Gene target and medicine for treating glycolipid metabolism related diseases

Abstract

The invention relates to a gene target spot and a medicine for treating glycolipid metabolism related diseases, and belongs to the technical field of biological medicines. The invention provides application of an ARPP21 gene and / or protein as a target spot in preparation of drugs for preventing and / or treating diseases related to glycolipid metabolism. The invention finds that the weight of an ARPP21 knockout mouse becomes lighter, visceral organs are injured, and compared with a wild mouse, the liver has fat deposition and lipid metabolism related factor expression is up-regulated. According to the present invention, by constructing the AML-12 cell capable of overexpressing and knocking down the Arpp21, the expression of the lipid metabolism related gene of the AML-12 cell capable of knocking down the ARPP21 is increased, and after the cell lipid deposition is induced, the adiposis of the AML-12 cell capable of overexpressing the Arpp21 is reduced; according to the invention, the function and mechanism of the ARPP21 participating in glycolipid metabolism pathways in the liver and muscles are defined, and a new therapeutic target and strategy are provided for glycolipid metabolic diseases.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a gene target and drug for the treatment of diseases related to glucose and lipid metabolism. Background Technology

[0002] Skeletal muscle secretion factors play a crucial role in maintaining metabolic homeostasis. Since the discovery in 2000 that skeletal muscle produces and releases interleukin-6 (IL-6), its endocrine function has been recognized. Skeletal muscle not only contracts in response to movement but also produces and secretes hundreds of myokines, which function through autocrine, paracrine, or endocrine mechanisms. Myokines mediate communication between muscles and other organs, including the brain, adipose tissue, bones, liver, intestines, pancreas, vascular beds, and skin, as well as within the muscle itself.

[0003] The interaction between skeletal muscle and the liver plays a crucial role in various physiological and pathological processes. Studies have found that factors such as insulin resistance, resistance to protein synthesis metabolism, and systemic inflammation are key pathophysiological processes leading to fatty liver disease accompanied by sarcopenia. Skeletal muscle possesses important endocrine functions; under contractile stimulation, it can release muscle factors to form "crosstalk" interactions with various tissues and organs, playing a vital role in disease prevention and delaying chronic diseases. For example, Chinese patent CN105561336A discloses the use of the ARPP-19 gene in the preparation of drugs for treating liver cancer, finding that low ARPP-19 expression leads to cell cycle arrest, proliferation disorders, and reduced colony formation in liver cancer cells.

[0004] The interaction between RNA molecules and RNA-binding proteins (RBPs) is one of the important mechanisms regulating gene expression. These interactions affect RNA processing, transport, stability, and function, thereby controlling cell fate and physiological state. With the development of science and technology, researchers have gradually revealed the complex interaction network between RNA and proteins, providing new perspectives for understanding the fine regulation of life processes.

[0005] Although studies have shown that RNA-binding proteins (RBPs) play an important role in regulating gene expression and metabolic homeostasis, the specific mechanisms of action of RBPs in muscle and liver, as well as their impact on glucose and lipid metabolism, still require further investigation. Furthermore, the effects of exercise on RNA epigenetic modifications and its regulatory mechanisms on liver metabolism through blood circulation are not fully elucidated. Therefore, in-depth research into the epigenetic regulatory mechanisms mediated by RBPs will not only help reveal metabolic interactions but may also provide new targets and strategies for the treatment of metabolic diseases. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a gene target and drug for the treatment of glucose and lipid metabolism-related diseases.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides the use of the ARPP21 gene and / or protein as a target in the preparation of drugs for the prevention and / or treatment of diseases related to glucose and lipid metabolism.

[0008] This invention found that ARPP21 knockout mice exhibit significant fat deposition in their livers. The expression of lipid metabolism-related factors was upregulated in ARPP21 knockout mice and ARPP21 knockdown AML-12 cells. Compared with ARPP21 knockdown AML-12 cells, ARPP21 overexpressing AML-12 cells showed reduced fatty degeneration after treatment with sodium oleate and free fatty acids.

