Novel alginate lyase for specifically degrading undaria pinnatifida and application

Abstract

The invention relates to the technical field of biological enzyme molecular modification and marine biological resource high-value utilization, and provides novel alginate lyase for specifically degrading undaria pinnatifida, and the amino acid sequence of the novel alginate lyase is shown as SEQ ID NO.2. The invention also provides a coding gene of the alginate lyase, and a recombinant expression vector and recombinant engineering bacteria containing the gene. Meanwhile, the invention also provides application of the alginate lyase in degradation of undaria pinnatifida or preparation of alginate oligosaccharide. The alginate lyase N312E is obtained through site-specific mutagenesis, and the specific enzyme activity of the alginate lyase N312E is improved by 200% compared with that of a wild type; the enzyme can specifically degrade undaria pinnatifida, the conversion rate reaches 51.5% and is increased by 58.5% compared with a wild type, the enzyme has no effect on other brown algae, and an efficient enzyme preparation is provided for high-value utilization of undaria pinnatifida and preparation of alginate oligosaccharide.

Description

Technical Field

[0001] This invention relates to the field of bioenzyme molecular modification and high-value utilization of marine biological resources, and in particular to a novel alginate lyase that specifically degrades wakame seaweed and its application. Background Technology

[0002] Wakame seaweed is a large economic brown algae rich in nutrients such as alginic acid, protein, and minerals. It has been cultivated on a large scale in coastal areas of my country, such as Dalian and Shandong, with an annual output of over 300,000 tons, making it the second largest marine economic brown algae after kelp.

[0003] Currently, wakame seaweed is mainly consumed directly. With the development of deep processing technology, its rich content of alginic acid and other active ingredients has shown significant development value. Through enzymatic hydrolysis and other processes, fucoidan can be extracted and prepared. Low molecular weight fucoidan has been proven to have antioxidant, hypoglycemic, and anti-inflammatory biological activities, and can be used to develop functional ingredients or preparations, promoting the transformation of wakame seaweed from a traditional food to a high-value-added industrial raw material.

[0004] In the production process of fucoidan oligosaccharides, traditional methods mainly include chemical and physical methods, but both have significant drawbacks: chemical methods produce products with uneven structures, numerous byproducts, and are prone to environmental pollution; physical methods are energy-intensive and difficult to precisely control the degree of polymerization. In recent years, enzymatic degradation using alginate lyase has become the mainstream technology for fucoidan oligosaccharide production due to its advantages such as mild reaction conditions and controllable products.

[0005] However, the composition of brown algae varies significantly depending on their source, and the corresponding alginate lyases also exhibit distinct catalytic preferences, leading to key bottlenecks in existing technologies: First, the alginate lyases reported in existing patents mainly target brown algae such as Sargassum and Laminaria japonica, and no highly efficient degradation enzyme technology specifically targeting Wakame has yet emerged; second, a limited number of literature mentions strains and alginate lyases that can degrade Wakame (such as VfAly7 and Shewanella from Vibrio marine bacteria). Shewanella Both the extracellular crude enzyme solution of PKA 1008 and the alginate lyase derived from Pseudomonas aeruginosa have low degradation efficiency or poor stability, and cannot meet the needs of practical applications.

[0006] In 2024, the research team of this invention discovered a species of bioluminescent bacteria derived from tidal flats. Photobacterium gaetbulicolaThe alginate lyase AlgPg (GenBank accession number: AJR06654) effectively degraded wakame seaweed: after 9 hours of reaction at a wakame powder concentration of 80 mg / mL, 35°C, and pH 7.5, the conversion rate reached 32.5%. This conversion rate is the highest reported to date for the direct degradation of wakame, and it allows for direct degradation of the leaves without prior powdering pretreatment. However, even so, the catalytic efficiency of wild-type AlgPg still does not meet the requirements for industrial applications.

