Application of HA7 protein and its encoding gene in regulating rice plant height and grain traits

By overexpressing and editing the HA7 protein and its encoding gene, rice plant height, leaf shape, and grain traits are synergistically regulated, solving the problem of balancing plant type and yield in rice breeding that is difficult to achieve in existing technologies, and achieving efficient and precise breeding results.

CN121852465BActive Publication Date: 2026-06-30SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2026-03-17
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

The lack of pleiotropic genes in existing technologies that can synergistically regulate rice plant height, leaf shape, and grain traits makes it difficult to achieve a balance between ideal plant type and high yield in rice breeding.

Method used

By utilizing the HA7 protein and its encoding gene, overexpression or gene editing techniques can be used to regulate rice plant height, leaf shape, and grain traits, achieving multiple breeding objectives, including reducing plant height, increasing leaf curl, and optimizing canopy structure.

Benefits of technology

It enables precise control over rice plant height, leaf shape, and grain traits, improves breeding efficiency, avoids the yield decline problem in traditional methods, and provides new breeding resources and technical approaches.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852465B_ABST
    Figure CN121852465B_ABST
Patent Text Reader

Abstract

This invention relates to the field of plant genetic engineering technology, specifically providing the application of the HA7 protein and its encoding gene in regulating rice plant height and grain traits. This invention obtains a dominant leaf-curling mutant through EMS mutagenesis. ha7, Research has found that, ha7 mutants and HA7 Overexpression plants all exhibited significantly reduced plant height, extreme leaf curling, and smaller grains, while knockout plants showed no significant changes in these phenotypes except for plant height. This invention can be used for targeted improvement of rice plant architecture, breeding new varieties with ideal canopy structure and optimized grain traits, which is of great significance for improving rice photosynthetic efficiency, lodging resistance, and yield potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology and relates to the application of HA7 protein and its encoding gene in regulating rice plant height and grain traits. Background Technology

[0002] Rice is one of the world's most important food crops, and its yield is directly related to food security. Plant architecture is a key factor affecting the light energy utilization efficiency, lodging resistance, and final yield of rice canopies. Among these factors, leaves, as the main organs of photosynthesis, have morphological characteristics (such as length, width, curling, and uprightness) that directly influence canopy structure, light distribution, and photosynthetic efficiency. Moderately curled and upright leaves can reduce mutual shading and improve canopy photosynthetic efficiency, and are considered important characteristics of ideal plant architecture. Therefore, identifying and utilizing key genes that regulate leaf shape and plant architecture is of significant strategic importance for high-yield rice breeding.

[0003] Zinc finger proteins are one of the largest families of transcription factors in eukaryotes, participating in DNA binding, protein interactions, and the regulation of various biological processes through their unique "finger-like" domains. In plants, zinc finger proteins have been widely reported to participate in abiotic stress responses (such as drought, salinity, and low temperature) and biotic stress resistance. However, compared to the in-depth research on their stress resistance, the specific functions and mechanisms of action of zinc finger proteins in plant growth, development, and morphogenesis (such as leaf shape regulation), especially in rice, are still poorly understood, greatly limiting the precise application of this family of genes in crop architecture improvement.

[0004] Currently, although some genes that regulate rice leaf shape have been cloned and their functions analyzed, such as regulating leaf curling by affecting vesicular cells, sclerenchyma, or hormone pathways, the following limitations still exist: (1) Most genes have a single function or a complex regulatory network, making it difficult to achieve precise improvement; (2) Mutations or manipulations of many genes often accompany other unfavorable agronomic traits (such as a severe decrease in yield) while improving leaf shape; (3) There is a lack of systematic research and application exploration of transcription factors that have pleiotropic effects (i.e., simultaneously regulate multiple important traits) and well-defined functions, especially members of the zinc finger protein family.

[0005] Therefore, there is an urgent need in this field to identify new, functionally defined, and application-potential leaf shape and plant type regulatory genes, especially key regulatory factors that can synergistically regulate multiple ideal agronomic traits (such as moderate leaf curling, short stalks, and optimized grain size), and to elucidate their molecular mechanisms, so as to provide new gene resources and theoretical basis for molecular design breeding of rice. Summary of the Invention

[0006] This invention aims to provide a novel molecular breeding strategy based on the zinc finger protein transcription factor HA7 and its encoding gene. By utilizing gain-of-function mutations or overexpression of this gene, multiple important traits of rice, such as plant height, leaf shape, grain size, and leaf physiology, can be synergistically regulated. This will enable the targeted creation of new rice varieties with ideal plant type characteristics such as short stalks, moderate leaf curling, and high light-efficiency canopy structure, providing a new genetic resource and key technological approach for high-yield molecular design breeding of rice.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] The HA7 protein described in this invention is an IDD family zinc finger protein, and its amino acid sequence is shown in SEQ ID NO.1; the nucleotide sequence of the nucleic acid molecule encoding this HA7 protein is shown in SEQ ID NO.2. This HA7 protein contains two highly conserved C2H2 zinc finger domains (amino acid positions 96-118 and 173-193), is located in the cell nucleus, and can participate in gene expression regulation as a transcription factor. Its encoding gene is constitutively expressed in rice roots, stems, leaves, sheaths, and other tissues, playing a role throughout the entire process of plant growth and development.