[0009] Secondly, the present invention provides the use of the ARPP21 gene and / or protein in the preparation of medicaments for the prevention and / or treatment of diseases related to glucose and lipid metabolism.

[0010] Thirdly, the present invention provides the use of an ARPP21 gene and / or protein expression promoter in the preparation of medicaments for the prevention and / or treatment of diseases related to glucose and lipid metabolism.

[0011] Furthermore, the ARPP21 gene and / or protein expression promoter includes an ARPP21 gene and / or protein expression cassette or an expression vector containing the ARPP21 gene.

[0012] Furthermore, the aforementioned glucose and lipid metabolism disorders include fatty liver.

[0013] Fourthly, the present invention provides a recombinant expression vector that overexpresses the ARPP21 gene and / or protein.

[0014] Fifthly, the present invention provides a recombinant cell containing the recombinant expression vector described above.

[0015] In a sixth aspect, the present invention provides a medicament for the prevention and / or treatment of diseases related to glucose and lipid metabolism, the medicament containing an expression promoter of the ARPP21 gene and / or protein.

[0016] Furthermore, the expression promoter of the ARPP21 gene and / or protein includes the recombinant expression vector or the recombinant cells.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention reveals that ARPP21 knockout mice exhibit lighter body weight and organ damage, with fat deposition in the liver compared to wild-type mice. The expression of lipid metabolism-related factors (PPara, Srebf1, Cptla, Fas, Scd1) is upregulated. ARPP21 further regulates glucose and lipid metabolism homeostasis in skeletal muscle and liver by acting on the expression levels of the FGF family, clarifying the role of Arpp21 in muscle and liver metabolic-related diseases. By constructing AML-12 cells that overexpress and knock down Arpp21, it was found that the expression of lipid metabolism-related genes (PPara, Srebf1, Cptla, Fas, Scd1) was increased in ARPP21-knockdown AML-12 cells. After inducing lipid deposition in hepatocytes through treatment with sodium oleate and free fatty acids, the steatosis in Arpp21-overexpressing AML-12 cells was reduced. This invention clarifies the function and mechanism of ARPP21 in the glucose and lipid metabolism pathways in the liver and muscle, and elucidates the specific mechanism of ARPP21 as an RNA-binding protein in the muscle-liver axis, providing new therapeutic targets and strategies for glucose and lipid metabolism diseases. Attached Figure Description

[0018] Figure 1 Arpp21 deficiency affects skeletal muscle development in mice and is accompanied by abnormalities in other organs. A is a flowchart of the mouse experiment; B shows the organs of different groups of mice; C shows the H&E pathological staining of the liver of different groups of mice.

[0019] Figure 2 A bar chart showing the distribution of compound categories in the metabolomics analysis of Arpp21-MKO mice.

[0020] Figure 3 A bar chart showing the pathway categories counted for metabolomics analysis in Arpp21-MKO mice.

[0021] Figure 4 The bar charts show the grouped up- and down-regulated metabolic factors in Arpp21-MKO mice compared to wild-type mice. Specifically, A represents the grouped bar charts of up- and down-regulated total metabolic factors; B represents the grouped bar charts of up- and down-regulated lipid metabolism-related metabolic factors.

[0022] Figure 5 Metabolite volcano plot of Arpp21-MKO mice compared to wild-type mice.

[0023] Figure 6 The results of q-PCR detection of lipid metabolism-related factors in Arpp21-MKO mice.

[0024] Figure 7 The plasmid is for overexpressing ARPP21.

[0025] Figure 8 Oil Red staining results for AML-12 cells with overexpression or knockdown of Arpp21.

[0026] Figure 9 To determine the expression of lipid metabolism-related factors in AML-12 cells with ARPP21 knockdown.

[0027] Figure 10 Arpp21 regulates FGFs family factors. A shows the WB efficiency verification results of constructing stable Arpp21 overexpression and knockdown strains; B shows the differential expression map of Arpp21 overexpression; C shows the differential expression map of Arpp21 knockdown; and D shows the Venn diagram of gene expression differences between Arpp21 overexpression and knockdown.