[0007] In order to further improve the degradation efficiency of alginate lyase AlgPg and realize its application value, this invention attempts to optimize its protein sequence to obtain a novel alginate lyase that can more efficiently and specifically degrade wakame seaweed. Summary of the Invention

[0008] The technical problem to be solved by the present invention is to provide a novel alginate lyase that specifically degrades wakame seaweed and its application. This enzyme has high specificity and high degradation activity for wakame seaweed, providing a better choice of dedicated degradation enzyme and technical support for the high-value utilization of wakame seaweed.

[0009] The present invention solves the above-mentioned technical problems by adopting the following technical solutions: A novel alginate lyase that specifically degrades wakame seaweed has the amino acid sequence shown in SEQ ID NO.2.

[0010] As one of the preferred embodiments of the present invention, the alginate lyase is obtained by structural optimization and improvement of the wild-type alginate lyase AlgPg with the amino acid sequence as shown in SEQ ID NO.1.

[0011] As one of the preferred embodiments of the present invention, the structural optimization and improvement is achieved through site-directed mutation.

[0012] As one of the preferred embodiments of the present invention, the site-directed mutagenesis is to mutate the asparagine at position 312 of the amino acid sequence shown in SEQ ID NO.1 to glutamic acid, corresponding to the single-point mutant N312E.

[0013] A gene encoding alginate lyase, the nucleotide sequence of which is shown in SEQ ID NO.3, is used to encode the aforementioned alginate lyase.

[0014] A recombinant expression vector containing the above-mentioned coding gene.

[0015] As one of the preferred embodiments of the present invention, the base vector of the recombinant expression vector is pET-28a.

[0016] A recombinant engineered bacterium containing the above-mentioned coding gene or recombinant expression vector.

[0017] As one of the preferred embodiments of the present invention, the host bacterium of the recombinant engineered bacteria is Escherichia coli BL21.

[0018] Application of the above-mentioned alginate lyase in the degradation of wakame seaweed or the preparation of brown algae oligosaccharides.

[0019] The advantages of this invention compared to the prior art are: (1) The N312E mutant alginate lyase of the present invention has a specific enzyme activity of 182.4±7.3 U / mg, which is 200% higher than that of wild type AlgPg; the conversion rate of degrading wakame is 51.5%, which is 58.5% higher than that of wild type, and is far superior to the wakame degrading enzymes reported in the present invention.

[0020] (2) The N312E mutant alginate lyase of the present invention has a highly efficient degradation effect on alginate in wakame seaweed, but no hydrolysis effect on other brown algae such as Sargassum and Sargassum fusiforme. It perfectly matches the component characteristics of wakame seaweed and provides a precise enzyme preparation for the exclusive degradation of wakame seaweed.

[0021] (3) The enzymatic hydrolysis process of this invention is mild and leaves no chemical reagent residue. It can not only efficiently degrade and transform wakame resources, but also be directly used for the large-scale preparation of brown algae oligosaccharides. The enzymatic hydrolysis products can be directly applied to functional foods, bio-fertilizers, pharmaceutical intermediates and other fields. At the same time, it promotes the transformation of wakame from a traditional food to a high-value-added industrial raw material, realizes the high-value utilization of wakame resources, and has significant economic and environmental benefits, with broad application prospects. Attached Figure Description

[0022] Figure 1 This is a structural diagram of the recombinant expression vector pET-28a-AJR06654 plasmid from Example 1; Figure 2 This is an SDS-PAGE image of the purified wild-type alginate lyase AlgPg and mutant N312E enzymes from Example 1 (in the image, lane "M" represents the Marker; lane "wild-type" represents the purified wild-type alginate lyase AlgPg; and lane "N312E" represents the purified mutant N312E). Figure 3 This is the optimal temperature curve of the wild-type alginate lyase AlgPg and the mutant N312E pure enzyme in Example 2; Figure 4 This is the optimal pH curve of the wild-type alginate lyase AlgPg and the mutant N312E pure enzyme in Example 2. Figure 5 This is a comparison of the degradation effects of wild-type alginate lyase AlgPg and mutant N312E pure enzyme on wakame seaweed in Example 2. Figure 6This is a bar chart showing the reducing sugar content of wild-type alginate lyase AlgPg and mutant N312E pure enzymes in Example 2, which degraded wakame seaweed. Figure 7 This is a comparison chart of the degradation effects of wild-type alginate lyase AlgPg pure enzyme on Sargassum and Sargassum fusiforme in Example 2. Figure 8 This is a comparison chart of the degradation effects of the mutant N312E pure enzyme on Sargassum and Sargassum fusiforme in Example 2. Detailed Implementation