[0009] In a first aspect, the present invention provides the application of genes overexpressing HA7 protein, wherein the application is any of the following:

[0010] A1) Application in reducing rice plant height, and / or increasing rice leaf curl, and / or increasing rice grain length, and / or decreasing rice grain width, and / or decreasing rice grain thickness, and / or reducing rice thousand-grain weight, and / or increasing rice leaf stomatal density, and / or reducing rice leaf chlorophyll content.

[0011] A2) Application in the preparation of rice with reduced plant height, and / or increased leaf curl, and / or increased grain length, and / or decreased grain width, and / or decreased grain thickness, and / or reduced thousand-grain weight, and / or increased leaf stomatal density, and / or decreased leaf chlorophyll content.

[0012] Secondly, the present invention provides applications of biomaterials related to the HA7 protein, wherein the applications are any of the following:

[0013] A1) Application in reducing rice plant height, and / or increasing rice leaf curl, and / or increasing rice grain length, and / or decreasing rice grain width, and / or decreasing rice grain thickness, and / or reducing rice thousand-grain weight, and / or increasing rice leaf stomatal density, and / or reducing rice leaf chlorophyll content.

[0014] A2) Application in the preparation of rice with reduced plant height and / or increased leaf curl, and / or increased grain length, and / or decreased grain width, and / or decreased grain thickness, and / or reduced thousand-grain weight, and / or increased leaf stomatal density, and / or decreased leaf chlorophyll content.

[0015] The biomaterial is any one of B1) to B3) below:

[0016] B1) An expression cassette containing a nucleic acid molecule encoding the HA7 protein;

[0017] B2) Recombinant vectors containing nucleic acid molecules encoding the HA7 protein;

[0018] B3) A recombinant microorganism containing a nucleic acid molecule encoding the HA7 protein, or a recombinant microorganism containing the expression cassette described in B1), or a recombinant microorganism containing the recombinant vector described in B2), wherein the microorganism is Agrobacterium.

[0019] Thirdly, the present invention provides a method for cultivating rice with reduced plant height, and / or increased leaf curl, and / or increased grain length, and / or decreased grain width, and / or decreased grain thickness, and / or reduced thousand-grain weight, and / or increased leaf stomatal density, and / or reduced leaf chlorophyll content. The method includes overexpressing the gene for the above-mentioned HA7 protein in rice to obtain rice with reduced plant height, and / or increased leaf curl, and / or increased grain length, and / or decreased grain width, and / or decreased grain thickness, and / or reduced thousand-grain weight, and / or increased leaf stomatal density, and / or reduced leaf chlorophyll content.

[0020] In the method described above, the gene that overexpresses the HA7 protein in plants is obtained by using transgenic technology to increase the expression level of the gene encoding the HA7 protein.

[0021] In the method described above, the expression level of the gene encoding the HA7 protein is increased by introducing a plant expression vector that integrates the nucleic acid molecule shown in SEQ ID NO. 2 into the target plant using transgenic technology.

[0022] The beneficial effects of this invention are:

[0023] (1) It provides clear and efficient molecular breeding targets for multiple effects:

[0024] Unlike traditional single-trait improvement genes, the HA7 gene can synergistically regulate multiple core agronomic traits such as plant height, leaf shape, grain size, and leaf physiology. By manipulating a single gene, multiple breeding objectives such as "reducing plant height, increasing leaf curl, and optimizing canopy structure" can be achieved, greatly improving breeding efficiency and precision, and avoiding the complexity and uncertainty of multi-gene aggregation.

[0025] (2) A dominant functional model was elucidated and utilized, thus broadening the breeding technology pathway:

[0026] This invention clarifies that HA7 belongs to the category of "gain-of-function" regulatory factors. This provides a third, highly efficient pathway for molecular design breeding, in addition to traditional "gene knockout" and "simple overexpression": namely, precisely creating "gain-of-function" alleles (such as simulating) through gene editing. ha7 (Mutation). This method can directly generate a strong phenotype and may avoid unintended effects or exogenous transgene problems caused by overexpression.

