Method for promoting induction of human totipotent stem cells

Abstract

The invention provides a method for promoting induction of human totipotent stem cells, belongs to the technical field of biology, and particularly relates to a method for promoting induction of the human totipotent stem cells to the totipotent stem cells through OTX2 knockout or knockdown, the method comprises the following steps: S1, constructing an OTX2 knockout or knockout plasmid vector; s2, establishing a human pluripotent stem cell line with OTX2 knocked down or knocked out; and S3, inducing the human pluripotent stem cells of which the OTX2 is knocked down or knocked out into totipotent stem cells, which are also called 8-cell-like cells (8CLCs). According to the invention, the efficiency of inducing the human pluripotent stem cells into the totipotent stem cells can be improved, and the application of the totipotent stem cells in in-vitro blastocyst-like induction, in-vivo chimeric embryo formation and the like is provided.

Description

Technical Field

[0001] This invention belongs to the field of cell induction technology and relates to a method for promoting the induction of human pluripotent stem cells, specifically a method for promoting the induction of human pluripotent stem cells into pluripotent stem cells by OTX2 knockout or knockdown. Background Technology

[0002] Totipotent stem cells (TSCs) are cells with the potential to differentiate into embryonic and extraembryonic tissues, representing the most primitive cellular state in mammals. In nature, totipotency exists only in the fertilized egg and early blastomeres. Totipotent stem cells are not only a key research subject for understanding the developmental patterns of early human embryos, but also an important strategic resource in the fields of stem cell and regenerative medicine.

[0003] Compared to pluripotent stem cells (PSCs), totipotent stem cells have a broader differentiation potential. Pluripotent stem cells can only differentiate into embryonic tissues, while totipotent stem cells can simultaneously generate embryonic tissues and extraembryonic tissues (such as the placenta and yolk sac). Therefore, they have irreplaceable value in the construction of artificial embryo models, assisted reproductive research, the analysis of the mechanisms of major genetic diseases, and regenerative medicine applications.

[0004] However, research on human pluripotent stem cells is still in its early stages. Due to the scarcity of human embryonic resources, directly obtaining pluripotent cells for experimental research faces ethical and legal limitations. Therefore, the scientific community urgently needs to develop methods for inducing pluripotent stem cells from in vitro cultured human pluripotent stem cells. In recent years, researchers have discovered a small number of cell populations with pluripotent characteristics in in vitro systems, but their proportion is extremely low and their stability is insufficient, posing significant challenges to induction efficiency and controllability. These problems severely limit the development of pluripotent stem cells in both basic research and applications. Therefore, finding new methods to improve the induction efficiency of pluripotent stem cells has become an important research direction in this field. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of existing technologies, such as low induction efficiency, small proportion, unstable properties, and limited induction strategies of human pluripotent stem cells. It provides a method to promote the induction of human pluripotent stem cells into pluripotent stem cells by knocking down and knocking out OTX2, thereby obtaining human pluripotent stem cells with 8-cell stage molecular characteristics and in vivo chimerism ability. It also provides a method for applying pluripotent stem cells in vitro in blastocyst models and mouse embryo chimerism models.

[0006] To achieve the above objectives, the present invention employs the following technical solutions: A method for promoting the induction of human pluripotent stem cells includes the following steps: S1. Construct plasmid vectors for OTX2 knockdown or knockout; S2. Introduce the plasmid vector into human pluripotent stem cells to establish an OTX2 knockdown or knockout human pluripotent stem cell line. S3. Under the conditions of 4CL induction medium and / or me4CL induction medium containing small molecule regulators, the OTX2 knockdown and / or knockout human pluripotent stem cells are induced into human totipotent stem cells with 8-cell stage characteristics.

[0007] As a preferred embodiment, the human pluripotent stem cells are selected from human embryonic stem cells, human induced pluripotent stem cells, or human pluripotent stem cell lines with TPRX1-EGFP reporter fluorescence.

[0008] As a preferred embodiment, the OTX2 knockdown plasmid vector is an expression vector carrying an shRNA sequence targeting the human OTX2 gene, wherein the shRNA sequence is selected from any of the nucleotide sequences shown in SEQ ID NO:1 to 4 in the sequence listing; the OTX2 knockout plasmid vector in step S1 is an expression vector carrying an sgRNA sequence targeting the human OTX2 gene, wherein the sgRNA sequence is selected from the nucleotide sequences shown in SEQ ID NO:5 or SEQ ID NO:6 in the sequence listing.