[0028] Figure 11 The results of q-PCR detection of FGF family-related factors in muscle tissue of Arpp21-MKO mice.

[0029] Figure 12 The results of q-PCR detection of FGF family-related factors in liver tissue of Arpp21-MKO mice.

[0030] Figure 13 Western blotting was used to detect the expression levels of Arpp21-regulated FGF family factors in skeletal muscle and liver. In this study, A shows the Western blotting results of FGF family-related factors in muscle tissue of Arpp21-MKO mice; B shows the Western blotting results of FGF family-related factors in liver tissue of Arpp21-MKO mice. Detailed Implementation

[0031] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, other materials and reagents used in the embodiments are commercially available.

[0032] Example 1: Arpp21 deficiency affects skeletal muscle development in mice and is accompanied by abnormalities in other organs. LoxP sites were inserted flanking key exons of the Arpp21 gene to construct mice carrying the Arpp21fl / fl alleles. Cre recombinase expression was driven using a skeletal muscle-specific promoter (HSA), ensuring tissue specificity of the knockout by activating Cre only in skeletal muscle cells. Mice carrying the Arpp21fl / fl alleles were crossed with HSA-Cre transgenic mice to produce skeletal muscle-specific Arpp21 knockout (Arpp21-MKO) mice. Arpp21-MKO mice and control mice were named Arpp21-MKO and Arpp21-WT (also known as flux / flox), respectively. Figure 1As shown in Figure A, these mice were injected daily with corn oil or tamoxifen for one week (from 4 to 5 weeks of age). The mice's major organs, including the heart, liver, spleen, lungs, and kidneys, were dissected, and the liver was subjected to H&E pathological staining analysis.

[0033] Seven days after tamoxifen injection, Arpp21-MKO mice showed reduced body size at 6 weeks of age. The Arpp21-MKO mice exhibited severe pulmonary congestion (likely related to lung compression caused by blood collection from the eyes), and significant swelling of the liver, spleen, and kidneys, indicating that knocking out ARPP21 in muscle affects more than just muscles and may be accompanied by abnormalities in other organs. Figure 1 B). Furthermore, liver H&E pathological staining results showed that Arpp21-MKO mice exhibited more pronounced fat deposition than wild-type mice. Figure 1 C).

[0034] Example 2: Arpp21 deficiency leads to lipid metabolism disorder To determine whether lipid deposition in the liver was caused by lipid metabolism abnormalities due to ARPP21 deficiency, plasma from mice in Example 1 was collected and metabolomics analysis was performed.

[0035] like Figure 2 , Figure 3 As shown in Table 1, the most altered metabolic profiles are in lipid metabolism molecules.

[0036] Table 1. Statistical distribution of compound categories in metabolomics analysis of Arpp21-KO mice. Example 3: Arpp21 significantly regulates changes in lipid metabolism factors. The factors that changed in the metabolic profile of Example 2 were analyzed.

[0037] like Figure 4 A, Figure 4 B and Figure 5 As shown, after knocking out Arpp21, 208 metabolic factors were significantly upregulated and 255 were significantly downregulated. Among them, 31 metabolic factors related to lipid metabolism were upregulated and 17 were downregulated (different colors represent different relative abundances of metabolites, red indicates relatively high abundance, blue indicates relatively low abundance, and the redder or bluer the color, the higher or lower the relative abundance between groups).

[0038] Example 4: Arpp21-regulated differential lipid metabolites and glucose metabolites are strongly correlated. The correlations between differentially metabolites in Example 3 were analyzed, and the significance of the correlations was calculated (the smaller the P-value, the more significant the correlation). Furthermore, based on the correlations between differentially metabolites, correlation pairs were obtained, and relationships with |rho|>0.7 were selected.

[0039] The results showed that knocking out Arpp21 led to a strong correlation between differential lipid metabolites and glucose metabolites.

[0040] Example 5: Arpp21 affects hepatic lipid deposition 1. qPCR was used to detect lipid metabolism-related factors in the mice of Example 1.

