Chicken Columbia feather type black and white tail feather gene detection method and application

Abstract

The invention discloses a detection method and application of chicken Columbia feather type black and white tail feather genes. Belongs to the technical field of animal genetic breeding. According to the invention, the A / G mutation at the 10892295 position of the chicken Z chromosome genome is associated with the chicken Columbia feather, and the T / C mutation at the 1341621 position of the chicken 34 chromosome genome is associated with the black and white tail of the chicken. A primer pair K and a primer pair P for detecting genotypes of Columbia feathers and black and white tail feathers of chickens are constructed according to the SNP loci; the gene typing detection method which is matched with the method, efficient, low in cost and suitable for large-scale groups is developed, the provided method is easy to operate, rapid in detection and accurate in result, the characters of Columbia feathers and black tail feathers can be more efficiently screened in breeding practice, the breeding progress is accelerated, the breeding cost is saved, and the method is suitable for popularization and application. And a rapid molecular breeding method is provided for breeding of characters of Columbia-feather black-tail chickens.

Description

Technical Field

[0001] This invention relates to the field of animal genetics and breeding technology, and more specifically to a method and application for detecting the gene for black and white tail feathers in chickens of the Columbia feather type. Background Technology

[0002] Feather color, one of the most prominent external characteristics of chickens (Gallus gallus domesticus), is not only an important marker for distinguishing breeds but also a key economic trait and selection indicator in modern chicken breeding. The diverse feather color types are regulated by multiple gene loci, and their genetic mechanisms are complex. Understanding the molecular basis of these traits and applying it to breeding practices is of great significance for improving industry efficiency.

[0003] Currently, one of the main models of poultry production in my country is crossbreeding large broiler roosters with high-yielding colored-feathered laying hens to produce "broiler hybrids" with high meat production and market appeal. In this market context, the plumage of commercial chickens directly affects their consumer acceptance and commercial value. Market data and practice show that, compared to individuals with white tails, commercial chickens covered in red feathers and with black tails (i.e., the "red-feathered, black-tailed" type) are more visually appealing to consumers and can generate higher economic benefits. Therefore, breeding parent stock capable of stably producing such offspring has become a common goal pursued by both laying hen and broiler breeding companies.

[0004] Breeding practices have shown that using laying hens with Columbia plumage and black tail traits as the female parent and crossing them with a suitable male parent can reliably produce ideal red-feathered, black-tailed individuals in the commercial generation. This technical approach demonstrates extremely high value for promotion and application. However, achieving this goal requires the precise identification and genotyping of key genes controlling Columbia plumage and black tail traits within the core breeding population.

[0005] Black and white tail feathers, as a stably heritable trait, are typically observed in the commercial Babcock B380 breed. This high-yielding brown-shelled egg-laying chicken breed possesses a typical Colombian plumage pattern (characterized by white feathers on the main body and colored feathers on the neck and tail). Its commercial production involves a complex crossbreeding process (such as crossing A / B lines with C / D lines), requiring the selection of pure black-tailed and silver-white-tailed male and female individuals. Finally, through further crossbreeding, the significant characteristic of equal numbers of black and white tails in the commercial female chicks is achieved. This phenomenon confirms a specific genetic law behind the tail feather color trait. However, traditional phenotypic selection methods are cumbersome, time-consuming, and cannot accurately identify tail feathers in early chicks (especially for breeds with slow feathering speed) or before sexual maturity, severely limiting breeding efficiency.

[0006] Furthermore, not all chicken breeds possess typical traits suitable for research. For example, the Bashang Long-tailed Chicken, a local breed from Hebei Province, exhibits a significantly different plumage type from the Columbian plumage type, thus lacking the typical characteristics of the Columbian plumage. Therefore, this type of breed can serve as important supporting evidence to verify the accuracy and specificity of identified gene loci related to Columbian plumage at the molecular level. Specifically, it allows for verification of whether the locus can still accurately distinguish plumage types in an unrelated population, thereby ruling out coincidental associations.