[0009] As a preferred method, the induction culture conditions used in step S3 include: first culturing human pluripotent stem cells with OTX2 knockdown and / or knockout in 4CL medium to induce them into a pre-pluripotent state; then continuing to culture them in modified me4CL medium to enrich TPRX1-positive pluripotent stem cells with 8-cell stage characteristics.

[0010] As a preferred embodiment, 4CL consists of an equal volume mixture of neural basal medium and DMEM / F12 medium, supplemented with the following components: 1×N2 supplement, 1×B27 supplement, 1×sodium pyruvate, 1×non-essential amino acid, 1×GlutaMAX glutamine substitute, 1×penicillin-streptomycin mixture, 50 μg / mL L-ascorbic acid, histone methyltransferase inhibitor, histone deacetylase inhibitor, MEK / ERK pathway inhibitor, Wnt signaling pathway inhibitor, JAK-STAT pathway activator, TGF-β / Smad pathway activator, and 0.4% Geltrex or Matrigel by volume.

[0011] Further optimization revealed that the histone methyltransferase inhibitor in 4CL was 10 nM dezanib, the histone deacetylase inhibitor was 5 nM trichostatin A, the MEK / ERK pathway inhibitor was 1 μM PD0325901, the Wnt signaling pathway inhibitor was 5 μM IWR-1, the JAK-STAT pathway activator was 20 ng / mL human leukemia inhibitory factor, and the TGF-β / Smad pathway activator was 20 ng / mL activin A.

[0012] Further preferably, the me4CL induction medium is based on the 4CL induction medium with adjusted concentrations of each component and the histone deacetylase inhibitor replaced with abestat.

[0013] Further preferably, the me4CL induction medium contains: a histone methyltransferase inhibitor of 5-50 nM dezanib, a histone deacetylase inhibitor of 0.1-5 μM abestat, a MEK / ERK pathway inhibitor of 0.5-5 μM MPD0325901, a Wnt signaling pathway inhibitor of 1-10 μM IWR-1, a JAK-STAT pathway activator of 5-50 ng / mL human leukemia inhibitory factor, and a TGF-β / Smad pathway activator of 5-50 ng / mL activin A.

[0014] Further preferred, the me4CL induction medium contains: a histone methyltransferase inhibitor of 10 nM dezanib, a histone deacetylase inhibitor of 2 μM abestat, a MEK / ERK pathway inhibitor of 1 μM PD0325901, a Wnt signaling pathway inhibitor of 5 μM IWR-1, a JAK-STAT pathway activator of 20 ng / mL human leukemia inhibitory factor, and a TGF-β / Smad pathway activator of 20 ng / mL activin A.

[0015] As a preferred method, the proportion of TPRX1-EGFP positive cells obtained was higher than that of totipotent-like cells obtained by induction of human pluripotent stem cells.

[0016] The present invention also discloses a human pluripotent stem cell obtained by the above method.

[0017] Terminology Explanation: In this specification, unless otherwise specified, the following terms have the following meanings: 1. "Totipotent stem cells" (TSCs) refer to stem cells that have the potential to differentiate into embryonic and extraembryonic tissues. These include cells that exist naturally in fertilized eggs and early blastomeres, as well as cells with similar differentiation potential obtained in vitro through induction.

[0018] 2. "Pluripotent stem cells" (PSCs) refer to stem cells that can differentiate into multiple somatic cell types derived from the three germ layers, but usually do not have the ability to form extraembryonic tissues. These include human embryonic stem cells and human induced pluripotent stem cells.

[0019] 3. “8-cell-like cells” (8CLCs) refer to a population of cells that appear in human pluripotent stem cell populations in vitro and have transcriptional characteristics and molecular markers similar to those of human 8-cell stage embryos.

[0020] 4. "Human embryonic stem cells" (hESCs) refer to stem cells derived from early human embryos that have self-renewal capacity and pluripotent differentiation potential.

[0021] 5. Human induced pluripotent stem cells (hiPSCs) are stem cells obtained by reprogramming somatic cells and possessing pluripotency characteristics similar to human embryonic stem cells.