[0041] The qPCR primer sequences are shown in Table 2. The amplification system is as follows: SYBR dye: 5 μL / well, primary water: 2 μL / well, front primer: 0.5 μL / well, back primer: 0.5 μL / well, mouse cDNA: 2 μL / well.

[0042] Amplification program: A two-step program was used, with pre-denaturation at 95℃ for 5 min; followed by 10 s at 95℃ and 30 s at 60℃, for 40 cycles.

[0043] Table 2 like Figure 6 As shown, the five lipid metabolism-related factors (PPara, Srebf1, Cptla, Fas, and Scd1) detected were all upregulated in the Arpp21 knockout group.

[0044] 2. Construct AML-12 cells overexpressing ARPP21 using the PLVX vector (AML-12 cells are normal mouse hepatocytes). This vector carries the strong CMV promoter, which can drive the transcription of the inserted target gene (Arpp21) in eukaryotic cells (AML-12), ensuring the efficient synthesis of the target gene mRNA. Figure 7 ).

[0045] (1) PCR amplification of the Arpp21 target gene The PCR reaction system consisted of: 2× buffer 25 μL, dNTP 1 μL, upstream primer (mPLVX-V5-Arpp21-APO-cloneF) 2 μL, downstream primer (mPLVX-V5-Arpp21-APO-cloneR) 2 μL, template (pTRE3G vector) 0.2 μL, enzyme 1 μL, and water to make up to a total PCR reaction volume of 50 μL.

[0046] The buffer and enzyme used were premixed solutions of Novizan (2×Phanta Max Master Mix).

[0047] mPLVX-V5-Arpp21-APO-cloneF:TCGAGCTCAAGCTTCGAATTCGGCAAGCCCATCCCCAAC; mPLVX-V5-Arpp21-APO-cloneR:GTACCGTCGACTGCAGAATTCCTTCAGGCCTGTGGCCCA.

[0048] The PCR reaction program was as follows: 95℃ for 3 min pre-denaturation; 95℃ for 15 s denaturation, 56~72℃ for 15 s annealing, 72℃ for 30~60 s / kb extension; 25~35 cycles; 72℃ for 5 min for complete extension; 12℃ maintenance.

[0049]

[0050] (2) Connecting the target gene to the vector Prepare the ligation system: 2 μL of 5×CEⅡ Buffer, 1 μL of PLVX vector (containing Puro selection marker), 1 μL of PCR amplification of Arpp21 target gene, 1 μL of Exnase Ⅱ enzyme, and add water to make up to a total ligation system of 10 μL.

[0051] The ligation system was incubated at 37°C for 40 min to obtain the ligation product. 10 μL of the ligation product was added to every 100 μL of competent cells, mixed well, and incubated on ice for 20 min. Then, the mixture was incubated in a 42°C metal bath for 50–60 s, followed by the addition of 500–600 μL of LOC medium. The mixture was shaken on a shaker for 1 h. 200 μL of the bacterial culture was then evenly spread onto LB solid medium and incubated upside down at 37°C to obtain a strain overexpressing Arpp21, which was then stored at -40°C.

[0052] (3) Extraction of plasmids Remove the centrifuge tube containing the strain overexpressing Arpp21 from -40℃, allow it to warm to room temperature, add 500 μL of Solution I containing RNase, vortex until the precipitate completely disappears, mix by pipetting with a 1 mL pipette, transfer to a 2 mL EP tube, add 500 μL of Solution II, invert and mix 7-8 times, let stand for 3 min, add 700 μL of Solution III, invert and mix 7-8 times, centrifuge at 14000 rpm for 10 min, and aspirate 700 μL of the supernatant.

[0053] Install the collection tube and filter column, add the supernatant to the filter column and filter to obtain the filtrate. Centrifuge at 13000 rpm for 30 seconds, discard the liquid in the collection tube, and repeat the step until the supernatant is completely filtered. Discard the liquid in the collection tube.

