Application method of metarhizium anisopliae Ma41

Abstract

The invention relates to the technical field of biological prevention and control of agricultural pests, and particularly discloses a combined application method of metarhizium anisopliae Ma41 and special synergistic auxiliary soybean peptide powder in prevention and control of rice pests such as brown planthoppers, and the method can effectively improve the prevention and control effect on target pests.

Description

Technical Field

[0001] This invention belongs to the field of biological control technology for agricultural pests, specifically relating to a method of using Metarhizium anisopliae Ma41 on scarab beetles. Background Technology

[0002] Long-term use of chemical pesticides to control agricultural pests easily leads to problems such as increased pest resistance, pesticide residues, and environmental pollution. Therefore, exploring green and sustainable control methods is imperative. Metarhizium anisopliae (a type of beetle) Metarhizium anisopliae Metarhizium anisopliae is a fungus belonging to the family Clavicipitaceae and the genus Metarhizium. It is a broad-spectrum insecticidal fungus that is pathogenic to a variety of pests, including rice planthoppers, rice stem borers, rice leaf rollers, corn borers, and peach borers. It is also basically harmless to humans, livestock, and crops, and has a high safety profile for non-target organisms such as bees.

[0003] Metarhizium anisopliae attaches to the surface of insect pests via conidia, which germinate and penetrate the insect's body wall under suitable conditions. Inside the insect, it multiplies rapidly, producing a large number of fungal cells and secreting insecticidal toxins such as cytotoxic agents to suppress the insect's immune function, ultimately leading to its death. Even after death, the insect's corpse can produce new spores that persist in the environment, providing continuous pest control. Several Metarhizium anisopliae preparations have already been registered and are being used for pest control in tea gardens, farmland, and other settings, demonstrating a certain level of application potential.

[0004] However, due to the living nature of its conidia, the effectiveness of *Metarhizium anisopliae* in field applications is affected by several factors. Firstly, it has high environmental requirements; spore germination, mycelial growth, and pest infestation all require suitable temperature and humidity. Inappropriate conditions reduce spore germination rates, impacting control efficacy. Secondly, its insecticidal speed is relatively slower than chemical pesticides, taking 3-7 days from spore infection to pest death. This makes it difficult to quickly control pest outbreaks, limiting its effectiveness in the field. To address these issues, scholars both domestically and internationally have conducted research on enhancement technologies. In fungal culture, studies have found that the type of nitrogen source affects the growth and sporulation of *Metarhizium anisopliae*, with amino acids serving as excellent nitrogen sources and significantly contributing to increased spore production. In terms of adjuvant application, surfactants are commonly used to improve the wettability of spores and help them attach to the surface of pests. However, there are few reports on nutritional adjuvants specifically developed for the physiological characteristics of Metarhizium anisopliae. The synergistic effect of related nutritional adjuvants when used in combination with Metarhizium anisopliae needs further exploration.

[0005] Metarhizium anisopliae Ma41 was isolated and identified by the Biological Control Team of the Institute of Plant Protection and Agricultural Product Quality and Safety, Anhui Academy of Agricultural Sciences, from the rice stem borer (Metarhizium anisopliae) infected with entomopathogenic fungi in Wuwei rice paddies. This strain has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41931, dated April 28, 2025. Previous experiments have confirmed that Metarhizium anisopliae Ma41 has good efficacy against brown planthoppers, rice stem borers, and peach fruit borers. The specific sequencing results are as follows (564 bp): CCTTCCGTAAGGGGGACCTGCGGAGGGATCATTACCGAGTTATCCAACTCCCACCCCTGTGAATCATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTTAATAAGTAT CTTCTGAGTGGTTAAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATT GCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCAGCACAGCCGTCCCTTAAATTAATTGGCGGTCTCGCCGTGG CCCTCCTCTGCGCAGTAGTAAAGCACTCGCAACAGGAGCCCGGCGCGGTCCACTGCCGTAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAGCCGGAGGAAA β-Alanine is a non-protein natural amino acid that can be produced in nature through microbial metabolism, chemical synthesis, or bio-fermentation. It belongs to the category of small-molecule nitrogenous nutrients. Fish collagen peptides, also known as fish collagen peptides, are derived from the connective tissues of fish skin, bones, and scales. They are a mixture of small-molecule peptides obtained by enzymatic hydrolysis of large-molecule fish collagen, exhibiting good water solubility and easy absorption by microorganisms. Soybean peptide powder is a mixture of plant-derived small-molecule peptides obtained from soybean protein through enzymatic hydrolysis, separation, and purification. Its main components are short peptides and free amino acids, making it rich in nutrients and highly absorbable. Branched-chain amino acids (BCAAs) are a collective term for the three essential amino acids leucine, isoleucine, and valine, widely found in animal and plant proteins, providing nutritional support for protein synthesis and cell proliferation. Experimental results show that these amino acids can provide nutrition for Metarhizium anisopliae Ma41, promoting spore germination, colony expansion, and increased sporulation, thereby effectively enhancing its infectivity and pathogenicity against pests. However, the specific mechanism remains unclear.