[0022] 6. The “TPRX1-EGFP reporter cell line” refers to a cell line in which an enhanced green fluorescent protein (EGFP) reporter construct driven by the TPRX1 gene promoter is introduced into the genome of human pluripotent stem cells to indicate or report the expression status of the TPRX1 gene.

[0023] 7. “4CL induction medium” refers to an induction medium system based on an equal volume of neural basal medium and DMEM / F12 medium, with the addition of several small molecule regulators (including but not limited to histone methyltransferase inhibitors, histone deacetylase inhibitors, MEK / ERK pathway inhibitors and Wnt signaling pathway inhibitors), and supplemented with N2, B27, amino acids, antibiotics, L-ascorbic acid and matrix gel.

[0024] 8. “me4CL induction medium” (modified 4CL induction medium) refers to a medium improved from 4CL induction medium, in which the histone deacetylase inhibitor in 4CL medium is replaced with abexinostat, and the other components are basically the same as 4CL medium.

[0025] 9. "Neurobasal medium" refers to a specialized basic culture medium commonly used for the culture of neurons and related cells.

[0026] 10. “DMEM / F12 medium” (Dulbecco's modified Eagle medium / Nutrient Mixture F-12, DMEM / F12) refers to a basic medium composed of Dulbecco's modified Eagle medium and F-12 nutrient mixture mixed in the usual proportion.

[0027] 11. “N2 supplement” and “B27 supplement” refer to commercially available cell culture additives containing various vitamins, hormones and proteins, which are commonly used for neural and stem cell culture.

[0028] 12. "Non-essential amino acids" (NEAA) refer to a mixture of amino acids that are added to the culture medium, which the cells can synthesize themselves but whose supplementation is beneficial to cell growth.

[0029] 13. “GlutaMAX Glutamine Substitute” (GlutaMAX) refers to a stable form of L-glutamine substitute used to provide a source of glutamine in cell culture.

[0030] 14. “Penicillin-streptomycin mixture” refers to a mixture of conventional antibiotics containing penicillin and streptomycin, used to reduce bacterial contamination.

[0031] 15. "Matrigel" and "Geltrex" are hydrogel materials derived from the extracellular matrix, used to coat culture dishes to promote the adhesion and growth of adherent cells.

[0032] 16. “L-ascorbic acid” refers to L-form vitamin C, which is used as an antioxidant and cell function regulator in culture systems.

[0033] 17. "Histone methyltransferase inhibitor" refers to a compound that can inhibit the activity of histone methyltransferase. In this invention, 3-deazaneplanocin A (3-DZNep) is preferred.

[0034] 18. "Histone deacetylase inhibitor" (HDAC inhibitor) refers to a compound that can inhibit the activity of histone deacetylase. In this invention, it may include trichostatin A (TSA) and abexinostat, etc.

[0035] 19. The MEK / ERK signaling pathway, Wnt signaling pathway, JAK-STAT signaling pathway, and TGF-β / Smad pathway are collective terms known in the field for intracellular signal transduction pathways that are related to processes such as cell proliferation, differentiation, and fate determination.

[0036] 20. "Leukemia inhibitory factor" (LIF) refers to a class of cytokines that can activate the JAK-STAT signaling pathway and are used to maintain the state of stem cells or regulate cell fate.

[0037] 21. "Activin A" refers to a cytokine belonging to the TGF-β superfamily, which can participate in the regulation of cell fate and embryonic development by activating the TGF-β / Smad signaling pathway.

[0038] 22. “3-Deazaneplanocin A” (3-DZNep) refers to a class of S-adenosine homocysteine ​​hydrolase inhibitors that can indirectly inhibit histone methylation levels.

[0039] 23. Trichostatin A (TSA) is a class of broad-spectrum histone deacetylase inhibitors, commonly used to regulate chromatin structure and gene expression.

[0040] 24. “Abexinostat” refers to a class of small molecule histone deacetylase inhibitors that can be used to regulate epigenetic states and promote cell reprogramming or fate switching.

[0041] 25. “PD0325901” refers to a class of MEK inhibitors used to inhibit the MEK / ERK signaling pathway.

[0042] 26. “IWR-1” refers to a class of Wnt signaling pathway inhibitors used to inhibit Wnt / β-catenin signaling activity.