[0007] In summary, there is an urgent need in this field for a molecular breeding technology that can overcome phenotypic limitations and achieve early and precise selection. Specifically, it is imperative to identify key molecular markers directly related to the control of plumage and black-and-white tail traits in Columbian breeds, and to develop a corresponding, efficient, low-cost genotyping detection method suitable for large-scale populations. These are technical problems that urgently need to be solved by those skilled in the art. Summary of the Invention

[0008] In view of this, the present invention develops a method and application for detecting the black and white tail feather gene in chickens with Columbia feather type. It identifies key SNP sites directly related to controlling Columbia feather type and black and white tail traits, identifies the molecular markers of these SNP sites, and develops a matching, efficient, low-cost genotyping detection method suitable for large-scale populations. This provides solid technical support for rapidly breeding purebred maternal lines with ideal Columbia feather type and black tail characteristics, and ultimately stably producing red-feathered black-tailed broiler hybrid chickens that are popular in the market.

[0009] The primary objective of this application is to provide the application of a reagent for chicken genotyping and helper breeding, said reagent being used to detect the following two single nucleotide polymorphism (SNP) sites: (i) SNP locus 1: located at position 10892295 on chicken Z chromosome, with genotype A or G, which is associated with Columbia feather type; (ii) SNP locus 2: located at position 1341621 on chicken chromosome 34, with a genotype of T or C, which is associated with the black and white tail trait; The detection is used to genotype chickens with Columbia feather type and / or black and white tail traits.

[0010] Another object of this application is to provide: a primer set for detecting the above-mentioned SNP site 1 and / or SNP site 2, comprising: Primer pair K is used to specifically amplify DNA fragments containing the aforementioned SNP site 1; And / or primer pair P, used to specifically amplify DNA fragments containing the above SNP site 2; Furthermore, both primers in primer pair K and primer pair P are mismatched primers, which can introduce artificial sites for restriction endonuclease digestion analysis into the PCR product.

[0011] As a preferred technical solution, the specific sequence of primer pair K is as follows: KF: 5'-GAAATAAGGAATACTGGGTGGGAG- 3', SEQ ID NO. 2; KR: 5'-CTCTTTGGATGGATGGCTGGC-3'SEQ ID NO.3; The specific sequence of primer pair P is as follows: PF: 5'-AGGTGCCCATTGCGGTGGATGTGAC-3', SEQ ID NO.6; PR: 5'-GTGGGGCTGCGGGAGATGCG-3', SEQ ID NO.7.

[0012] Another object of this application is to provide a kit for detecting the Columbia feather type and / or black and white tail trait in chickens, comprising primer pair K and / or primer pair P.

[0013] As a preferred technical solution, the kit further includes restriction endonucleases for digesting the PCR products of primer pair K and / or primer pair P. The restriction endonuclease used to digest the PCR product of primer pair K was HaeIII. The restriction endonuclease used to digest the PCR product of primer pair P was HinP1I.

[0014] Another object of this application is to provide: a method for detecting Columbia feather type and / or black and white tail traits in chickens, comprising the following steps: (a) Obtaining genomic DNA samples from chickens; (b) Using the primer pair K and primer pair P, the genomic DNA was amplified by PCR to determine the genotypes of the following two SNP sites: A / G genotype at position 10892295 on chicken Z chromosome; The T / C genotype at position 1341621 on chicken chromosome 34; (c) Based on the test results of step (b), determine the genotype of the chicken’s Columbia feather type and / or black and white tail trait.

[0015] As a preferred technical solution, the method for determining the genotype of the specific SNP locus in step (b) is as follows: Chicken Columbia feather genotype: If the PCR digestion product size is 169bp, the genotype of the chicken being tested is GG; if the PCR digestion product size is 169bp or 185bp, the genotype of the chicken being tested is GA; if the PCR digestion product size is 185bp, the genotype of the chicken being tested is AA. Genotypes of black and white tail feathers in chickens: If the size of the PCR digestion product is 66bp, 104bp, or 124bp, then the genotype of the chicken being tested is TC; if the size of the PCR digestion product is 66bp or 104bp, then the genotype of the chicken being tested is CC.

