A SNP molecular genetic marker for the WNT6 gene associated with chicken feed conversion ratio and its application

Abstract

This invention discloses a SNP molecular genetic marker for the WNT6 gene related to feed conversion ratio in chickens and its application, belonging to the fields of animal genetics and breeding and molecular biology. The aforementioned SNP molecular genetic marker is located at locus 22401119 of the rs733687399 sequence on chicken chromosome 7, and the locus is a T>G mutation. On the one hand, this invention provides the SNP molecular genetic marker chr7-22401119, which is significantly correlated with the feed conversion ratio trait in yellow-feathered broilers. It can be applied to the breeding of yellow-feathered broilers, allowing for the selection of yellow-feathered broilers with low feed conversion ratios, effectively reducing feed consumption during production and improving the economic benefits and competitiveness of enterprises. On the other hand, this invention also provides primers and a kit for identifying the SNP molecular genetic marker chr7-22401119, which can be used for efficient screening of individuals or parents with excellent feed conversion ratio traits in yellow-feathered broilers.

Description

Technical Field

[0001] This invention relates to the fields of animal genetics and breeding and molecular biology, specifically to a SNP molecular genetic marker of the WNT6 gene related to chicken feed conversion rate and its application. Background Technology

[0002] Chicken is the world's most consumed meat product, boasting advantages such as low fat, high protein, and low price, with its global demand continuously increasing. Feed is a crucial element in yellow-feathered broiler breeding, accounting for approximately 70% of total feeding costs. Improving growth and feeding traits is essential for controlling feed costs. Feed conversion rate (FCR) is a vital feed trait in poultry farming, representing the ratio of standard feed kilograms to weight gain kilograms. Understanding the molecular basis of FCR is necessary for understanding feed conversion rate in yellow-feathered broilers. Previous research has shown that genetic selection can explain 85% to 90% of phenotypic improvements and plays a dominant role in the underlying genetic structure of feed conversion rate. With the development of low-cost and high-throughput sequencing, various marker-based genotyping platforms have provided alternatives to microarray-based genotyping, with single nucleotide polymorphism (SNP) microarrays currently being the most common choice in livestock and poultry farming.

[0003] Genome-wide association studies (GWAS) have been found to accurately identify genes for economically important traits in chickens. Using estimated whole-genome sequence data, GWAS can fully utilize all markers and detect trait-related variations without being affected by linkage disequilibrium between SNPs and potential genes. Over the past decade, the development of chicken SNP combinatorial studies has provided a powerful tool for GWAS, enabling the detection of small, relevant chromosomal regions. Single-marker GWAS can identify genomic regions and candidate genes with additive, additive-dominant, dominant, and sex-interaction effects associated with FCR traits. Studies have shown that the WNT6 protein can upregulate and amplify the expression of Pax3 and Pax7 in the dorsal somites. Both Pax3 and Pax7 act on satellite cells during muscle development, promoting satellite cell growth and fusion, thereby hypertrophying myofibrils and promoting animal muscle development. Developing SNP molecular markers related to feed conversion ratio (FCR) in chickens based on WNT6 can broaden the breeding direction for yellow-feathered broilers with low FCR and accelerate the genetic selection process. Summary of the Invention

[0004] To address the aforementioned technical problems, the purpose of this invention is to provide a SNP molecular genetic marker for the WNT6 gene related to chicken feed conversion rate and its application.

[0005] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0006] In a first aspect, the present invention provides a SNP molecular genetic marker for the WNT6 gene related to chicken feed conversion rate. The SNP molecular genetic marker is located at position 22401119 of the rs733687399 sequence on chicken chromosome 7, and the position is a T>G mutation.

[0007] The beneficial effects of this invention are as follows: There are differences in feed conversion rates among different genotypes of yellow-feathered broilers. This invention, through association analysis of feed conversion rates and whole-genome SNP genetic markers in yellow-feathered broilers, screened and obtained an effect genetic marker that affects feed conversion rates in yellow-feathered broilers. This genetic marker is located at position 22401119 of the rs733687399 sequence of the WNT6 gene on chromosome 7 of chicken, named chr7-22401119. Applying it to the breeding of yellow-feathered broilers can effectively select individuals with low feed conversion rates, effectively reduce feed consumption during production, and improve the economic benefits and competitiveness of enterprises. The chr7-22401119 genetic marker involved is the mutation site with SNP number chr7-22401119, which can be found in the NCBI Chicken Genome Database (bGalGal1.mat.broiler.GRCg7b).