[0023] The embodiments of the present invention are described in detail below. These embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments. Furthermore, unless otherwise specified, the carriers, reagents, culture media, methods, and equipment used in the present invention are all conventional carriers, reagents, culture media, methods, and equipment in this technical field, and will not be described in detail further.

[0024] Example 1: Construction of AlgPg mutant of alginate lyase: I. Screening of mutation sites 1. Sequence difference analysis with previously reported alginate lyases. Our laboratory previously discovered a bioluminescent bacterium originating from tidal flats. Photobacterium gaetbulicola The wild-type alginate lyase AlgPg (GenBank accession number: AJR06654) effectively degrades wakame seaweed, representing the highest level of degradation reported in current direct degradation studies. Simultaneously, a literature search of the alginate lyase family was conducted, and an alginate lyase AlyPB1 (GenBank accession number: MN116685), which has high sequence similarity to the aforementioned wild-type AlgPg but lower catalytic activity, was selected as a reference. Sequence alignment between the two enzymes was then used to identify potential sites for enzyme activity optimization.

[0025] First, the amino acid sequences of wild-type AlgPg and AlyPB1 were globally compared using the BLAST program in NCBI to clarify their sequence homology and the distribution of conserved regions. Then, focusing on the enzyme's catalytic domain, 11 amino acid residues with potential modification value were identified by using sequence alignment software (Clustal omega) for precise multi-parameter comparison.

[0026] 2. Multiple sequence alignment of the alginate lyase family Based on the NCBI and CAZY databases, 130 alginate lyase protein sequences from different strains and taxonomic positions were collected, and a multiple sequence alignment matrix for the alginate lyase family was constructed. Bioinformatics analysis tools (WebLogo 3, ESPript 3.0) were used to visualize and analyze the multiple sequence alignment results. Using the sequence conservation score as the core indicator, highly conserved amino acid residue sites within the family were removed; less conserved amino acid residue sites located in the functional region of the catalytic domain were retained. Ten amino acid residue differential sites with potential modification value were identified.

[0027] 3. Simulation analysis of molecular docking and structure-activity relationship Enzyme-substrate molecular docking simulation: The protein structure of wild-type alginate lyase AlgPg was simulated using AlphaFold2, and the structural information of mannouronic acid oligosaccharides with a degree of polymerization of 6 was downloaded from PubChem. Enzyme-oligosaccharide docking experiments were performed using molecular docking software (AutoDockVina), and key parameters such as the binding free energy, number of hydrogen bonds, and strength of hydrophobic interactions between the enzyme and the oligosaccharide were calculated.

[0028] Screening of potentially modifiable sites: The positional state of the 21 sites selected in the previous two steps after enzyme-oligosaccharide docking was analyzed, and 5 sites that were spatially distant from the oligosaccharide were deleted. The remaining 16 sites were subjected to virtual saturation mutagenesis, and the binding free energy and other information of the virtual mutants with the oligosaccharide substrate were analyzed. Finally, 32 site-directed mutagenesis were identified.

[0029] II. Construction of Site-Directed Mutation Template (Wild-Type AlgPg Recombinant Expression Vector) Using the wild-type alginate lyase AlgPg encoding gene (GenBank accession number: AJR06654) preserved in the laboratory as a template, the signal peptide portion was removed. The signal peptide is located at amino acids 1-21 of the N-terminus, and the mature sequence starts from position 22. Specific primers AJR06654-F and AJR06654-R containing EcoRI and XhoI restriction sites were designed to amplify the target gene fragment by PCR.