[0016] As a preferred technical solution, chickens with genotype GG exhibit Colombian plumage, while chickens with genotypes GA and AA exhibit non-Colombian plumage; chickens with genotype TC exhibit white tails, and chickens with genotype CC exhibit black tails.

[0017] As a preferred technical solution, the PCR reaction system for primer set K and primer set P amplification in step (b) is as follows: 2×Taq PCR masterMix 20μl, upstream primer 2μl, downstream primer 2μl, DNA template 2μl, ddH2O 14μl; The PCR reaction program for primer set K amplification was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 61.9℃ annealing for 1 min, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min. The PCR reaction program for primer set P amplification was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 64.9℃ annealing for 1 min, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min.

[0018] Another object of this application is to provide: the application of the above primer set, the above kit, or the above method, wherein the application is in any of the following directions: (1) Application in detecting Columbia feather type and / or black and white tail in chickens; (2) Application in the combined genotyping detection of Columbia feather type and black and white tail traits in chickens; (3) Application in the breeding of chickens with specific traits of Colombian feather type and black and white tail.

[0019] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects: This application is the first to discover the association between the A / G mutation at position 10892295 on chicken Z chromosome and Columbia feathers, and the association between the T / C mutation at position 1341621 on chicken chromosome 34 and black and white tail feathers. Based on the above SNP sites, primer pairs K and P were constructed for detecting the genotypes of Columbia feathers and black and white tail feathers. A matching, efficient, low-cost genotyping detection method suitable for large-scale populations was also developed. The provided method is simple to operate, fast to detect, and accurate to provide results. It helps to screen for Columbia feathers and black and white tail feathers more efficiently in breeding practice, accelerates breeding progress, saves breeding costs, and provides a rapid molecular breeding method for the selection of Columbia feather black-tailed chicken traits. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0021] Figure 1 It is: Babcock B380 Blacktail Hen (with Colombian plumage, Blacktail).

[0022] Figure 2 It is: Babcock B380 White-tailed Hen (with Colombian plumage, white-tailed chicken).

[0023] Figure 3 The image shows gel electrophoresis images of the chicken Colombian feather patterns of five Babcock B380 hens and five Bashang Longtail hens, determined using primer pair K.

[0024] Figures 4-19 Image: Gel electrophoresis image of the black and white tail genotypes of 160 Babcock B380 hens determined using primer pair P. Detailed Implementation

[0025] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] The materials used were samples from Babcock B380 hens (a Babcock B380 hen population with equal numbers of black and white tails, and also exhibiting Columbia plumage; this invention is used to study Columbia plumage and black and white tail feathers) and Bashang long-tailed hens (used to verify the accuracy of the Columbia plumage locus and to investigate black and white tails in the case of the Columbia plumage GG genotype). Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0027] Example 1 Design of primer pair K for determining the feather genotype of chicken Columbia Based on the A / G mutation at position 10892295 on the Colombian chicken Z chromosome (reference gene version number: selected from the chicken (Gallus gallus) genome assembly version bGalGal1.mat.broiler.GRCg7b in the National Center for Biotechnology Information (NCBI) database), a 185bp sequence was selected from this chromosome (as shown in SEQ ID NO.1) to cover the aforementioned missense mutation site, and the following primer pair K was designed: KF: 5'-GAAATAAGGAATACTGGGTGGGAG-3', SEQ ID NO.2; KR: 5'-CTCTTTGGATGGATGGCTGGC-3', SEQ ID NO. 3.

[0028] Example 2 The method for detecting the genotype of Columbia chicken feathers using the above primer pair K includes the following steps: (1) Sampling of the chickens to be tested The chicken blood samples were collected from Angel Poultry Breeding Co., Ltd., consisting of 5 Babcock B380 hens and 5 Bashang Longtail hens. PCR amplification was performed using the DNA from the chicken blood samples as a template and primer pair K as the primer.

[0029] (2) PCR amplification and enzyme digestion incubation The PCR amplification reaction system was as follows: 20 μl of 2×Taq PCR masterMix, 2 μl of KF, 2 μl of KR, 2 μl of DNA template, and 14 μl of ddH2O.

[0030] The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 61.9℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃.