[0006] Based on this, the effects of four adjuvants (β-alanine, fish collagen peptide, soybean peptide powder, and branched-chain amino acids) on the germination rate, colony diameter, and sporulation of Metarhizium anisopliae Ma41 were studied to determine the compatibility of the tested adjuvants with entomopathogenic fungi and to determine the effect of the combined use of Metarhizium anisopliae Ma41 and adjuvants on insecticidal toxicity, so as to provide a theoretical basis for exploring the efficient application of Metarhizium anisopliae Ma41. Summary of the Invention

[0007] This invention provides a method for using Metarhizium anisopliae Ma41 on scarab beetles, which can effectively improve the control effect on target pests. The specific technical solution is as follows: A method for using Metarhizium anisopliae Ma41, which involves combining it with soybean peptide powder; Metarhizium anisopliae Ma41 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41931 and accession date of April 28, 2025.

[0008] Preferably, the soybean peptide powder has a mass concentration of 0.05-4%; and the concentration of Metarhizium anisopliae Ma41 is 1.0 × 10⁻⁶. 6 Spores / mL - 1.0 × 10 8 Spores / mL. More selectively, the soybean peptide powder concentration is 1-2%; the concentration of Metarhizium anisopliae Ma41 is 1.0 × 10⁻⁶. 6 Spores / mL - 1.0 × 10 7 Spores / mL.

[0009] This invention provides the use of soybean peptide powder to improve the colony growth and sporulation of Metarhizium anisopliae Ma41.

[0010] This invention provides the use of soybean peptide powder to enhance the insecticidal activity of Metarhizium anisopliae Ma41 against pests, wherein the pest is preferably the brown planthopper.

[0011] This invention provides an insecticidal composition comprising Metarhizium anisopliae Ma41 and soybean peptide powder, wherein the soybean peptide powder has a mass concentration of 1-4% and the Metarhizium anisopliae Ma41 has a concentration of 1.0 × 10⁻⁶. 6 Spores / mL - 1.0 × 10 8 Spores / mL.

[0012] Compared with the prior art, the present invention has the following beneficial effects: This invention, by screening specific amino acid substances and optimizing their combination ratio, reveals for the first time the synergistic effect of these four types of amino acid substances on the growth and insecticidal toxicity of Metarhizium anisopliae Ma41, and clarifies their optimal added components and ratios.

[0013] The application of this technology can significantly improve the sporulation and control effect of Metarhizium anisopliae Ma41, providing a brand-new solution for green control of agricultural pests and is of great significance for promoting the practice of reducing pesticide use and increasing efficiency.

[0014] The raw materials used in this invention are widely available, inexpensive, and easy to add. Attached Figure Description

[0015] Figure 1 Morphological comparison of brown planthoppers infected with Metarhizium anisopliae on scarab beetles: healthy planthopper (left) and infected planthopper (right). Detailed Implementation

[0016] The present invention can be better understood from the following embodiments. However, those skilled in the art will readily understand that the descriptions in the embodiments are for illustrative purposes only and should not, and will not, limit the scope of the invention as detailed in the claims. Example 1: Effects of different types of amino acid addition on the biological activity of Metarhizium anisopliae Ma41. I. Materials and Methods 1. Test strains and insects The tested entomopathogenic fungus was Metarhizium anisopliae Ma41, preserved in our laboratory, which has high toxicity to a variety of pests.

[0017] The insects used for testing were brown planthoppers that had been kept indoors in our laboratory for a long time. They were not exposed to any insecticides during the rearing process. The rearing conditions were a temperature of (27±1)℃, a relative humidity of 70%-80%, and a photoperiod of 16L:8D. Third-instar nymphs of uniform size and in good growth condition were selected for testing.