[0008] Furthermore, G>T mutation represents different mutated alleles at a single site, where G is a high-frequency allele and T is a low-frequency allele, and the symbol > indicates the frequency of the allele.

[0009] Furthermore, the mutation sites and upstream and downstream sequences of the SNP molecular genetic marker are shown in SEQ ID NO.1, where K is the mutation site, and when K is G, it is a chicken with low feed conversion ratio;

[0010] SEQ ID NO.1:

[0011] 5'-TGGAGCAGGGGCTGGGAGGACGTGGGGGGCCCCAGGAGAGCAGCGCCAGGGCG

[0012] GTGGGAGCCTTGGCTGGGATTTCTCAGAGGTTGCGGGTGGTTTTGGGTGCTGCAGTCTGAGCTTTCCCTCACTCAGCCAGGCCGGTATCCGGGTTTCCCATCCTCCCCCTATCTGTATTACTACAAACTTTCCTAAAAAGCTTTTTKTTGTTGTTGTTGTTTTGGTTTTTTGGCC AAAACATTCTATTTTTGGTCTCTGTCCAGAGGGGATTTTTTTCCCCCAAGTTTGATTGAATTAATCTGTCTGGCTGTTTTTCAGCTCAAGCAATTGAAGGGAAAATTGTGCTCTTCCCGTTCGAAAAACAAATAAATAAAAATGAAGCCATTAACATCGCAGCATTCGGGCA-3'.

[0013] Furthermore, a method for determining the above-mentioned SNP molecular genetic markers is provided, the specific steps of which are as follows:

[0014] (1) Cultivate healthy yellow-feathered broiler individuals, and select yellow-feathered broilers with the lowest and highest feed conversion rates to collect and preserve blood;

[0015] (2) Extract DNA and perform DNA quality determination;

[0016] (3) Determine the SNP molecular genetic markers associated with the feed conversion rate trait in yellow-feathered broilers.

[0017] In a second aspect, the present invention provides primers for detecting the above-mentioned SNP molecular genetic markers, wherein the sequence of the forward primer is shown in SEQ ID NO.2 and the sequence of the reverse primer is shown in SEQ ID NO.3;

[0018] SEQ ID NO.2: 5'-TGGAGCAGGGCTGG-3';

[0019] SEQ ID NO. 3: 5'-TGCCCGAATGCTGCG-3'.

[0020] A third aspect of the present invention provides a kit for detecting SNP molecular genetic markers, comprising the primers described above.

[0021] Furthermore, the kit also includes 2×Taq Master Mix.

[0022] In a fourth aspect, the present invention provides the application of the above-mentioned SNP molecular genetic markers or primers or kits in screening chicken individuals or parents with low feed conversion ratios.

[0023] In a fifth aspect, the present invention provides a method for screening chickens with low feed conversion ratio, wherein the above-mentioned SNP molecular markers of the individuals to be screened are amplified and sequenced using PCR technology, and homozygous individuals with the SNP molecular marker genotype GG are selected as chickens with low feed conversion ratio.

[0024] Furthermore, the method for screening chickens with low feed conversion ratio based on the above-mentioned kit for detecting SNP molecular genetic markers includes the following steps:

[0025] (1) Blood was collected from the wing vein of the individual to be tested, anticoagulated with EDTA, stored at -20℃, and DNA was extracted.

[0026] (2) The kit contains 2×Taq Master Mix, forward and reverse primers;

[0027] (3) The PCR products were sequenced using the Sanger sequencing method;

[0028] (4) Select homozygous individuals with the GG genotype at position 22401119 on chromosome 7.

[0029] Furthermore, the PCR system was a 20 μL system, including 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to 20 μL.

[0030] Furthermore, the PCR reaction conditions were as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0031] The present invention has the following beneficial effects:

[0032] (1) The present invention provides a SNP molecular genetic marker chr7-22401119, which is significantly associated with the feed conversion rate trait of yellow-feathered broilers. It can be applied to the breeding of yellow-feathered broilers. By selecting yellow-feathered broilers with low feed conversion rate during the breeding process, the amount of feed consumed in the production process can be effectively reduced, and the economic benefits and competitiveness of enterprises can be improved.