[0031] The enzyme digestion reaction system consisted of 10 μl of PCR product, 1 μl of HaeIII, 2 μl of 10×buffer, and 18 μl of ddH2O, and was incubated in a water bath for 8 hours.

[0032] (3) Genotyping: PCR amplification and enzyme digestion products were separated by 4.0%-5.0% agarose gel electrophoresis with a 1×TAE electrophoresis buffer concentration, a voltage of 150V, and an electrophoresis time of 30min. The gel electrophoresis imaging system was used to obtain electrophoretic patterns, and the Columbia feather genotype of chickens was detected based on the patterns.

[0033] The specific basis is as follows: The GG genotype corresponds to the Columbia feather phenotype. The PCR amplification and enzyme digestion product sequence length is 169 bp, and the genotyping result is a single band. Individuals with the GG genotype have a homozygous mutation (G / G) at position 10892295 on the chicken Z chromosome. (A mutation at position 18 of SEQ ID NO. 1, changing from T (wild type) to C (mutant), was verified as a mutant genotype, which is the complementary sequence to the target sequence, therefore the corresponding genotype is G (mutant)).

[0034] CTCTTTGGATGGATGGC C TTCATGTCCAACATGCTCTTCTTCACGGATTTCATGGGGCAGGTAAAAGTGTAAAATGCTCTTGCCTTTCTTTCCTCATAGCATTTCCTCCTCCACCAAAACCAAATGAAGATATGGTTATAAACCTGAAGACATGACTCTGGCTCCCACCCAGTATTCCTTATTTC, SEQ ID NO. 1.

[0035] The phenotype corresponding to the GA or AA genotype is non-Columbian feathering. PCR amplification and enzyme digestion product sequences are 169 bp, 185 bp, or 185 bp in length, and the genotyping result is one or two bands. Individuals with the GA or AA genotype are heterozygous (G / A) or homozygous wild-type (A / A) at base 10,892,295. (A T / C single nucleotide polymorphism exists at base 18 of SEQ ID NO.4, where T is the wild-type allele and C is the mutant allele. The verified A allele corresponds to the wild-type and is the complementary sequence to the target sequence; therefore, the corresponding allele is A (wild-type). If the mutant allele G is also detected, then the site is heterozygous (G / A), and the corresponding genotype is GA; if only the wild-type allele A is detected, then the site is homozygous wild-type (A / A), and the corresponding genotype is AA.) CTCTTTGGATGGATGGC T TTCATGTCCAACATGCTCTTCTTCACGGATTTCATGGGGCAGGTAAAAGTGTAAAATGCTCTTGCCTTTCTTTCCTCATAGCATTTCCTCCTCCACCAAAACCAAATGAAGATATGGTTATAAACCTGAAGACATGACTCTGGCTCCCACCCAGTATTCCTTATTTC, SEQ ID NO. 4.

[0036] (4) Test results The Colombian feather type classification result is a single band, such as... Figure 3 As shown in lanes 3-7 of the middle swimming pool, the PCR amplification and enzyme digestion product sequence length is 169 bp, and its genotype is determined to be GG; the non-Columbian feathering genotype result is two or one band, as shown in lane 3-7. Figure 3 Lanes 8-12, PCR amplification, and enzyme digestion product sequences were 169bp, 185bp, or 185bp in length. From Figure 3 The genotyping results show that the detection results of this invention on Colombian and non-Colombian populations are completely consistent with the corresponding phenotypes, indicating that the identification results of this method are reliable and correct.

[0037] Example 3 Design of primer pair P for determining the black and white tail feather genotype of chickens Based on the T / C mutation at position 1341621 on chromosome 34 of the black-and-white tailed chicken (reference gene version number: bGalGal1.mat.broiler.GRCg7b from the chicken genome assembly version in the NCBI database), a 190bp sequence was selected from this chromosome (as shown in SEQ ID NO.5) to cover the aforementioned synonymous mutation site. The following primer pair P was designed: PF: 5'-AGGTGCCCATTGCGGTGGATGTGAC-3', SEQ ID NO.6; PR: 5'-GTGGGGCTGCGGGAGATGCG-3', SEQ ID NO.7.