[0027] (3) It breaks through the common contradiction between "ideal plant type" and "yield decline":

[0028] In crop improvement, altering plant architecture often leads to a decrease in yield. This invention not only focuses on leaf shape but also delves into... HA7 The regulatory mechanisms of grain traits. This allows breeders to proactively assess and weigh the relationship between plant architecture improvement and yield components (such as grain shape and grain weight), and through fine regulation (such as using tissue-specific promoters) or combining dominant haplotypes, optimize plant architecture while minimizing negative impacts on yield, and even indirectly increase yield by optimizing population light energy utilization. Attached Figure Description

[0029] Figure 1 Wild type (WT) and mutant ha7 Key morphological characteristics: (A) Wild type (WT) and mutant ha7 Leaf length (Bar=5 cm) and leaf cross-section (Bar=1 cm) of plants at tillering stage; (BF) wild type (WT) and mutant ha7 Comparison of plant height, leaf length, leaf width, number of tillers, and curl; data are expressed as mean ± standard deviation (n = 20); ns indicates no significant difference; * indicates significant difference at the 0.05 level; *** indicates significant difference at the 0.001 level (Student's t-test).

[0030] Figure 2 Wild type (WT) and mutant ha7 Comparison of leaf sclerenchyma: (A, B) Wild type (WT) and mutant ha7 Paraffin sections, the red box shows the differences in the development of thick-walled tissue between the two (Bar=100 um).

[0031] Figure 3 Wild type (WT) and mutant ha7 Grain traits: (A) Wild type (WT) and mutant ha7 Seed morphology (Bar=1 cm); (B) Wild type (WT) and mutant ha7 Epidermal cells (Bar=300 μm); (CH) wild-type (WT) and mutant ha7 Comparison of grain length, width, thickness, thousand-grain weight, cell row count, and cell count; data are expressed as mean ± standard deviation (n = 50); ns indicates no significant difference; * indicates significant difference at the 0.05 level; ** indicates significant difference at the 0.01 level; *** indicates significant difference at the 0.001 level (Student's t-test).

[0032] Figure 4 Wild type (WT) and mutant ha7 Yield traits: (A) Wild type (WT) and mutant ha7 (B) Ear of grain (Bar=2 cm); (B) Wild type (WT) and mutant ha7 Comparison of 100 kernels (Bar=1 cm); comparison of spike length, number of primary branches, number of secondary branches, number of effective spikes, number of kernels per spike, and yield per plant between wild-type (WT) and mutant ha7 (CH); data are expressed as mean ± standard deviation (n = 10); ns indicates no significant difference; ** indicates significant difference at the 0.01 level; *** indicates significant difference at the 0.001 level (Student's t-test).

[0033] Figure 5 Wild type (WT) and mutant ha7 Stomatal observation: (A) Wild type (WT) and mutant ha7 Stomatal morphology, left image: white triangles point to stomata, Bar=50 μm; right image: Bar=10 μm (B) Number of stomata (CD) Area and diameter of a single stoma; ns indicates no significant difference; * indicates significant difference at the 0.05 level; *** indicates significant difference at the 0.001 level (Student t-test).

[0034] Figure 6 Wild type (WT) and mutant ha7 Comparative analysis of leaf chlorophyll content: (A) relative chlorophyll content; (BC) chlorophyll content; data are expressed as mean ± standard deviation (n = 10); ns indicates no significant difference; ** indicates significant difference at the 0.01 level; *** indicates significant difference at the 0.001 level (Student's t-test).

[0035] Figure 7 The structure of the HA7 protein: (A) HA7 Protein structure and mutants ha7 Mutation sites, marked in red: P represents proline, L represents leucine; (B) HA7 The location of the two zinc finger domains in the protein.

[0036] Figure 8 Amino acid sequence alignment of the IDD family in rice: the marked parts are mutation sites.

[0037] Figure 9 Evolutionary relationships and promoter element analysis of IDD genes in rice: (A) Phylogenetic tree and promoter element analysis, plotted on MEGE using the full length of the rice IDD protein and on Tbtools using the upstream 2000 bp of the rice IDD gene promoter; (B) Heatmap of functional elements on the promoter of the rice IDD gene; the red boxes indicate... HA7 Gene.

[0038] Figure 10 for HA7 Spatiotemporal expression patterns of genes: (A) Rice at 10 and 15 weeks HA7 (A) Gene expression levels in roots, stems, leaves, leaf sheaths, and panicles; (B) Rice germination 7-17 days HA7 Gene expression in roots and leaves; UBQ This is an internal reference; the data are mean ± standard deviation (n = 10).

[0039] Figure 11 for HA7 Phenotypic observation of overexpressing and knockout plants: (A) Leaves of tillering plants (Bar=10 cm) (Bar=5 cm) (BF) HA7 Plant height, leaf length, leaf width, number of tillers, and curl of overexpressing and knockout plants were compared with those of wild type. Data are expressed as mean ± standard deviation (n = 20); ns indicates no significant difference; ** indicates significant difference at the 0.01 level; *** indicates significant difference at the 0.001 level (one-way ANOVA).