[0043] 27. "Short hairpin RNA" (shRNA) refers to short-chain RNA molecules that can form hairpin structures within cells and be processed into small interfering RNAs to mediate gene silencing.

[0044] 28. "Single guide RNA" (sgRNA) refers to a single-stranded RNA molecule used in the CRISPR-Cas9 gene editing system to guide the Cas9 nuclease to cut a specific target sequence.

[0045] 29. The “CRISPR-Cas9 system” refers to a gene editing tool derived from the acquired immune mechanism of bacteria, consisting of the Cas9 protein and its corresponding guide RNA.

[0046] 30. A "plasmid vector" is a circular double-stranded DNA molecular vector used to carry exogenous nucleic acid fragments for expression or editing within cells.

[0047] 31. "Real-time quantitative PCR" (RT-qPCR) refers to polymerase chain reaction technology that uses fluorescence signals to monitor the amplification process of specific nucleic acids in real time and to perform quantitative analysis on them.

[0048] 32. "Western blot" is an experimental method that separates proteins by gel electrophoresis and uses specific antibodies to detect the expression of target proteins.

[0049] 33. Flow cytometry (FACS) is a technique that uses a flow cytometer to analyze and sort the fluorescence signals and scattering characteristics of individual suspended cells.

[0050] 34. "Transcriptome sequencing" (RNA sequencing, RNA-seq) refers to a method for the comprehensive detection and quantitative analysis of RNA transcripts in cells or tissues using high-throughput sequencing technology.

[0051] 35. "Immunofluorescence staining" refers to a detection method that uses fluorescently labeled antibodies to specifically recognize target antigens and then observes them under a microscope.

[0052] 36. “OTX2” refers to the human orthodenticle homeobox 2 gene or the protein it encodes.

[0053] 37. “TPRX1”, “DUX”, “ZSCAN4” and “MERVL” refer to known genes or transcripts associated with human 8-cell stage embryos or endogenous retroviruses, which can be identified by those skilled in the art based on the above gene names.

[0054] Other English abbreviations and terms not specifically defined in this specification have the meanings commonly understood by those skilled in the art.

[0055] Compared with the prior art, the advantages of the present invention are: This invention improves the induction efficiency of pluripotent stem cells by knocking down or knocking out OTX2 in human pluripotent stem cells, including increasing the proportion of TPRX1-EGFP fluorescent reporter cells, increasing the expression of 8-cell-specific genes, and improving the chimerism ability of mouse embryos, providing a model and tool for research on early human embryonic development. Attached Figure Description

[0056] Figure 1 This is a graph showing the results of RT-qPCR detection of OTX2 knockdown; Figure 2 This is a Western blot analysis result of the OTX2 knockout protein; Figure 3 These are white light and fluorescence images of pluripotent stem cells induced by OTX2 knockdown and knockout cells; Figure 4 This is a flow cytometry result of TPRX1-EGFP-positive pluripotent stem cells induced by the OTX2 knockout strain; Figure 5 This is a graph showing the results of 8C-specific gene detection in pluripotent stem cells induced by OTX2 knockout. Figure 6 This is a diagram showing the chimerism results of OTX2 knockout-induced pluripotent stem cells in mouse E12.5 embryos.

[0057] Figure 7 This is a comparison of the proportion of TPRX1-EGFP positive cells in pluripotent stem cells induced by WT control and OTX2 knockout strain; Figure 8 This is a comparison of 8C gene expression in pluripotent stem cells induced by WT control and OTX2 knockout strains; Figure 9 This is a comparison of transcriptome sequencing analysis of pluripotent stem cells induced by WT control and OTX2 knockout strains; Figure 10This is a comparison diagram of chimerism between WT control and OTX2 knockout pluripotent stem cells in mouse E12.5 embryos. Detailed Implementation

[0058] The present invention will now be described in detail with reference to the accompanying drawings.

[0059] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0060] In the description of this invention, it must be noted that for parts where specific conditions are not explicitly stated in the embodiments, they should be performed under conventional conditions or conditions recommended by the manufacturer. Furthermore, if the manufacturers of the reagents or instruments used are not specified, it indicates that these reagents or instruments are commercially available, conventional products.