[0033] (2) This invention provides primers and kits for identifying the SNP molecular genetic marker chr7-22401119, which can be applied to efficiently screen individuals or parents of yellow-feathered broilers with excellent feed conversion ratio. Attached Figure Description

[0034] Figure 1 Manhattan diagram for SNP molecular genetic markers;

[0035] Figure 2 Genotype sequencing diagram for SNP molecular genetic markers. Detailed Implementation

[0036] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0037] Example 1: Screening of SNP molecular genetic markers

[0038] The screening process for SNP molecular genetic markers includes the following steps:

[0039] 1872 healthy yellow-feathered broiler chickens were selected and fed to their maximum capacity for 49 days. The daily feed intake, initial body weight, and final body weight of each chicken were recorded. The feed conversion ratio was calculated using the following formula:

[0040] ;

[0041] In the formula, FCR is the feed conversion ratio; W f For feed consumption; W a To increase the weight of living organisms.

[0042] A lower FCR value, indicating a lower feed conversion ratio, means less feed is consumed for the same production capacity, thus saving feed. DNA was extracted from each sample, and the DNA samples underwent quality testing. DNA concentration was measured using a Qubit Fluorometer, and DNA fragment size and degradation were measured using agarose gel electrophoresis. The results showed that 99 samples were substandard, and the 1773 qualified DNA samples from yellow-feathered chicken breeder chickens were used for subsequent library construction and sequencing. Simplified genome sequencing was performed using high-throughput yield measurement technology. Sequencing data underwent quality control and filtering to remove low-quality sequencing reads and potential false positive BNPs. Feed conversion ratio was used as a phenotype and correlated with SNP data. GWAS analysis was performed using the EMMAX program (http: / / genetics.cs.ucla.edu / emmax / index.html), and the analysis model is as follows:

[0043] y=Xb+Zu+m+e

[0044] In the model, y represents the true value of the trait record, X represents the fixed-effects association matrix, b represents the fixed-effects vector, the fixed effects include batch effects and three principal component effects, Z represents the additive genetic effects association matrix, u represents the individual additive genetic effects vector, e represents the residual, and u ~ N(0, Gσ) 2 α ), e~N(0, Iσ 2 ε α), G represents the genomic kinship matrix, I represents the identity matrix, σ 2 α σ 2 ε represents the variance of the additive genetic effect and the variance of the residuals, respectively, and m represents the SNP marker effect.

[0045] Based on the association analysis results, a SNP molecular marker associated with the feed conversion ratio trait in yellow-feathered broilers was identified. This molecular marker is located in the WNT6 gene on chromosome 7 of yellow-feathered broilers, specifically at locus 22401119 of the rs733687399 sequence on chromosome 7, named chr7-22401119. Figure 1 The Manhattan diagram shows the mutation site of this SNP molecular genetic marker and the upstream and downstream primer sequences as shown in SEQ ID NO.1.

[0046] SEQ ID NO.1:

[0047] 5'-TGGAGCAGGGGCTGGGAGGACGTGGGGGGCCCCAGGAGAGCAGCGCCAGGGCG

[0048] GTGGGAGCCTTGGCTGGGATTTCTCAGAGGTTGCGGGTGGTTTTGGGTGCTGCAGTCTGAGCTTTCCCTCACTCAGCCAGGCCGGTATCCGGGTTTCCCATCCTCCCCCTATCTGTATTACTACAAACTTTCCTAAAAAGCTTTTTKTTGTTGTTGTTGTTTTGGTTTTTTGGCC AAAACATTCTATTTTTGGTCTCTGTCCAGAGGGGATTTTTTTCCCCCAAGTTTGATTGAATTAATCTGTCTGGCTGTTTTTCAGCTCAAGCAATTGAAGGGAAAATTGTGCTCTTCCCGTTCGAAAAACAAATAAATAAAAATGAAGCCATTAACATCGCAGCATTCGGGCA-3'.

[0049] K is the T>G mutation site. When K is G, chickens have a lower feed conversion rate. 5'- and -3' represent the 5' end and 3' end of the nucleotide sequence, respectively.

[0050] Example 2: Validation of SNP molecular genetic markers

[0051] I. The verification of SNP molecular genetic markers specifically includes the following steps:

[0052] The SNP molecular genetic marker chr7-22401119 obtained in Example 1 was validated in another yellow-feathered broiler population. A total of 1773 healthy yellow-feathered broiler individuals were fed to satiety for 49 days. The daily feed intake, initial weight and final weight of each chicken were recorded. The feed conversion ratio was calculated. 150 individuals with low feed conversion ratio (negative value) and 150 individuals with high feed conversion ratio (positive value) were selected, and blood was taken for DNA extraction.

[0053] Then, using the extracted DNA as a template, PCR reaction was performed with the forward and reverse primers shown in SEQ ID NO.2-3.