[0040] Figure 12 for HA7 Grain trait analysis of overexpressing and knockout plants: (A) HA7 Grain morphology (Bar=1 cm) of overexpressing and knockout plants compared to wild-type (WT) (B) HA7 Overexpressing and knockout plants compared with wild-type epidermal cells (Bar=300 μm) (CH) HA7 Comparison of grain length, width, thickness, thousand-grain weight, cell row number, and cell number between overexpressing and knockout plants and wild-type (WT) plants; data are expressed as mean ± standard deviation (n = 50); ns indicates no significant difference; * indicates significant difference at the 0.05 level; ** indicates significant difference at the 0.01 level; *** indicates significant difference at the 0.001 level (one-way ANOVA).

[0041] Figure 13 for HA7 Observation of stomata in overexpressed and knocked-out leaves: (A) Stomatal morphology, left image: white triangles pointing to stomata, Bar=50 um; right image: Bar=10 um (B) Number of stomata (CD) Area and diameter of individual stomata; ns indicates no significant difference; *** indicates significant at the 0.001 level (one-way ANOVA).

[0042] Figure 14 for HA7 Comparative analysis of chlorophyll content in leaves with overexpression and knockout: (A) relative chlorophyll content; (BC) chlorophyll content; data are expressed as mean ± standard deviation (n = 50); ns indicates no significant difference; * indicates significant difference at the 0.05 level; ** indicates significant difference at the 0.01 level; *** indicates significant difference at the 0.001 level (one-way ANOVA). Detailed Implementation

[0043] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0044] Explanation of the sequence list:

[0045] SEQ ID NO. 1:

[0046] MASNSSAAAAAAFFGISRDGDQHDQIKPLISHQQHQHQQQQLAASLTGVATAAPTAASSQGAPPAAPPAKKKRNLPDPDAEVIALSPKTLLATNRFVCEVCNKGFQREQNLQLHRRGHNLPWKLKQKNPAQAQRRRVYLCPEPTCVHHDPARALGDLTGIKKHFCRKHGEKKWKCDKCSKRYAVQSDWKAHSKICGTREYRCDCGTLFSRRDSFITHRAFCDALAQESSRLPPTSLSSLTSHLYGASNAGNMALSLSQVGSHLTTSLQDGGGHHHHPSPELLRLGGAGGGGGAGGGSSIAARLDHLLSPSGASAFRPPQPAFFLNAAAAAAATGQDFGDDAGNGQHSFLQAKPFHGLMQLPDLQGNGAGGPGAPGPNLFNLGFFANNGNSSGSSHEHASQGLMSNDQFSCGAGGGGGSDASAAGIFGGNFVGGDHVSPAGLYNDQAAMLPQMSATALLQKAAQMGATSSANGPGSMFRGFVGSSPHMRPAAQHMDQSDAHLNDLMNSLAGGGVNAAAMFGGTNGGGVPGAGMFDPRLCDIEHEVKFSQGGGGGGGAGAGTGDGTRDFLGVGGGGIVHGMSTPRGDHHQSSSDMSSLEAEMKSASSFNGRRMP*

[0047] SEQ ID NO .2:

[0048]

[0049] SEQ ID NO. 3:

[0050] TGTTACTTCTGCAGGAGCTCATGGCATCGAATTCATCGGC

[0051] SEQ ID NO. 4:

[0052] CTCACCATGGATCCGGTACCTGGCATCCTTCTCCCGTTGA

[0053] SEQ ID NO. 5:

[0054] GGCAGCCTCACCAGCCACCTGTA

[0055] SEQ ID NO. 6:

[0056] AAACTACAGGTGGCTGGTGAGGC

[0057] SEQ ID NO. 7:

[0058] CTCCGTTTTACCTGTGGAATCG

[0059] SEQ ID NO. 8:

[0060] CGGAGGAAAATTCCATCCAC-3

[0061] SEQ ID NO. 9:

[0062] TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG

[0063] SEQ ID NO. 10:

[0064] AGCGTGGGTCTCGACCGGGTCCATCCACTCCAAGCTC

[0065] Experimental materials: rice mutants ha7 This mutant originates from the japonica rice variety Nipponbare (NPB). After treating Nipponbare with a 1% concentration of the chemical mutagen ethyl methane sulphonate (EMS), a dominant mutant exhibiting extreme leaf curling was screened and isolated. ha7 Experimental materials: NPB, ha7、 HA7-OE (NPB background) HA7(overexpressing plants of the gene) and HA7-KO (NPB background) HA7 (Gene knockout plants).