[0038] Example 4 The method for detecting the black and white tail feather genotype of chickens using the above primer pair P includes the following steps: This embodiment is used to further detect the genotype of black and white tail feathers in chickens after confirming the GG genotype of Colombian feathers, and includes the following steps: (1) Sampling of the chickens to be tested The chicken blood samples to be tested were collected from Angel Poultry Breeding Co., Ltd., and included 160 Babcock B380 hens. The DNA from the chicken blood was used as a template, and PCR amplification was performed using the above-mentioned primer pair P.

[0039] (2) PCR amplification and enzyme digestion incubation The PCR amplification reaction system was as follows: 20 μl of 2×Taq PCR masterMix, 2 μl of PF, 2 μl of PR, 2 μl of DNA template, and 14 μl of ddH2O.

[0040] The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 64.9℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃.

[0041] The enzyme digestion reaction system consisted of 10 μl of PCR product, 1 μl of HinP1I, 2 μl of 10×buffer, and 18 μl of ddH2O, and was incubated in a water bath for 8 hours.

[0042] (3) Genotyping: PCR amplification and enzyme digestion products were separated by 4.0%-5.0% agarose gel electrophoresis with a 1×TAE electrophoresis buffer concentration, a voltage of 150V, and an electrophoresis time of 30min. The gel electrophoresis imaging system was used to obtain electrophoretic patterns, and the black and white tail feather genotype of chickens was detected based on the patterns.

[0043] The specific basis is as follows: The TC genotype corresponds to white tail feathers. PCR amplification and enzyme digestion product sequences are 66bp, 104bp, and 124bp in length, respectively, resulting in three bands in the genotyping results. Individuals with the TC genotype are heterozygous (T / C) at position 1341621 on chicken chromosome 34, carrying a single-base mutation at this site (mutation at position 169 of SEQ ID NO. 5). Aggtgcccattgcggtggatgtgacacagctggaggtggcagcgggggacggcgggagcttcgtgcgcaaccgccccgtggccttcaacgtgaggct gcacgaccccagccattacctgcgtgatgctgacatctcctattcgtgggacttcggggaccagagcggcacactcatctcccgcagccccac, seq ID NO.5.

[0044] The phenotype corresponding to the CC genotype is black tail feathers. The PCR amplification and enzyme digestion product sequences are 66bp and 104bp in length, and the genotyping result is two bands. Individuals with the CC genotype are homozygous mutants at 1341621 bases on chromosome 34 (as shown in SEQ ID NO.8).

[0045] Aggtgcccattgcggtggatgtgacacagctggaggtggcagcgggggacggcgggagcttcgtgcgcaaccgccccgtggccttcaacgtgaggct gcacgaccccagccattacctgcgtgatgctgacatctcctattcgtgggacttcggggaccagagcggcacCctcatctcccgcagccccac, seq ID NO.8.

[0046] (4) Test results The Babcock B380 black-tail fractal result shows two bands, such as... Figures 4 to 19 As shown in lanes 3-7 of the middle swim grout line, the PCR amplification and enzyme digestion product sequences were 66 bp and 104 bp in length, indicating a CC genotype. The Babcock B380 white-tailed genotype showed three bands. Figures 4 to 19 Lanes 8-12 of the middle swimming pool yielded PCR amplification enzyme digestion product sequences of 66bp, 104bp, and 124bp in length. The genotyping results of the Babcock B380 black-tailed chicken population using this invention were completely consistent with the phenotype, as shown in Table 1. Furthermore, resequencing genotyping results in 12 different Colombian black-tailed chicken breeds demonstrated that this method has good accuracy and reliability, as shown in Table 2.

[0047] Table 1. Results of tail feather genotyping of the Babcock B380 black-and-white tailed chicken population using the method of the present invention.

[0048] Table 2 shows the genotyping results of 12 Colombian black-tailed chicken species using resequencing data.

[0049] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0050] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of a reagent for chicken genotyping and assisted breeding, characterized in that, The reagent is used to detect the following two single nucleotide polymorphism (SNP) sites: (i) SNP locus 1: located at position 10892295 on chicken Z chromosome, with genotype A or G, which is associated with Columbia feather type; (ii) SNP locus 2: located at position 1341621 on chicken chromosome 34, with a genotype of T or C, which is associated with the black and white tail trait; The detection is used to genotype chickens with Columbia feather type and / or black and white tail traits.