[0018] 2. Culture medium Peptone Potato Dextrose Agar Medium (PPDA): Weigh 200g of potatoes, add deionized water, and boil for 20-30 minutes. Filter and bring the volume to 1L. Add 20g of anhydrous glucose, 20g of agar, and 10g of peptone. Mix well and dispense into Erlenmeyer flasks, sealing the flasks. Sterilize in an autoclave at 121℃ for 20 minutes, then pour into petri dishes for later use.

[0019] 3. Test auxiliaries A total of four amino acid adjuvants are involved: β-alanine (AA-B), soybean peptide powder (AA-D), fish collagen peptide (AA-Y), and branched-chain amino acids (AA-Z).

[0020] 4. Test methods 4.1 Effects of different types of amino acid addition on the biological activity of Metarhizium anisopliae Ma41 4.1.1 Effects of different types of amino acid addition on the germination of Metarhizium anisopliae Ma41 spores Two mL of spore suspensions, each supplemented with amino acid adjuvants (AA-B, AA-D, AA-Y, AA-Z), and 18 mL of PPD culture medium were added sequentially to 50 mL centrifuge tubes to achieve a final spore concentration of 1 × 10⁻⁶. 7 1 spore / mL (Table 1). The centrifuge tubes were then secured with rubber bands and placed in a shaker at (28±1)°C and 150 r / min for 24 hours. After incubation, samples were taken and spore germination was observed under a microscope. A spore suspension without adjuvants was included as a control. Each treatment was repeated 5 times, with 100 spores randomly observed each time. The number of germinating spores was counted, and the germination rate was calculated.

[0021] Table 1. Treatment methods of four adjuvants on Metarhizium anisopliae Ma41 in scarab beetles.

[0022] Note: β-alanine: AA-B, soybean peptide powder: AA-D, fish collagen peptide: AA-Y, branched-chain amino acids: AA-Z 4.1.2 Effects of different types of amino acid addition on the mycelial growth of Metarhizium anisopliae Ma41. Four adjuvants were added to PPDA medium to prepare media containing 0.05% and 0.5% adjuvants, respectively. Approximately 15 mL of medium was poured into each petri dish and cooled. The medium without adjuvants was used as a control. 2 μL of 1×10⁻⁶ adjuvants was added to each dish. 7A suspension of Metarhizium anisopliae Ma41 with 1 spore / mL was inoculated in the center of each culture medium. After incubation at 28±1℃ and 85% humidity for 14 days, the colony diameter was measured using the cross-crossing method. Each treatment was repeated 5 times.

[0023] 4.1.3 Effects of different types of amino acid addition on sporulation of Metarhizium anisopliae Ma41 The culture method for Metarhizium anisopliae Ma41 was the same as in 4.1.2. After 14 days of culture, spores were collected and prepared into a spore suspension in 0.05% Tween-80 solution. After shaking and serial dilution, the spore concentration was determined using a hemocytometer, and the total spore yield and spore yield per unit area were calculated. The above treatment was repeated 5 times.

[0024] 4.2 Effects of different proportions of AA-D on the biological activity of Metarhizium anisopliae Ma41 in scarab beetles The optimal amino acids determined in previous experiments were selected, and adjuvants of 0.125%, 0.25%, 0.50%, 1.00%, 2.00%, and 4.00% were added to PPD culture medium, with the spore suspension without adjuvants serving as a control. The culture was carried out on a shaker for 24 hours, and the spore germination rate was measured. The same proportions of adjuvants were added to PPDA medium, with the medium without adjuvants serving as a control. The culture was then inoculated with a spore suspension of *Metarhizium anisopliae* Ma41, and cultured at 28±1℃ and 85% relative humidity for 14 days. After culture, the colony diameter was measured, and spores were scraped and prepared into a spore suspension using 0.05% Tween-80. After dilution by shaking, the spore concentration was determined using a hemocytometer, and the total spore yield and spore yield per unit area were calculated. Each treatment was repeated 5 times.