[0066] Example 1: Observation of mutant phenotype and determination of physiological indicators

[0067] 1.1 NPB and ha7 Plant type differences

[0068] Based on EMS mutagenesis of wild-type NPB (WT), a dominant mutant material with curled leaves was obtained. ha7 Under field conditions, compared to the wild type, the mutant... ha7 The plant's leaves exhibit a curling phenotype from the seedling stage. Figure 1 (A) During the grain-filling stage, the plant's leaf length increased significantly. ha7 The leaf length reached 42.36 cm, an increase of 20.24% compared to the wild type's 35.23 cm. Figure 1 (C in the text). Furthermore, ha7 The plant height and leaf width were 63.38 cm and 0.45 cm, respectively, which were significantly reduced by 31.59% and 66.36% compared to the wild type. Figure 1 (B and D in the text). There was no significant difference in the number of tillers between the two. Figure 1 (E in the text).

[0069] 1.2 Morphological observation of leaf tissue cells

[0070] Studies have shown that the formation of the leaf curl phenotype is mainly related to the polarity of the axillary and abaxial surfaces, vesicular cells, and the development of cuticle and epidermal cells. Mutations in genes involved in these processes may lead to abnormal leaf development and the leaf curl phenotype. Furthermore, abnormal development of vascular bundles, parenchyma cells, sclerenchyma cells, and mesophyll cells within the leaf can also cause leaf curling. To investigate... ha7 The reason for leaf curling was observed through tissue sections of the leaves. ha7 Defects in the development of thick-walled tissues. Therefore, we believe... ha7 Leaf curling may be caused by defects in the development of sclerenchyma tissue. Figure 2 ).

[0071] 1.3 Grain trait analysis

[0072] Rice yield is influenced by a variety of factors, among which grain size is one of the key traits. Grain size is closely related to its development process, photosynthetic efficiency, and nutrient accumulation, directly affecting the final number of grains per panicle and thousand-grain weight, thus determining the rice yield level. Phenotypic analysis of mature grains revealed that… ha7The grain length, grain width, and grain thickness were 6.46 mm, 2.40 mm, and 2.21 mm, respectively, which were significantly reduced by 2.57%, 15.34%, and 8.45% compared to the wild type. Figure 3 (A to E in the text). The wild type has a thousand-grain weight of 26.99 g, while... ha7 The concentration was 21.14 g, a significant decrease of 21.68%. Figure 3 (F in the text). Scanning electron microscopy analysis of the outer epidermal cells of the husk revealed that, compared to the wild type, ha7 The number of epidermal cells in the glumes was significantly increased, 1.45 times that of the wild type, but the number of cell rows did not differ significantly. ha7 The outer epidermal cells of the glume are more compact ( Figure 3 (B to H in the middle).

[0073] 1.4 Yield Trait Analysis

[0074] To explore HA7 The effect of genes on plant yield-related traits, and their influence on wild-type mutants. ha7 Statistical analysis was performed on the yield traits. The results showed that... ha7 The ear length is 16.64 cm ( Figure 4 (C) Number of secondary branches: 6.67 Figure 4 E in the middle), number of grains per ear 84.42 ( Figure 4 (G in the text), and the yield per plant was 12.49 g ( Figure 4 The percentages of H in the H group decreased by 17.3%, 45.9%, 18.4%, and 51.3% respectively compared to the wild type. There was no significant difference between the two groups in the number of primary branches and the number of effective spikelets. Figure 4 (D and F in the text).

[0075] 1.5 Observation of stomatal morphology

[0076] Rice stomata, as the main channels for gas exchange between plants and the external environment, are crucial for physiological processes such as photosynthesis, transpiration, and the absorption of water and nutrients. The number, morphology, and distribution characteristics of stomata directly affect plant growth and development, playing a particularly important role in regulating water metabolism, stress resistance, and growth adaptability. Therefore, studying the characteristics of rice leaf stomata and their molecular-level regulatory mechanisms is of great significance for revealing the regulatory mechanisms of crop growth.

[0077] In our study, while the focus was on phenotypic changes in rice leaf shape, we also paid special attention to the morphological characteristics of rice leaves' stomata because stomatal morphology is closely related to leaf function. We compared mutants... ha7 Differences in the morphology and number of stomata on the abaxial surface of leaves between the wild type and the wild type. The results show that... ha7The mutant showed a significant increase in the number of stomata, but a significant decrease in the stomatal area. Figure 5 (from A to C), and the stomata diameter did not show significant changes ( Figure 5 (D in the original text). This finding suggests that... HA7 Genes may influence the stomatal function of rice leaves by regulating the number and area of ​​stomata, thereby indirectly affecting the growth, development, and adaptability of rice.