2. A primer set for detecting SNP site 1 and / or SNP site 2 as described in claim 1, characterized in that, Include: Primer pair K is used to specifically amplify the DNA fragment containing SNP site 1 as described in claim 1; And / or primer pair P, for specifically amplifying DNA fragments containing SNP site 2 as described in claim 1; Furthermore, both primers in primer pair K and primer pair P are mismatched primers, which can introduce artificial sites for restriction endonuclease digestion analysis into the PCR product.

3. The primer set according to claim 2, characterized in that, The specific sequence of primer pair K is as follows: KF: 5'-GAAATAAGGAATACTGGGTGGGAG- 3', SEQ ID NO. 2; KR: 5'-CTCTTTGGATGGATGGCTGGC-3'SEQ ID NO.3; The specific sequence of primer pair P is as follows: PF: 5'-AGGTGCCCATTGCGGTGGATGTGAC-3', SEQ ID NO.6; PR: 5'-GTGGGGCTGCGGGAGATGCG-3', SEQ ID NO.

7.

4. A kit for detecting Columbia feather type and / or black and white tail traits in chickens, characterized in that, Primer pair K and / or primer pair P comprising the sequence of claim 3.

5. The reagent kit according to claim 4, characterized in that, It also contains restriction endonucleases for digesting PCR products of primer pair K and / or primer pair P; The restriction endonuclease used to digest the PCR product of primer pair K was HaeIII. The restriction endonuclease used to digest the PCR product of primer pair P was HinP1I.

6. A method for detecting Columbia feather type and / or black and white tail traits in chickens, characterized in that, Includes the following steps: (a) Obtaining genomic DNA samples from chickens; (b) Using primer pair K and / or primer pair P as described in claim 3, perform PCR amplification and detection on the genomic DNA to determine the genotypes of the following two SNP sites: A / G genotype at position 10892295 on chicken Z chromosome; The T / C genotype at position 1341621 on chicken chromosome 34; (c) Based on the test results of step (b), determine the genotype of the chicken’s Columbia feather type and / or black and white tail trait.

7. The method according to claim 6, characterized in that, The method for determining the genotype of the specific SNP loci in step (b) is as follows: Chicken Columbia feather genotype: If the PCR digestion product size is 169bp, the genotype of the chicken being tested is GG; if the PCR digestion product size is 169bp or 185bp, the genotype of the chicken being tested is GA; if the PCR digestion product size is 185bp, the genotype of the chicken being tested is AA. Genotypes of black and white tail feathers in chickens: If the size of the PCR digestion product is 66bp, 104bp, or 124bp, then the genotype of the chicken being tested is TC; if the size of the PCR digestion product is 66bp or 104bp, then the genotype of the chicken being tested is CC.

8. The method according to claim 7, characterized in that, Chickens with the GG genotype exhibit Colombian plumage, while chickens with the GA and AA genotypes exhibit non-Colombian plumage. Chickens with the TC genotype have white tails, while chickens with the CC genotype have black tails.

9. The method according to claim 6, characterized in that, In step (b), the PCR reaction system for primer set K and primer set P amplification is as follows: 20 μl of 2×Taq PCR masterMix, 2 μl of upstream primer, 2 μl of downstream primer, 2 μl of DNA template, and 14 μl of ddH2O; The PCR reaction program for primer set K amplification was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 61.9℃ annealing for 1 min, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min. The PCR reaction program for primer set P amplification was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 64.9℃ annealing for 1 min, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min.

10. The application of the primer set according to any one of claims 2-3, the kit according to any one of claims 4-5, or the method according to any one of claims 6-9, characterized in that, The application is in any of the following directions: (1) Application in detecting Columbia feather type and / or black and white tail in chickens; (2) Application in the combined genotyping detection of Columbia feather type and black and white tail traits in chickens; (3) Application in the breeding of chickens with specific traits of Colombian feather type and black and white tail.

Images