[0025] 4.3 Effects of combined application of Metarhizium anisopliae Ma41 and AA-D on insecticidal activity in scarab beetles Dilute the spore suspension to 1.0 × 10⁻⁶. 8 1 spores / mL, 1.0 × 10 7 1 spores / mL, 1.0 × 10 6 1 spores / mL, 1.0 × 10 5 1 spores / mL, 1.0 × 10 4 1 spores / mL and 1.0 × 10 3Spores / mL were added to the corresponding concentrations with 2.00% AA-D, using a 0.05% Tween-80 aqueous solution as a control. Thirty third-instar brown planthopper nymphs were collected using a siphon and placed in centrifuge tubes. 10 mL of the prepared drug solution of the corresponding concentration was added, and the nymphs were immersed for 5 seconds before the solution was quickly filtered off with gauze. The treated nymphs were transferred to culture dishes containing rice seedlings (2-leaf, 1-heart stage), covered with transparent plastic cups, and placed in an artificial climate chamber for 10 days. Water was used as a blank control. Each treatment was repeated three times, and the number of live and dead nymphs was recorded for each treatment. Nymphs that could crawl normally when touched were considered live; those that crawled unnaturally, were partially dead, or completely dead were considered dead. The LC50 of each treatment was calculated. 50 Analyze the significant differences.

[0026] 4.4 Pot experiment to determine the effect of combined application of Metarhizium anisopliae Ma41 and AA-D on the control effect. Sixteen insect rearing cages were used, with two pots of rice of similar growth placed in each cage. Twenty third-instar larvae of brown planthoppers were introduced into each cage. Four treatment groups were established, with four replicates per treatment group. Each treatment group was sprayed with the following pesticide: ① 1.0 × 10⁻⁶ 7 Spores / mL: ① 1.0 × 10⁻⁶ spore suspension of *Metarhizium anisopliae* Ma41; 7 Spores / mL: ① 2.00% AA-D suspension of Metarhizium anisopliae Ma41 spores; ② 2.00% AA-D; ③ 0.05% Tween-80 aqueous solution (blank control). After 10 days of humidified isolation culture in a greenhouse, the number of brown planthopper deaths was investigated, with treatment ④ as the control, and the corrected mortality rate was calculated.

[0027] II. Results and Analysis 1. Effects of the addition of four amino acids on the biological activity of Metarhizium anisopliae Ma41. The experimental results showed no significant difference in spore germination rate among the various amino acid treatments, all remaining within the range of 95.6% to 97.2%, indicating that the tested amino acids did not inhibit spore germination. Regarding colony growth, 0.05% AA-B, 0.5% AA-B, and AA-D all significantly promoted mycelial expansion, with the largest colony diameter reaching 60.53 mm. In terms of sporulation capacity, the 0.5% AA-D treatment had the highest total sporulation, significantly higher than the control group; while the same concentration of AA-B significantly inhibited sporulation, with the lowest total sporulation and sporulation per unit area among all treatments. Regarding sporulation per unit area, 0.05% AA-Z, AA-Y, and 0.5% AA-D were all significantly higher than the control group. Overall, 0.5% AA-D showed the best combined effect in promoting colony growth and sporulation (Table 2).

[0028] Table 2. Effects of different amino acid classes on the biological characteristics of Metarhizium anisopliae Ma41.

[0029] Note: β-alanine: AA-B, soybean peptide powder: AA-D, fish collagen peptide: AA-Y, branched-chain amino acids: AA-Z 2. Effects of different proportions of AA-D on the biological activity of Metarhizium anisopliae Ma41 in scarab beetles. The experimental results showed that the spore germination rate of each concentration treatment remained within the range of 95.6% to 97.2%, with no significant difference, indicating that the concentrations of AA-D did not inhibit spore germination. Regarding colony growth, when the AA-D concentration was not lower than 1.00% (1.00%, 2.00%, 4.00%), the colony diameter was significantly larger than that of the control group, with the largest colony diameter (64.85 mm) observed in the 2.00% treatment, demonstrating a significant promoting effect on mycelial growth.

[0030] Regarding sporulation capacity, the total sporulation yield initially increased and then decreased with increasing AA-D concentration, reaching its highest value (15.88 × 10⁻⁶) at the 2.00% treatment. 8 The sporulation rate was significantly higher than that of the control group; the sporulation rate per unit area also reached its maximum value (0.48 × 10⁻⁶ spores) at the 2.00% treatment. 8 The concentration of 2.00% AA-D (spores / cm²) indicates that this concentration optimally enhances sporulation efficiency within a limited growth range. Comprehensive analysis shows that the 2.00% AA-D concentration exhibits the best overall performance in promoting colony growth and sporulation (Table 3).

[0031] Table 3. Effects of different soybean peptide powder concentrations on the biological characteristics of Metarhizium anisopliae Ma41.