[0061] Example 1: Construction of plasmid vectors for OTX2 knockdown and knockout; Operating procedures and experimental methods: A plasmid for OTX2 gene knockdown was constructed. Two shRNA sequences for human OTX2 knockdown were designed and synthesized on the Thermo Fisher website and named sh1 and sh2, respectively. Two complementary single-stranded DNA sequences were synthesized for each shRNA. After annealing, sh1 (obtained by annealing sh1-1 and sh1-2, which are then ligated into a double strand) and sh2 (obtained by annealing sh2-1 and sh2-2) were respectively ligated with pLKO.1 plasmid that had been digested and recovered with AgeI and EcoRI enzymes and reacted with T4 ligase at 16°C for 1 hour to obtain ligation products. The ligation products were transformed into 100 μl of competent cells, plated on LBA plates, and cultured overnight at 37°C. On the second day, single colonies of appropriate size and clear boundaries were picked for sequencing verification.

[0062] The primer information used in this process is as follows: OTX2 sh1-1: CCGGGCACTGAAACTTTACGACAAACTCGAGTTTGTCGTAAAGTTTCAGTGCTTTTT OTX2 sh1-2: AATTCAAAAAGCACTGAAACTTTACGACAAACTCGAGTTTGTCGTAAAGTTTCAGTGC OTX2 sh2-1: CCGGGCTGGCTCAACTTCCTACTTTCTCGAGAAAGTAGGAAGTTGAGCCAGCTTTTT OTX2 sh2-2: AATTCAAAAAGCTGGCTCAACTTCCTACTTTCTCGAGAAAGTAGGAAGTTGAGCCAGC OTX2 gene knockout plasmid construction: The sgRNA sequence for human OTX2 knockout was designed and synthesized on the Red Cotton website. Two complementary single-stranded DNA sequences were synthesized for the sgRNA. After annealing, the sgRNA (obtained by annealing sg-1 and sg-2, which are then ligated into a double strand) and the lentiGuide-Puro plasmid recovered by BsmBI digestion were reacted with homologous recombination ligase at 37°C for 30 minutes to obtain the ligation product. The ligation product was transformed into 100 μl of competent cells, plated on LBA plates, and cultured overnight at 37°C. The next day, single colonies of suitable size and clear boundaries were picked for sequencing verification.

[0063] The primer information used in this process is as follows: OTX2 sg-1: CTTGTGGAAAGGACGAAAGAAATCAACTTGCCCGAGTCGGTTTTAGAGCTAGAAATAGC OTX2 sg-2: GCTATTTCTAGCTCTAAAACCGACTCGGGCAAGTTGATTTCTTTCGTTCCTTTCCACAAG Example 2: Establishment of human pluripotent stem cell lines with OTX2 knockdown and knockout; 1. Experimental Methods: The constructed knockdown and knockout plasmids, along with helper plasmids pMD2.G and psPAX2, were transfected into 293T cells using liposome transfection reagent for viral packaging. Viral supernatant was collected 48 hours after transfection. The collected supernatant was centrifuged (3000 rpm for 20 minutes) to remove cell debris, and then 200 μL was added to pluripotent stem cell culture wells (30% cell density, 1 / 12-well plate) for infection. After 24 hours, the medium was replaced with puromycin containing 3 μg / mL. The puromycin-containing medium was replaced daily for 72 hours. Cells in the uninfected control group died completely, while some cells in the experimental group survived. Surviving cells were screened by drug treatment and passaged at low density, with 10-15 cells per well in 96-well plates for monoclonal cell selection. Once the cells have grown to a certain size, single clones are selected, and the cells are knocked down for RT-qPCR verification. The genome fragments of the knocked-out cells are extracted, amplified, and sent to the company for sequencing verification to form cell lines. OTX2 knockdown or knockout cell lines are then constructed.

[0064] 2. Experimental Results RT-qPCR analysis showed that the mRNA expression level of OTX2 in the OTX2 knockdown cell line was significantly lower than that in the WT control group. Figure 1 Western blot analysis showed that OTX2 was no longer expressed in the OTX2 knockout strain. Figure 2 ).

