involved in this embodiment are as follows:
[0071] Detection primer Cas9-F nucleotide sequence (SEQ ID NO.6): CAGAGCTTCATCGAGCGGAT
[0072] Detection primer Cas9-R nucleotide sequence (SEQ ID NO.7): GTCTGCAGGATGCCCTTCTT
[0073] Example 5
[0074] Expression analysis of sgRNA in transgenic plants
[0075] Total RNA (Adelaide, CAT No: RN09) was extracted from leaves of transgenic plants. RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a NanoDrop 2000 Thermo concentration meter. 500 ng of RNA was used to extract RNA via iScript. TM 10 μL of cDNA was synthesized using the cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) and diluted 5-fold. sgRNA expression was detected using real-time quantitative PCR with primers sgRNA-F and sgRNA-R, whose nucleotide sequences are shown in SEQ ID NO. 8 and SEQ ID NO. 9, respectively. The citrus Actin gene was used as an internal control for quantitative PCR, with primers Actin-F and Actin-R, whose nucleotide sequences are shown in SEQ ID NO. 10 and SEQ ID NO. 11, respectively. The reaction mixture consisted of 6 μL of iTaq™ Universal SYBR®, 0.3 μL each of 10 μmol / L sgRNA-F and sgRNA-R, 1 μL of cDNA, and ddH2O to a final volume of 12 μL. The reaction conditions were: 95℃ for 3 min, 94℃ for 10 s; 56℃ for 10 s, 72℃ for 10 s, for 40 cycles; 72℃ for 10 min. The experiment was repeated three times. Transgenic plants containing the CsU6-7 promoter were used as a control, and 2... -△△Ct The relative expression level of sgRNA in transgenic plants containing the CsU6.1 promoter was calculated.
[0076] Test results are shown Figure 2Using the CsU6-7-3 transgenic plant, which had the highest sgRNA expression level among transgenic plants containing the CsU6-7 promoter, as a control, the expression levels of sgRNA in CsU6-7-1, CsU6-7-2, CsU6-7-4, CsU6-7-5, CsU6.1-1, CsU6.1-2, CsU6.1-3, and CsU6.1-4 were 0.91±0.29, 0.59±0.02, 0.80±0.18, 0.69±0.01, 2.31±0.50, 1.84±0.34, 1.83±0.14, and 1.76±0.15, respectively. Significance analysis showed that sgRNA expression levels in CsU6.1-1, CsU6.1-2, CsU6.1-3, and CsU6.1-4 transgenic plants were significantly higher than those in the control, while there was no significant difference in sgRNA expression levels among the CsU6.1-1, CsU6.1-2, CsU6.1-3, and CsU6.1-4 transgenic plants. Compared with the control plant (CsU6-7-3) (i.e., the expression level of the control plant was taken as 1), the expression level of sgRNA in transgenic plants containing the CsU6.1 promoter was upregulated by up to 2.31-fold.
[0077] The nucleotide sequences involved in this embodiment are as follows:
[0078] Primer sgRNA-F nucleotide sequence (SEQ ID NO.8): GTTTAGAGCTAGAAATAGC
[0079] Primer sgRNA-R nucleotide sequence (SEQ ID NO.9): GCACCGACTCGGTGCCACTT
[0080] Primer Actin-F nucleotide sequence (SEQ ID NO.10): CATCCCTCAGCACCTTCCAGC
[0081] Primer Actin-R nucleotide sequence (SEQ ID NO.11): CCAACCTTAGCACTTCTCCATGTC
[0082] Example 6
[0083] Mutation detection of target sites in transgenic plants
[0084] Using the DNA extracted in Example 4 as a template, and using target detection-F (SEQ ID NO. 12) and target detection-R (SEQ ID NO. 13) as primers, PCR amplification was performed in a 50 μl reaction system using the high-fidelity enzyme PrimeSTAR Max DNA Polymerase. The PCR reaction conditions were the same as in Example 1. After agarose gel electrophoresis, a 461 bp fragment was recovered using a gel extraction kit. The recovered product was ligated into the pGEM-T vector, transformed into E. coli DH5α, and single colonies were picked for Sanger sequencing. The sequencing results showed that gene editing occurred at the target sites in the transgenic plants CsU6-7-1, CsU6-7-3, CsU6.1-1, CsU6.1-2, CsU6.1-3, and CsU6.1-4. Gene editing efficiency = number of transgenic plants with gene editing / total number of transgenic plants. According to the formula, the gene editing efficiency obtained by the pNGerRGEB32-CsU6-7-sgRNA gene editing vector is 40%, while the gene editing efficiency obtained by transforming citrus with the pNGerRGEB32-CsU6.1-sgRNA gene editing vector is 100%. Figure 3 ).
[0085] The nucleotide sequences involved in this embodiment are as follows:
[0086] Nucleotide sequence of target detection-F (SEQ ID NO.12): TCCTCCTCATCCCTTACTGTCT
[0087] Nucleotide sequence of target detection-R (SEQ ID NO.13): AAGAAGTGCATACCTGCAAGA
[0088] Therefore, the citrus RNA polymerase III promoter CsU6.1 obtained in this invention can effectively drive the expression of downstream sgRNA, achieving efficient citrus genome editing. Thus, the CsU6.1 promoter described in this invention can be applied to the citrus CRISPR / Cas gene editing system, thereby achieving efficient and precise citrus variety improvement.