[0032] 3. Effects of combined application of Metarhizium anisopliae Ma41 and AA-D on insecticidal activity in scarab beetles. When Metarhizium anisopliae Ma41 and 2.00% AA-D were used in combination, its LC... 50 The value is 7.44 × 10 6 The number of spores / mL decreased to 1.28 × 10⁻⁶. 6 The insecticidal toxicity was increased by 82.80% compared with the treatment of Metarhizium anisopliae Ma41 alone (Table 4). Figure 1 According to statistical analysis using Polo software, the two LC processing methods... 50 The fact that the lethal dose ratio did not include 1 in the 95% confidence interval indicates a significant difference between the two. Therefore, it can be concluded that the combined use of Metarhizium anisopliae Ma41 and 2.00% AA-D significantly enhances the insecticidal activity against brown planthoppers.

[0033] Table 4. Effects of combined application of Metarhizium anisopliae Ma41 and amino acids on virulence.

[0034] Note: * indicates that the lethal dose ratio analysis using Polo software showed a significant difference at the P < 0.05 level. 4. Pot experiment to determine the effect of combined application of Ma41 and AA-D on the control efficacy of Metarhizium anisopliae. As shown in Table 5, 1.0 × 10 7 The combined treatment of Metarhizium anisopliae Ma41 and 2.00% AA-D with spores / mL resulted in a mean corrected mortality rate of 61.64% against brown planthoppers, compared to treatment with only 1.0 × 10⁻⁶ spores / mL. 7 Treatment with Metarhizium anisopliae Ma41 (mean corrected mortality rate 41.05%) increased spores / mL by 50.16%, indicating that the combined application of Metarhizium anisopliae Ma41 and 2.00% AA-D can improve the control effect against brown planthopper.

[0035] Table 5. Control efficacy of combined application of Metarhizium anisopliae Ma41 and amino acids against brown planthopper.

[0036] This study shows that among the tested 4-amino acid adjuvants, soybean peptide powder (AA-D) has the best compatibility with Metarhizium anisopliae Ma41, significantly promoting mycelial expansion, increasing colony diameter, and improving sporulation. Among these, 2.00% AA-D showed the best overall effect in promoting colony growth and enhancing sporulation capacity. Furthermore, the combined treatment of 2.00% AA-D and Metarhizium anisopliae Ma41 significantly reduced the LC50 of the target pest, the brown planthopper. 50 The combined effect of Ma41 and soybean peptide powder (AA-D) effectively enhances the insecticidal activity of Ma41 and improves its control effect on brown planthopper. Currently, there are no reported studies on the combined use of Metarhizium anisopliae Ma41 and soybean peptide powder (AA-D), therefore this study provides reliable data support for its synergistic optimization in field applications.

Claims

1. A method for using Metarhizium anisopliae Ma41 on scarab beetles, characterized in that, Metarhizium anisopliae Ma41 was used in combination with soybean peptide powder; Metarhizium anisopliae Ma41 was deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41931 and deposit date of April 28, 2025.

2. The method of use according to claim 1, characterized in that, The soybean peptide powder concentration was 0.05-4%; the concentration of Metarhizium anisopliae Ma41 was 1.0 × 10⁻⁶. 6 Spores / mL - 1.0 × 10 8 Spores / mL.

3. The method of use according to claim 1, characterized in that, The soybean peptide powder concentration was 1-2%; the concentration of Metarhizium anisopliae Ma41 was 1.0 × 10⁻⁶. 6 Spores / mL - 1.0 × 10 7 Spores / mL.

4. The use of soybean peptide powder to improve the colony growth and sporulation of Metarhizium anisopliae Ma41, characterized in that, The soybean peptide powder concentration was 1-4%; the concentration of Metarhizium anisopliae Ma41 was 1.0 × 10⁻⁶. 6 Spores / mL - 1.0 × 10 8 Spores / mL.

5. The use of soybean peptide powder to enhance the insecticidal activity of Metarhizium anisopliae Ma41 against pests, characterized in that... The soybean peptide powder concentration was 1-4%; the concentration of Metarhizium anisopliae Ma41 was 1.0 × 10⁻⁶. 6 Spores / mL - 1.0 × 10 8 Spores / mL.

6. The use according to claim 5, characterized in that, The pest in question is the brown planthopper.

7. An insecticidal composition, characterized in that, It contains Metarhizium anisopliae Ma41 and soybean peptide powder, with the soybean peptide powder having a mass concentration of 1-4%; the concentration of Metarhizium anisopliae Ma41 is 1.0 × 10⁻⁶. 6 Spores / mL - 1.0 × 10 8 Spores / mL.

Images