[0065] Example 3: OTX2 knockdown and knockout human pluripotent stem cells were induced into totipotent stem cells, and the totipotent stem cells were identified and compared. 1. Induction methods Knockdown or knockout pluripotent stem cells were divided into 1 Pluripotent stem cells were seeded at a density of 10^5 cells per well in one well of a 12-well cell culture plate. After the pluripotent stem cells adhered the next day, the plate was switched to 4CL medium and cultured for 2-3 days. Cells cultured in 4CL for 2-3 days were digested with Accutase and then seeded at a 1:10 ratio in 12-well plates using 4CL medium containing 5 μM of the ROCK-specific inhibitor Y27632. The next day, the plate was switched to 4CL medium without Y27632 and cultured for another 24 hours. Starting on the third day, the plate was switched to me4CL medium and cultured for 3 days, yielding pluripotent stem cells exhibiting TPRX1 green fluorescence.

[0066] 2. Identification methods and results This invention, by knocking down or deleting the OTX2 gene in pluripotent stem cells, alters the cell fate from pluripotency to totipotency, specifically manifested as follows: (1) Morphological changes: Observation of induced pluripotent stem cells using an inverted fluorescence microscope revealed that the cell colonies were round and raised, and some cells expressed green fluorescence. Figure 3 ).

[0067] (2) Proportion of TPRX1-EGFP positive subset: TPRX1-EGFP is a reporter gene that is specifically expressed in human 8-cell stage embryos. In this invention, by knocking down or knocking out the OTX2 gene, more cells in human embryonic stem cells are induced to transform into a TPRX1-EGFP positive state, thereby obtaining cells that are closer to pluripotent stem cells. Figure 4 ).

[0068] (3) 8C gene expression: RT-qPCR was used to detect the expression of 8C genes, such as Tprx1, Dux, Zscan4, and endogenous retrovirus MERVL, and the expression of these genes was significantly upregulated. Figure 5 ).

[0069] (4) Mouse embryo chimerism: OTX2 knockout pluripotent stem cells were injected into mouse 8-cell stage embryos, and then transplanted into pseudopregnant mice at the blastocyst stage. Dissection of mouse embryos at E12.5 stage revealed that pluripotent stem cells could chimerize into the fetus, yolk sac, and placenta. Figure 6 ).

[0070] Comparative Example 1: Comparison of OTX2 knockout and wild-type pluripotent stem cells 1. Detection Method (1) Flow cytometry was used to detect the proportion of TPRX1-EGFP positive cells; (2) Real-time quantitative PCR (RT-qPCR) was used to detect 8C gene expression; (3) Transcriptome sequencing was used to detect 8C gene expression; (4) In vivo developmental potential of mouse embryonic chimerism detection.

[0071] 2. Experimental Results (1) Proportion of TPRX1-EGFP positive cells: The proportion of TPRX1-EGFP positive cells in the WT control group of totipotent stem cells induced by me4CL was about 15%, while that in the OTX2 knockout group was about 27%. OTX2 knockout significantly increased the proportion of totipotent stem cells induced. Figure 7 ).

[0072] (2) 8C gene expression: The expression of the 8C gene in pluripotent stem cells induced by the OTX2 knockout strain was significantly higher than that in the WT control group. Figure 8 ).

[0073] (3) Transcriptome sequencing analysis: Compared with the WT control group, the expression level of the 8C gene was significantly increased after knocking out the OTX2 gene, which is closer to the state of pluripotent stem cells in 8-cell stage blastomeres. Figure 9 ).

[0074] (4) Embryo chimerism detection: In mouse E12.5 embryos, the degree of placental chimerism in embryos injected with OTX2 knockout pluripotent stem cells was higher than that in the WT control group. Figure 10 ).

[0075] like Figures 7-10 As shown, under the same me4CL induction conditions, compared with the WT control group, the pluripotent stem cells obtained by the OTX2 knockout group showed significant advantages in terms of TPRX1-EGFP positive rate, 8C gene expression level, global transcriptome characteristics, and in vivo chimerism ability. This demonstrates that the present invention, through OTX2 knockout combined with a specific 4CL / me4CL induction culture system, can significantly improve the induction efficiency and pluripotency of human pluripotent stem cells.

Claims

1. A method for promoting the induction of human pluripotent stem cells, characterized in that, Includes the following steps: S1. Construct plasmid vectors for OTX2 knockdown or knockout; S2. Introduce the plasmid vector into human pluripotent stem cells to establish an OTX2 knockdown or knockout human pluripotent stem cell line. S3. Under the conditions of 4CL induction medium and / or me4CL induction medium containing small molecule regulators, the OTX2 knockdown and / or knockout human pluripotent stem cells are induced into human totipotent stem cells with 8-cell stage characteristics.