[0054] SEQ ID NO.2: 5'-TGGAGCAGGGCTGG-3';

[0055] SEQ ID NO. 3: 5'-TGCCCGAATGCTGCG-3'.

[0056] The PCR reaction system was a 20 μL system, including 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to 20 μL.

[0057] The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0058] Finally, the PCR products were sequenced using the Sanger sequencing method.

[0059] II. Results Analysis

[0060] The sequencing results were analyzed, and the genotype of each individual was recorded according to the sequencing peak diagram of each sample (e.g., Figure 2As shown in Tables 1 and 2), the corresponding sequencing sites of genotype TT show only one peak, indicating that the alleles are the same (T); the corresponding sequencing sites of genotype TG show two peaks, indicating that the alleles are different (one is G and the other is T); the corresponding sequencing sites of genotype GG show only one peak, indicating that the alleles are the same (G). One-way ANOVA using SPSS 26.0 was used to analyze the relationship between SNP molecular marker genotypes and alleles and feed conversion ratio. The results are shown in Tables 1 and 2.

[0061] Table 1. Statistical table of distribution differences of SNP molecular genetic marker genotypes between low and high feed conversion ratios.

[0062]

[0063] Table 2. Statistical table of distribution differences of SNP molecular genetic marker alleles between low and high feed conversion ratios.

[0064]

[0065] The results in the table show that, in the SNP molecular genetic marker chr7-22401119, both genotype and allele frequencies differed significantly between the low and high feed conversion ratio (FCR) groups (P < 0.01). In the low FCR group, the frequency of the G allele was higher than that of the T allele, and the frequency of the GG genotype was higher than that of the TT genotype, indicating that individuals with the GG genotype at position 201 had a better FCR phenotype than those with the TT genotype. This further demonstrates that the polymorphism of the screened SNP molecular genetic marker chr7-22401119 is significantly associated with the FCR trait, making it a feed conversion ratio-associated SNP locus that can be used for breeding yellow-feathered broilers with low FCR.

[0066] Example 3: Assisted molecular breeding method for feed conversion ratio trait in yellow-feathered broilers based on SNP molecular genetic marker chr7-22401119

[0067] This invention provides a kit for detecting the SNP molecular genetic marker chr7-22401119, the kit comprising 2×Taq Master Mix, forward and reverse primers as shown in SEQ ID NO.2-3, and ddH2O.

[0068] The specific method includes the following steps:

[0069] (1) Blood was collected from the wing vein of the yellow-feathered broiler individual to be tested, anticoagulated with EDTA, stored at -20℃, and DNA was extracted.

[0070] (2) Perform PCR on the DNA extraction product from step (1). The PCR reaction system is a 20 μL system, including 10 μL of 2×TaqMaster Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to 20 μL. The PCR reaction conditions are: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0071] (3) The PCR products from step (2) were sequenced using the Sanger sequencing method.

[0072] (4) Genotyping is performed based on the sequencing results. Homozygous individuals with the SNP molecular genetic marker chr7-22401119 as the GG genotype are selected for breeding to reduce feed conversion rate and effectively reduce feed consumption and breeding costs. Individuals with this marker are selected to join the core breeding population, which can achieve rapid homozygosity of the alleles related to this trait and provide technical support for accelerating the progress of genetic selection.

[0073] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of primers for detecting SNP molecular genetic markers related to chicken feed conversion ratio in the assisted screening of yellow-feathered broilers with low feed conversion ratio, characterized in that, The SNP molecular genetic marker is located at position 22401119 of chicken chromosome 7, with RS number rs733687399. This site is a T>G mutation. Homozygous individuals with the SNP molecular genetic marker genotype GG are selected as yellow-feathered broiler chickens with low feed conversion ratio.

2. The application according to claim 1, characterized in that, The mutation sites and upstream and downstream sequences of the SNP molecular genetic marker are shown in SEQ ID NO.1, where K is the mutation site. When K is G, it is a yellow-feathered broiler with low feed conversion ratio.

3. The application according to claim 1, characterized in that, The primers include a forward primer and a reverse primer, the sequence of which is shown in SEQ ID NO.2 and the sequence of which is shown in SEQ ID NO.

3.

4. A method for assisting in screening yellow-feathered broiler chickens with low feed conversion ratio, characterized in that, The SNP molecular genetic markers of the individuals to be screened are amplified and sequenced using PCR technology, and homozygous individuals with the SNP molecular genetic marker genotype GG are selected as yellow-feathered broiler chickens with low feed conversion ratio.

Images