[0054] Add 500 μL of HBC Buffer to the filter column to obtain the filtrate, centrifuge at 13000 rpm for 30 s; discard the liquid in the collection tube, add 700 μL of DNA wash Buffer to the filter column to obtain the filtrate, centrifuge at 13000 rpm for 30 s, discard the liquid in the collection tube, repeat twice, then centrifuge at 13000 rpm for 2 min to completely dry, add 40 μL of sterile water preheated to 55~60℃, let stand for 1 min, centrifuge at 13000 rpm for 2 min, take the supernatant to detect DNA concentration and OD260 / 280 value, and obtain the plasmid overexpressing Arpp21.

[0055] (4) Packaging plasmids Take the corresponding number of 6 cm culture dishes, add 3 mL of gelatin to each, and place them in an incubator at 37℃ for at least 5 min, then discard the gelatin; passage 293T cells in medium containing 10% (v / v) FBS + 1% (v / v) P / S (100 U / mL penicillin and 0.1 mg / mL streptomycin), ensuring a cell density of 80-90% at transfection. Aspirate the supernatant, slowly add 2 mL of DMEM containing 5% (v / v) FBS and without penicillin and streptomycin (preheated to 37℃ in an incubator) along the cell wall, return to the incubator, and let stand for 30 min.

[0056] 4 μL of packaging plasmid, 4 μL of Arpp21 overexpressing plasmid, and 250 μL of Optimum medium were mixed to obtain solution A. 32 μL of 1 μg / μL PEI transfection reagent was mixed with 250 μL of Optimum medium and allowed to stand for 5 min to obtain solution B. Equal volumes of solutions A and B were mixed by pipetting and shaking; the mixture was then briefly shaken and allowed to stand for 15 min to obtain the prepared transfection solution. The prepared transfection solution was slowly added to 293T cells, and after culturing in an incubator for 6 h, the supernatant was collected to obtain the viral fluid, which was used as the viral fluid for infecting AML-12 cells.

[0057] (5) Transfecting cells AML-12 cells in logarithmic growth phase were injected at a rate of 5 × 10⁻⁶. 4 Cells were seeded at a density of 1 / well in 6-well plates and cultured for 24 h until cell confluence reached 70%–80%. Virus solution with verified titer was added to wells at an MOI of 5–10, along with 5–8 μg / mL Polybrene to enhance virus adsorption efficiency. The mixture was gently mixed and incubated at 37°C with 5% CO2 for 12–16 h. The next day, the medium was replaced with fresh complete medium (DMEM / F12 + 10% v / v FBS + 1% v / v penicillin and streptomycin) and cultured for another 48 h. After complete cell adhesion and proliferation, the medium was replaced with selection medium containing 2–5 μg / mL puromycin. This puromycin medium was changed every 2–3 days for 3–5 days until the uninfected control group cells died completely. After selection, single clones were picked or directly expanded for further culture and analyzed by Western spectroscopy. The efficiency of target gene knock-in can be detected by blot, or the proportion of positive cells can be verified by flow cytometry using a fluorescent label (such as GFP) carried by the vector, and finally AML-12 cells that stably overexpress ARPP21 can be obtained.

[0058] 3. An ARPP21-overexpressing AML-12 cells were treated with a 250 μmol / L sodium palmitate (SP) solution combined with a 500 μmol / L sodium oleate (SO) solution of free fatty acids (FFAs) for 48 h to establish a hepatocyte steatosis model and induce lipid deposition in hepatocytes.

[0059] like Figure 8 As shown, Oil Red staining results revealed that the experimental group (overexpressing ARPP21) showed reduced cellular fatty degeneration compared to the control group.

[0060] 4. Construct a plasmid to knock down ARPP21 and ARPP21-knockdown AML-12 cells using the PLKO vector. The shRNA sequence used in the ARPP21 knockdown plasmid is as follows: A21-sh3-F: CCGGCAGAAGTCTTGCTGTCTGTGACTCGAGTCACAGACAGCAAGACTTCTGTTTTTG (SEQ ID NO: 3); A21-sh3-R:AATTCAAAAACAGAAGTCTTGCTGTCTGTGACTCGAGTCACAGACAGCAAGACTTCTG (SEQ ID NO: 4).