[0078] 1.6 Chlorophyll content determination

[0079] Chlorophyll content is an important indicator of a plant's photosynthetic capacity, and photosynthetic efficiency is closely related to leaf shape characteristics. By measuring chlorophyll content, we can delve into the intrinsic relationship between leaf shape and photosynthesis, plant growth and development, and environmental adaptability, providing crucial data support for related research. Therefore, we studied mutants... ha7 The total chlorophyll content, chlorophyll a (Chl a), chlorophyll b (Chl b), and carotene (Car) content of the plants were determined in both the wild-type and non-wild-type plants. The results showed that, compared with the wild-type, ha7 The contents of chlorophyll a and carotenoids in the leaves were significantly reduced, while the contents of chlorophyll b showed no significant difference. Figure 6 (C) This was also found by measuring the relative chlorophyll content (SPAD). ha7 Although the SPAD value of the subtype was not significantly different from that of the wild type, it was still slightly lower overall than that of the wild type. Figure 6 (A and B in the text).

[0080] Example 2: HA7 Analysis of gene sequence characteristics and expression patterns

[0081] 2.1 HA7 protein structure

[0082] The structural features of the HA7 protein were analyzed using an online prediction tool, http: / / smart.embl-heidelberg.de / . The results showed that the HA7 protein contains two C2H2 zinc finger domains, located at amino acid positions 96-118 and 173-193, respectively. Figure 7 (B) Zinc finger domains, as common protein structural modules, are usually closely related to functions such as DNA binding and transcriptional regulation. In mutant studies, mutations often occur in known functional domains; however, in this study, we observed mutation sites in non-domain regions, and the mutation type was a substitution of proline (Pro) for leucine (Leu). Figure 7(A) To further explore the potential functional impact of this mutation site, we performed amino acid sequence alignment analysis of this gene protein family in rice to assess the conservation of this site and its potential impact on protein function. Sequence alignment confirmed whether this mutation affects the functional conservation of the HA7 protein and provided a theoretical basis for subsequent functional verification.

[0083] 2.2 Sequence alignment of the HA7 protein family

[0084] The HA7 protein belongs to the Indeterminate Domain (IDD) family. Amino acid sequences of IDD proteins in rice were aligned using the online tool https: / / www.genome.jp / tools-bin / clustalw. The results showed that the amino acid at this mutation site is highly conserved across all rice IDD protein members. This indicates the functional importance of this site in the rice genome. The substitution of proline (Pro) for leucine (Leu) at the mutation site may interfere with the normal structure or function of the HA7 protein, thereby affecting its regulatory role in rice growth and development. Figure 8 Since the IDD protein family is typically involved in important biological processes such as plant growth and development, stress response, and gene expression regulation, this mutation may have a profound impact on the growth, development, yield, and stress resistance of rice. Further functional validation and phenotypic analysis will help elucidate the specific effects of this mutation on rice phenotypes and its potential breeding application value.

[0085] 2.3 HA7 Phylogenetic tree and promoter element analysis of gene families

[0086] To explore in depth HA7 We constructed the gene functions using MEGA and TBtools software. HA7 The phylogenetic tree of the gene and its homologous genes in rice was used to reveal the evolutionary relationships and conservation of the HA7 protein in different species through phylogenetic analysis. Figure 9 In addition, we also... (A) HA7 A detailed analysis of cis-regulatory elements in gene promoter regions was conducted, identifying functional elements related to gene expression regulation, and these elements were summarized in a heatmap. Figure 9 (B) to visually demonstrate the distribution of functional elements within the promoter and their potential regulatory roles. These analyses provide a theoretical basis for subsequent physiological function experiments and functional verification, further helping us to understand... HA7 The specific role of genes in plant growth and development and their regulatory mechanisms.

[0087] 2.4 HA7Spatiotemporal expression pattern analysis

[0088] Meanwhile, this study used real-time quantitative polymerase chain reaction (qRT-PCR) technology to... HA7 The gene expression patterns were investigated in depth. Specifically, the expression patterns of genes in different tissues and organs of 10-week-old and 15-week-old wild-type plants were studied. HA7 The relative expression levels of genes were measured. The results showed that... HA7 It exhibits constitutive expression in all tissues and organs, peaking in the stem at 10 weeks; by 15 weeks, expression levels in all parts... HA7 Gene expression levels decreased. Figure 10 (A) Given that this study focuses on leaf shape development, the seedling stage... HA7 The relative expression levels were also determined. Furthermore, based on existing literature reports… HA7 Involved in the regulation of root development, this study also measured the growth characteristics of young roots at different stages. HA7 The expression level was studied to lay the foundation for subsequent experimental expansion. The results showed that... HA7 The highest expression levels were observed in leaves and roots 13 days after germination. Figure 10 (B in the middle).

[0089] Example 3: HA7 Gene function verification

[0090] To clarify HA7 To investigate the function of genes in rice, this invention first constructs overexpression and knockout vectors, then performs Agrobacterium-mediated transformation, and finally performs genetic transformation in rice.