[0030] AJR06654-F: 5'–CCGGAATTCACTTCGCCGACGCCG–3'; AJR06654-R: 5'–CCGCTCGAGGCGCTTCGGTGCCTCTT–3'.

[0031] After verification of the PCR products by 1% agarose gel electrophoresis, the target gene fragment was recovered. Simultaneously, the pET-28a vector and the recovered target gene fragment were double-digested with EcoRI and XhoI restriction endonucleases, respectively (incubated at 37℃ for 4 h). The digestion products were recovered by electrophoresis again and ligated overnight at 16℃ using T4 DNA ligase to construct the recombinant expression vector pET-28a-AJR06654 (structure shown below). Figure 1 (As shown).

[0032] The ligation product was transformed into *E. coli* DH5α competent cells and plated on LB solid medium containing 50 μg / mL kanamycin. The cells were incubated upside down at 37°C for 12 h. Single colonies were picked and inoculated into LB liquid medium containing kanamycin. After incubation at 37°C and 200 rpm for 8 h, the plasmid was extracted for double enzyme digestion verification and sequencing identification. This confirmed that the target gene was correctly inserted into the pET-28a vector without sequence mutations. This recombinant plasmid served as the template for subsequent site-directed mutagenesis.

[0033] III. Site-directed mutation Using the validated recombinant expression vector pET-28a-AJR06654 as a template, specific primers for introducing mutations were designed and synthesized for 32 candidate mutation sites (the primers for mutants Q203T and N312E are shown in Table 1). The mutant expression vectors were constructed using site-directed mutagenesis PCR technology.

[0034] Site-directed mutagenesis PCR reaction system (50 μL): 2×PrimeSTAR Max Premix 25 μL, forward mutagenesis primer (10 μM) 1.5 μL, reverse mutagenesis primer (10 μM) 1.5 μL, template plasmid (50 ng / μL) 1 μL, ddH2O 21 μL. PCR reaction conditions: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 55℃ annealing for 5 s (adjust according to primer Tm value), 72℃ extension for 40 s, for a total of 30 cycles; final extension at 72℃ for 10 min.

[0035] After the PCR products were verified by 1% agarose gel electrophoresis, 1 μL of DpnI restriction endonuclease (which specifically cleaves methylated template plasmids) was added, and the cells were incubated at 37°C for 2 h to remove wild-type template. Subsequently, the digested PCR products were transformed into Escherichia coli BL21(DE3) competent cells, plated on LB solid medium containing 50 μg / mL kanamycin, and incubated upside down at 37°C for 12 h to obtain single colonies.

[0036] Single clones were picked and inoculated into LB liquid medium containing kanamycin. After culturing at 37°C and 200 rpm for 8 hours, plasmids were extracted and sequenced to confirm that the mutation site was correctly introduced and there were no other random mutations. 32 recombinant expression strains with single-point mutants were obtained.

[0037] Table 1. Primers for single-point mutants Q203T and N312E

[0038] IV. Expression and Purification of Mutants The 32 mutant recombinant strains and wild-type recombinant strains that were correctly sequenced were inoculated into test tubes containing 5 mL of LB liquid medium (containing 50 μg / mL kanamycin) and cultured overnight at 37°C and 200 rpm. Afterward, they were transferred to 400 mL of LB liquid medium (containing 50 μg / mL kanamycin) and cultured until OD (outlet count) reached. 600 When the bacterial concentration reaches 0.6-0.8, 0.1 mM IPTG is added and the cells are induced overnight at 16°C and 120 rpm. Then, the cells are centrifuged at 4°C and 4000 rpm for 30 min to collect the cells. After resuspending the cells, the induced cells are disrupted by sonication. The cells are then centrifuged at 4°C and 12000 rpm for 30 min to obtain the supernatant and precipitate.