[0061] The difference from constructing AML-12 cells that overexpress ARPP21 is that the plasmid that overexpresses Arpp21 is replaced with a plasmid that knocks down ARPP21.

[0062] Five lipid metabolism-related factors were detected by qPCR.

[0063] like Figure 9 As shown, qPCR results indicated that AML-12 cells with knocked-down ARPP21 showed increased expression of lipid metabolism-related genes (PPara, Srebf1, Cptla, Fas, Scd1).

[0064] Example 6: Arpp21 regulates FGFs family factors Transcriptome sequencing was performed on AML-12 cells overexpressing or knocking down Arpp21 constructed in Example 5, and Venn analysis was performed on these differentially expressed molecules. iCLIP data from experimental cells and other cell lines were studied using RBP function and Venn analysis was also performed.

[0065] like Figure 10 A to Figure 10As shown in Figure D, the 550 intersecting genes are enriched with members of the fibroblast growth factor family (FGFs): Fgf5, Fgf7, Fgf10, Fgf21, and Fgf23. The intersecting genes, including Fgf7, Fgf10, Fgf21, and Fgf23, all have potential binding ability with ARPP21.

[0066] Example 7: Arpp21 regulates the expression levels of FGF family factors in skeletal muscle and liver. The expression levels of FGFs in the skeletal muscle and liver of mice from Example 1 were detected by qPCR. The amplification system and procedure were the same as in step 1 of Example 5. Western blot experiments were performed using FGF7 antibody.

[0067] The qPCR primer sequences are shown in Table 3, and the detection system is the same as in Example 5.

[0068] Table 3 qPCR results showed that after Arpp21 knockout, skeletal muscle ( Figure 11 ) and liver ( Figure 12 RNA expression levels of FGFs were significantly reduced in skeletal muscle. Among them, FGFs Fgf7, Fgf21, and Fgf23 were significantly downregulated in skeletal muscle, while Fgf5, Fgf10, Fgf21, and Fgf23 were significantly downregulated in liver.

[0069] like Figure 13 A and Figure 13 As shown in Figure B, the Western blot results indicate that knocking out Arpp21 significantly reduced the expression levels of ARPP21 and FGF7 proteins in skeletal muscle, and the expression level of FGF7 protein also decreased in the liver.

[0070] Therefore, ARPP21 further regulates the metabolic homeostasis of glucose and lipid metabolism in skeletal muscle and liver by acting on the expression levels of the FGF family.

[0071] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. Application of ARPP21 gene and / or protein as targets in the preparation of drugs for the prevention and / or treatment of diseases related to glucose and lipid metabolism.

2. Application of ARPP21 gene and / or protein in the preparation of drugs for the prevention and / or treatment of diseases related to glucose and lipid metabolism.

3. Application of ARPP21 gene and / or protein expression promoters in the preparation of drugs for the prevention and / or treatment of glucose and lipid metabolism-related diseases.

4. Use according to any one of claims 1 to 3, wherein The ARPP21 gene and / or protein expression promoter includes an ARPP21 gene and / or protein expression cassette or an expression vector containing the ARPP21 gene.

5. Use according to any one of claims 1 to 3, wherein the compound is ###0002### The glucose and lipid metabolism disorders include fatty liver.

6. A recombinant expression vector, characterized in that, The recombinant expression vector overexpresses the ARPP21 gene and / or protein.

7. A recombinant cell, characterized in that, The recombinant cells contain the recombinant expression vector as described in claim 6.

8. A medicament for the prevention and / or treatment of diseases related to glucose and lipid metabolism, characterized in that, The drug contains an expression promoter of the ARPP21 gene and / or protein.

9. The drug as described in claim 8, characterized in that, The expression promoter of the ARPP21 gene and / or protein includes the recombinant expression vector of claim 6 or the recombinant cell of claim 7.

Images