2. The method for promoting the induction of human pluripotent stem cells according to claim 1, characterized in that: The human pluripotent stem cells are selected from human embryonic stem cells, human induced pluripotent stem cells, or human pluripotent stem cell lines with TPRX1-EGFP reporter fluorescence.

3. The method for promoting the induction of human pluripotent stem cells according to claim 1, characterized in that: The OTX2 knockdown plasmid vector is an expression vector carrying an shRNA sequence targeting the human OTX2 gene, wherein the shRNA sequence is selected from any of the nucleotide sequences shown in SEQ ID NO:1 to 4 in the sequence listing; the OTX2 knockout plasmid vector in step S1 is an expression vector carrying an sgRNA sequence targeting the human OTX2 gene, wherein the sgRNA sequence is selected from the nucleotide sequences shown in SEQ ID NO:5 or SEQ ID NO:6 in the sequence listing.

4. The method for promoting the induction of human pluripotent stem cells according to claim 1, characterized in that, The induction culture conditions used in step S3 include: first culturing human pluripotent stem cells with OTX2 knockdown and / or knockout in 4CL medium to induce them into a pre-pluripotent state; then continuing to culture them in modified me4CL medium to enrich TPRX1-positive pluripotent stem cells with 8-cell stage characteristics.

5. A method for promoting the induction of human pluripotent stem cells according to claim 1 or 2, characterized in that: 4CL consists of an equal volume mixture of neural basal medium and DMEM / F12 medium, supplemented with the following components: 1×N2 supplement, 1×B27 supplement, 1×sodium pyruvate, 1×non-essential amino acid, 1×GlutaMAX glutamine substitute, 1×penicillin-streptomycin mixture, 50 μg / mL L-ascorbic acid, histone methyltransferase inhibitor, histone deacetylase inhibitor, MEK / ERK pathway inhibitor, Wnt signaling pathway inhibitor, JAK-STAT pathway activator, TGF-β / Smad pathway activator, and 0.4% Geltrex or Matrigel by volume.

6. The method for promoting the induction of human pluripotent stem cells according to claim 5, characterized in that: In 4CL, the histone methyltransferase inhibitor is 10 nM dezanib, the histone deacetylase inhibitor is 5 nM trichostatin A, the MEK / ERK pathway inhibitor is 1 μM PD0325901, the Wnt signaling pathway inhibitor is 5 μM IWR-1, the JAK-STAT pathway activator is 20 ng / mL human leukemia inhibitory factor, and the TGF-β / Smad pathway activator is 20 ng / mL activin A.

7. The method for promoting the induction of human pluripotent stem cells according to claim 5, characterized in that: The me4CL induction medium is based on the 4CL induction medium with adjusted concentrations of each component and replacement of the histone deacetylase inhibitor with abestat.

8. The method for promoting the induction of human pluripotent stem cells according to claim 7, characterized in that, The me4CL induction medium contained the following: histone methyltransferase inhibitor 5-50 nM dezanib, histone deacetylase inhibitor 0.1-5 μM abestat, MEK / ERK pathway inhibitor 0.5-5 μM PD0325901, Wnt signaling pathway inhibitor 1-10 μM IWR-1, JAK-STAT pathway activator 5-50 ng / mL human leukemia inhibitory factor, and TGF-β / Smad pathway activator 5-50 ng / mL activin A.

9. The method for promoting the induction of human pluripotent stem cells according to claim 7, characterized in that, The optimal effective concentrations of each component in the me4CL induction medium are as follows: 10 nM dezanib, histone deacetylase inhibitor 2 μM abestat, MEK / ERK pathway inhibitor 1 μM PD0325901, Wnt signaling pathway inhibitor 5 μM IWR-1, JAK-STAT pathway activator 20 ng / mL human leukemia inhibitory factor, and TGF-β / Smad pathway activator 20 ng / mL activin A.

10. The method for promoting the induction of human pluripotent stem cells according to claim 1, characterized in that, The proportion of TPRX1-EGFP positive cells obtained was higher than that of totipotent-like cells induced from human pluripotent stem cells.

11. A human pluripotent stem cell obtained by any one of the methods described in claims 1-10.

Images