[0039] Cell lysis supernatant was collected and enzyme activity was detected using sodium alginate (5 mg / mL) as a substrate. The total reaction volume for enzyme activity detection was 900 μL, including 590 μL substrate, 10 μL enzyme, and 300 μL DNS. The detection method was as follows: after incubation in pH 8.0 buffer (50 mM Tris-HCl) for 10 min, 300 μL DNS was added, followed by centrifugation, boiling for 10 min, and then OD was measured using a UV spectrophotometer after cooling. 540 Values. The standard curve was determined using glucose as the standard. One standard enzyme activity unit (U) is defined as the amount of enzyme required to release 1 μmol of reducing sugar per minute. Enzyme activity assay results showed that among the 32 single-point mutants, 12 showed increased enzyme activity, 3 showed no change in enzyme activity, 12 showed decreased enzyme activity, and 5 showed no enzyme activity.

[0040] Based on the above results, further purification (nickel column affinity chromatography) was performed to obtain 12 mutant proteins with enhanced enzyme activity, and SDS-PAGE analysis was conducted. Figure 2 At the same time, the enzyme activity was measured.

[0041] Using a 150% increase in enzyme activity as the standard, two highly active single-point mutants were screened: Q203T (the glutamine at position 203 of the amino acid sequence of the wild-type alginate lyase AlgPg shown in SEQ ID NO.1 is mutated to threonine) and N312E (the asparagine at position 312 of the amino acid sequence of the wild-type alginate lyase AlgPg shown in SEQ ID NO.1 is mutated to glutamic acid). The specific enzyme activity of the wild-type AlgPg was 91.2 ± 3.6 U / mg; the specific enzyme activity of mutant Q203T was 143.2 ± 5.7 U / mg, an increase of 157% compared to the wild type; and the specific enzyme activity of mutant N312E was 182.4 ± 7.3 U / mg, an increase of 200% compared to the wild type, representing the mutant with the highest increase in enzyme activity (Table 2).

[0042] Table 2. Specific enzyme activity of single-point mutants with significantly increased enzyme activity

[0043] Based on the above results, the specific enzyme activity of the N312E mutant was 200% higher than that of the wild type, making it the strain with the largest increase in enzyme activity and the best catalytic efficiency among all mutants. Therefore, mutant N312E (amino acid sequence shown in SEQ ID NO.2, gene sequence encoding this mutant shown in SEQ ID NO.3) was selected as the core target enzyme for subsequent verification and application research on Wakame seaweed-specific degradation, in order to further clarify its enzymatic characteristics, substrate specificity, and industrial application potential.

[0044] Example 2: Enzymatic characteristics of mutant N312E and verification of Wakame-specific degradation: I. Determination of the enzymatic properties of mutant N312E 1. Determination of optimal temperature Using sodium alginate (5 mg / mL) as a substrate, in 50 mM Tris-HCl buffer at pH 8.0, the reaction temperature gradient was set to 20℃, 25℃, 30℃, 35℃, and 40℃. The remaining reaction conditions were the same as the enzyme activity detection method in Example 1. The enzyme activities of wild-type AlgPg and mutant N312E were measured respectively. The highest enzyme activity was taken as 100%, and the relative enzyme activity at different temperatures was calculated to plot the optimal temperature curve.

[0045] The results are as follows Figure 3 As shown in the figure. The results show that the optimal temperature for wild-type AlgPg is 30℃, and the relative enzyme activity is maintained above 75% in the range of 25~35℃; while the optimal temperature for mutant N312E is 25℃, which is 5℃ lower than that of wild-type, and the relative enzyme activity is maintained above 80% in the range of 20~30℃. It has better low-temperature adaptability and is more in line with the low-temperature energy-saving requirements of industrial production.

[0046] 2. Determination of optimal pH Under their respective optimal temperature conditions (wild type 30℃, N312E 25℃), pH gradients of 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9.0 were set up. The reaction systems were prepared using 50mM Tris-HCl buffer solutions corresponding to the pH values, with other reaction conditions remaining unchanged. The enzyme activities of the two enzymes were measured, and the highest enzyme activity was taken as 100%. The relative enzyme activities at different pH values ​​were calculated, and the optimal pH curve was plotted.