[0091] (1) Construction of overexpression vector:

[0092] Using NPB cDNA as a template, a 1839 bp amplification was performed using primers 5'-TGTTACTTCTGCAGGAGCTCATGGCATCGAATTCATCGGC-3' (SEQ ID NO. 3) and 5'-CTCACCATGGATCCGGTACCTGGCATCCTTCTCCCGTTGA-3' (SEQ ID NO. 4). HA7 The full-length cDNA sequence of the gene (SEQ ID NO. 2) was obtained and ligated to the SacI restriction site of the HJEV6 vector. The vector was then transformed into *E. coli* DH5α, and positive plasmids were identified by colony PCR. Sequencing of the positive plasmids yielded the genetic transformation vector HJEV6-HA7 containing the 1839 bp full-length cDNA fragment of the HA7 gene.

[0093] (2) Knockout vector construction:

[0094] Gene knockout vectors were constructed using the ApYLCRISPR / Cas9-MH / B vector system developed by Liu Yaoguang's team at South China Agricultural University. Target adapters were prepared using primers HA7-U3-F: GGCAGCCTCACCAGCCACCTGTA (SEQ ID NO. 5) and HA7-U3-R: AAACTACAGGTGGCTGGTGAGGC (SEQ ID NO. 6). Next, the enzyme-digested pYLgRNA-U3 vector was ligated with the corresponding adapter to prepare a gRNA expression cassette. Then, the gRNA expression cassette was amplified by two rounds of nested PCR. The gRNA expression cassette prepared in the previous step was used as the template for the first round of amplification, with primers UF: 5'-CTCCGTTTTACCTGTGGAATCG-3' (SEQ ID NO. 7) and gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3' (SEQ ID NO. 8). The first-round PCR amplification products were diluted 100-fold and used as templates for the second-round amplification. The amplification primers were Uctcg-B1': 5'-TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG-3' (SEQ ID NO. 9) and gRcggt-BL: 5'-AGCGTGGGTCTCGACCGGGTCCATCCACTCCAAGCTC-3' (SEQ ID NO. 10). The two sets of amplified PCR products were purified, mixed in equal volumes, and then ligated into the pYLCRISPR / Cas9-MH vector while being digested with enzymes. The mixture was then transformed into DH5α, and positive plasmids were identified by colony PCR and sequencing, thus obtaining the gene knockout vector pYLCRISPR / Cas9-MH-HA7.

[0095] (3) Agrobacterium-mediated genetic transformation of rice

[0096] Plasmids HJEV6-HA7 and pYLCRISPR / Cas9-MH-HA7 were transformed into competent Agrobacterium EHA105 cells using electroporation for transformation experiments in rice.

[0097] During the transformation process, mature embryos of NPB were used to culture callus tissue. After culturing in callus induction medium for about two weeks, well-grown callus tissue was selected as recipient material for the transformation experiment. Next, the EHA105 strain containing HJEV6-HA7 and pYLCRISPR / Cas9-MH-HA7 plasmids was used to infect rice callus tissue, and co-cultured at 25℃ in the dark for 3 days.

[0098] After co-culture, the callus tissue was transferred to a selection medium containing 50 mg / L Hygromycin and cultured under light for approximately 14 days. Surviving callus tissue was then selected and transferred to differentiation medium for further culture. After approximately one month of culture under appropriate light conditions, T0 generation plants were finally obtained.

[0099] Genomic DNA was extracted from leaves of T0 generation plants and analyzed using vector-specific primers or HA7 Gene-specific primers were used for PCR amplification, and the integration and correct editing of the exogenous gene were verified by sequencing. The verified positive T0 generation plants were planted in the field, and seeds were harvested individually to obtain T1 generation seeds. T1 generation seeds were sown, and resistance screening was performed at the seedling stage (for overexpression lines) or genotyping was performed by PCR and sequencing (for knockout lines). Lines with stable and homozygous inheritance of the target gene were selected and named accordingly. HA7 -OE (overexpression homozygote) and HA7 -KO (knockout homozygous). All subsequent functional validation experiments in this study were conducted using homozygous lines.

[0100] Example 4: HA7 Gene function verification

[0101] 3.1 Plant type observation of relevant genetic materials

[0102] Compared to the wild type, HA7 Overexpression strain ( HA7-OE The following diagram is abbreviated as OE ) exhibits characteristics similar to dominant mutants ha7 Similar leaf curl phenotype, with leaf curl reaching 0.53 ( Figure 11 (F in the text). This phenomenon indicates that... HA7 Genes may be involved in regulating leaf morphology formation. Furthermore... HA7-OE The plant height was significantly reduced, decreasing by 22.14% compared to the wild type. In contrast, HA7 Gene knockout strains ( HA7-KO The following diagram is abbreviated as KO Compared to the wild type, the plant height was also significantly reduced, but the decrease was 7.39%. Regarding leaf length, leaf width, and number of tillers, HA7-OE and HA7-KO No significant differences were observed between the wild type and the wild type. Figure 11 (A to E in the original text).