[0089] Finally, it should be noted that the above specific embodiments are only used to describe the purpose, technical solution, and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation of the present invention and is not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the foregoing specific embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions or improvements can be made to some or all of the technical features. These modifications, equivalent substitutions, and improvements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be covered within the scope of the claims and specification of the present invention.
Claims
1. A method for improving the efficiency of citrus gene editing based on cloning the citrus U6 promoter, characterized in that, include: (1) Using the genomic DNA of Late Orange leaves as a template, the promoter CsU6.1 was amplified by PCR, the amplified fragment was recovered and ligated into the linearized pNGerRGEB32 vector to obtain the pNGerRGEB32-CsU6.1 vector containing the CsU6.1 promoter; the nucleotide sequence of the promoter CsU6.1 is SEQ ID NO.1, and the nucleotide sequence of the pNGerRGEB32 vector is SEQ ID NO.14; (2) Using pNGerRGEB32-CsU6.1 as a template, primers containing the target sequence were designed for PCR amplification, the amplified product fragment was recovered, and the linearized pNGerRGEB32-CsU6.1 vector was ligated to obtain the pNGerRGEB32-CsU6.1-sgRNA gene editing vector containing the target sequence. (3) Transform citrus fruits with the pNGerRGEB32-CsU6.1-sgRNA gene editing vector.
2. The method for improving citrus gene editing efficiency based on citrus U6 promoter cloning according to claim 1, characterized in that, In step (1), PCR amplification uses specific primers CsU6.1-F1 and CsU6-R1 containing homologous recombination arms, with nucleotide sequences SEQ ID NO.4 and SEQ ID NO.3, respectively.
3. The method for improving citrus gene editing efficiency based on citrus U6 promoter cloning according to claim 1, characterized in that, The specific steps in step (1) involving the recovery of the amplified product and ligation into the linearized pNGerRGEB32 vector are as follows: The pNGerRGEB32 plasmid was double-digested with HindIII and AvrII, and ligated with the amplified fragment using In-fusion homologous recombinase. The ligation product was transformed into E. coli DH5α and single clones were picked for sequencing to obtain the pNGerRGEB32-CsU6.1 vector containing the CsU6.1 promoter.
4. A method for improving citrus gene editing efficiency based on citrus U6 promoter cloning according to claim 2, characterized in that, In step (2), PCR amplification uses CsU6-R2 containing the target sequence as the downstream primer and CsU6.1-F1 as the upstream primer. The nucleotide sequence of CsU6-R2 is SEQ ID NO.
5.
5. The method for improving citrus gene editing efficiency based on citrus U6 promoter cloning according to claim 1, characterized in that, In step (2), the amplified product fragment is recovered and ligated into the linearized pNGerRGEB32-CsU6.1 vector, specifically as follows: The pNGerRGEB32-CsU6.1 plasmid was double-digested with HindIII and AvrII, and ligated with the amplified fragment using In-fusion homologous recombinase. The ligation product was transformed into E. coli DH5α, and single clones were picked for sequencing to obtain the pNGerRGEB32-CsU6.1-sgRNA gene editing vector containing the target sequence.
6. The method for improving citrus gene editing efficiency based on citrus U6 promoter cloning according to claim 1, characterized in that, In step (3), the pNGerRGEB32-CsU6.1-sgRNA gene editing vector was genetically transformed into citrus using Agrobacterium tumefaciens-mediated transformation.
7. The method for improving citrus gene editing efficiency based on citrus U6 promoter cloning according to claim 6, characterized in that, The Agrobacterium tumefaciens-mediated method specifically includes: The pNGerRGEB32-CsU6.1-sgRNA gene editing vector was transformed into Agrobacterium tumefaciens EHA105 via freeze-thaw method, and then citrus epicotyl explants were transformed using Agrobacterium tumefaciens-mediated transformation. Adventitious buds growing from the explant wounds were identified by GFP green fluorescence, grafting, and PCR to obtain transgenic citrus plants.
8. A method for improving citrus gene editing efficiency based on citrus U6 promoter cloning according to claim 7, characterized in that, The primers used for PCR identification of transgenic citrus plants were Cas9-F and Cas9-R, with nucleotide sequences SEQ ID NO.6 and SEQ ID NO.7, respectively.
9. A method for improving citrus gene editing efficiency based on citrus U6 promoter cloning according to claim 7, characterized in that, It also includes the analysis of sgRNA expression levels in transgenic citrus plants using qRT-PCR, with primers sgRNA-F and sgRNA-R, and nucleotide sequences SEQ ID NO.8 and SEQ ID NO.9, respectively.
10. The method for improving citrus gene editing efficiency based on citrus U6 promoter cloning according to claim 7, characterized in that, It also includes detecting mutations at target sites in transgenic plants to verify gene editing efficiency.
Citation Information
Patent Citations
Rubber tree U6 gene promoter proHbU6.8 and cloning and application thereof
CN110157709A
RNA guide genome editing in citrus using crispr-ribonucleoprotein complexes
WO2021026081A2