[0047] The results are as follows Figure 4 As shown in the figure. The results show that the optimal pH of mutant N312E is consistent with that of wild-type AlgPg, both being 8.0; and within the pH range of 7.5 to 8.5, N312E has better relative enzyme activity stability than wild-type, making it more suitable for pH fluctuations in industrial reaction systems.

[0048] II. Verification of the specific degradation of Wakame seaweed by mutant N312E 1. Direct degradation experiment of wakame leaves Fresh wakame leaves were used as substrates. 50 mM Tris-HCl buffer (pH 8.0) was added, and the substrate concentration was controlled at 8 mg / mL, NaCl concentration at 200 mM, and enzyme dosage at 200 U / mL. Purified wild-type AlgPg and mutant N312E were then added, and the reaction was carried out at their respective optimal temperatures for 9 h. After the reaction, the morphological changes of the wakame leaves were observed visually, and the reaction solution was centrifuged. The supernatant was collected, and the reducing sugar content was determined by the DNS method. The conversion rate was calculated (conversion rate = actual reducing sugar yield / theoretical maximum reducing sugar yield × 100%).

[0049] The results are as follows Figure 5 , 6 As shown. The results showed that the leaf edges of the wild-type AlgPg group dissolved and partially broke into small pieces; while the leaves of the mutant N312E group were completely degraded into fine fragments, which were suspended in the reaction solution. Figure 5 The reducing sugar yield of wild-type AlgPg was 26.2±1.6 mg / mL, with a conversion rate of 32.5%; the reducing sugar yield of mutant N312E was 42.3±2.5 mg / mL, with a conversion rate of 51.5%, which was 58.5% higher than that of wild-type. Figure 6 This directly proves that N312E has a significantly higher degradation efficiency for wakame seaweed than the wild type.

[0050] 2. Substrate specificity verification Using Sargassum and Sargassum leaves as control substrates, and referring to the reaction conditions for Undaria pinnatifida degradation, mutant N312E was added to carry out enzymatic hydrolysis, and the morphological changes of Sargassum and Sargassum leaves were observed by the naked eye.

[0051] The results are as follows Figure 7 , 8 As shown in the figure. The results showed that both the wild-type AlgPg and the mutant N312E had no hydrolytic effect on Sargassum fusiforme and other brown algae such as Sargassum fusiforme, but had specific degradation activity only on Wakame seaweed, with no cross-hydrolysis phenomenon. They can be used as Wakame seaweed-specific degradation enzyme preparations for industrial production.

[0052] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A novel alginate lyase which specifically degrades Undaria pinnatifida, characterized by, Its amino acid sequence is shown in SEQ ID NO.

2.

2. The alginate lyase according to claim 1, characterized in that, The alginate lyase was obtained by structural optimization of the wild-type alginate lyase AlgPg, whose amino acid sequence is shown in SEQ ID NO.

1.

3. The alginate lyase of claim 2, wherein, The structural optimization and improvement are achieved through site-directed mutation.

4. The alginate lyase of claim 3, wherein, The site-directed mutation involves mutating asparagine at position 312 of the amino acid sequence shown in SEQ ID NO.1 to glutamic acid, corresponding to the single-point mutant N312E.

5. An alginate lyase-encoding gene, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.3, and it is used to encode the alginate lyase according to any one of claims 1 to 4.

6. A recombinant expression vector, characterized in that, It contains the encoding gene as described in claim 5.

7. The recombinant expression vector of claim 6, wherein, The base vector for the recombinant expression vector is pET-28a.

8. A recombinant engineered bacterium, characterized in that, Contains the coding gene as described in claim 5 or the recombinant expression vector as described in any one of claims 6 to 7.

9. The recombineering bacteria of claim 8, wherein, The host bacterium of the recombinant engineered bacteria is Escherichia coli BL21.

10. The application of the alginate lyase as described in any one of claims 1 to 4 in the degradation of wakame seaweed or the preparation of brown algae oligosaccharides.

Images