[0103] These results indicate that HA7 Genes may play an important role in regulating leaf curl, but their influence on other traits such as plant height, leaf size, and tiller number is relatively limited.

[0104] 3.2 Grain trait analysis of relevant genetic materials

[0105] Compared to the wild type, HA7-OE Significant changes in grain morphology were observed: grain length increased, while grain width, grain thickness, and thousand-grain weight decreased significantly. Figure 12 (C to F in the text). Furthermore, the outer epidermal cells of the glume are more densely arranged (…). Figure 12 (From G to H). These phenotypic changes suggest... HA7 It may play a certain regulatory role in grain development. ha7 The mutants also exhibited similar phenomena, with varying degrees of reduction in grain width, grain thickness, and thousand-grain weight, while the outer epidermal cells of the glume were more densely packed. In contrast, HA7-KO There was no significant difference in grain characteristics compared to the wild type.

[0106] Based on the above results, it is inferred that... HA7 Genes not only play a role in regulating leaf shape, but may also have some influence on grain size and morphology.

[0107] 3.3 Observation of stomatal morphology in relevant genetic materials

[0108] Compared to the wild type, HA7-OE and mutants ha7 They exhibited a consistent phenotype: an increased number of stomata, but a decreased stomatal area, and no significant change in stomatal diameter. In contrast, HA7-KO There was no significant difference in the number and morphology of stomata compared to the wild type. Figure 13 ).

[0109] These results indicate HA7 Genes play an important role in regulating stomatal morphology and number.

[0110] 3.4 Determination of chlorophyll content in relevant genetic materials

[0111] Compared to the wild type, HA7-OE It showed a significant decrease in chlorophyll a, chlorophyll b, and carotene content, while the total chlorophyll content was also significantly reduced. Figure 14 (B to C in the original text). The SPAD value measurements further support this finding, showing that... HA7-OE The plant has a relatively low chlorophyll content, a phenomenon that is related to... ha7 The chlorophyll content in the mutants changed consistently. In contrast, HA7-KO There were no significant differences between the wild type and the total chlorophyll content and SPAD value. Figure 14 (A in the middle).

[0112] These results indicate that HA7 Genes may participate in the regulation of chlorophyll accumulation in plant leaves by controlling the process of chlorophyll synthesis or degradation.

[0113] The above examples are merely some specific embodiments of the present invention. It should be noted that the present invention is not limited to the above embodiments, and all modifications that can be directly derived or conceived by those skilled in the art from the content disclosed in the present invention should be considered within the scope of protection of the present invention.

Claims

1. Use of a gene overexpressing a HA7 protein, characterized in that, The application is any one of the following: A1) Application in increasing stomatal density and / or reducing total chlorophyll content in rice leaves; A2) Application in the preparation of rice with increased leaf stomatal density and / or decreased total leaf chlorophyll content; The amino acid sequence of the HA7 protein is shown in SEQ ID NO.

1.

2. Use of a biological material associated with the HA7 protein as described in claim 1, characterized in that, The application is any one of the following: A1) Application in increasing stomatal density and / or reducing total chlorophyll content in rice leaves; A2) Application in the preparation of rice with increased leaf stomatal density and / or decreased total leaf chlorophyll content; The biomaterial is any one of B1) to B3) below: B1) An expression cassette containing a nucleic acid molecule encoding the HA7 protein; B2) Recombinant vectors containing nucleic acid molecules encoding the HA7 protein; B3) A recombinant microorganism containing a nucleic acid molecule encoding the HA7 protein, or a recombinant microorganism containing the expression cassette described in B1), or a recombinant microorganism containing the recombinant vector described in B2), wherein the microorganism is Agrobacterium; The amino acid sequence of the HA7 protein is shown in SEQ ID NO.1, and the nucleotide sequence of the nucleic acid molecule encoding the HA7 protein is shown in SEQ ID NO.

2.

3. A method for breeding a rice plant having increased stomatal density and / or decreased total chlorophyll content in leaves, the method comprising introducing into a rice plant a mutation in a gene encoding a protein having the amino acid sequence of SEQ ID NO:

2. The method involves overexpressing the HA7 protein gene in rice to obtain rice with increased leaf stomatal density and / or decreased total leaf chlorophyll content, wherein the amino acid sequence of the HA7 protein is shown in SEQ ID NO.

1.

4. The method according to claim 3, characterized in that, The gene that overexpresses HA7 protein in rice is obtained by using transgenic technology to increase the expression level of the gene encoding HA7 protein.

5. The method according to claim 4, characterized in that, The method of increasing the expression level of the gene encoding the HA7 protein using transgenic technology is achieved by introducing an expression vector that integrates the nucleic acid molecule shown in SEQ ID NO.2 into rice.