Recombinant plasmid, heat-resistant isoamylase gene engineering strain and application
By constructing the recombinant plasmid pHT7-CoES212-IA in Bacillus subtilis to express isoamylase from extreme thermophilic bacteria, the problems of high production cost and long production cycle of isoamylase were solved, and efficient and low-cost isoamylase production was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
- Filing Date
- 2024-10-18
- Publication Date
- 2026-04-21
AI Technical Summary
Existing isoamylases have high production costs and long production cycles. Moreover, most isoamylases are heat-sensitive enzymes or have problems such as low heterologous expression levels and severe inclusion bodies, which affect their application.
A recombinant plasmid pHT7-CoES212-IA was constructed to express isoamylase derived from extreme thermophilic bacteria, and its efficient intracellular expression was achieved in Bacillus subtilis. By utilizing T7 RNA polymerase and an optimized ribosome binding site, inclusion body formation was reduced and soluble expression was improved.
This technology enables the efficient production of isoamylase, shortens the fermentation cycle, reduces production costs, and ensures that Bacillus subtilis is a food-grade microorganism that does not produce endotoxins, which is beneficial for large-scale production and application.
Smart Images

Figure CN121896261A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of enzyme engineering technology, and in particular to a recombinant plasmid, a thermostable isoamylase genetically engineered strain, and their applications. Background Technology
[0002] Starch is the second largest renewable resource in nature and an important industrial raw material. In natural starch, glucose units are linked by α-1,4-glycosidic bonds or α-1,6-glycosidic bonds, forming amylose and amylopectin. The enzymes used in starch processing mainly include: endopeptidases, exopeptidases, debranching enzymes, and glycoside transferases. Due to the complex structure of starch, a single enzyme cannot completely hydrolyze it; therefore, the synergistic action of multiple enzymes is usually required in the enzymatic hydrolysis of starch to produce oligosaccharides or monosaccharides. Isoamylase can be combined with α-amylase, saccharifying enzymes, β-amylase, 4-α-glucantransferase, glycogen phosphorylase, and other amylases to produce products such as glucose, maltose, cyclodextrin, resistant starch, and glucose-1-phosphate. This combination offers advantages such as shortening reaction time, increasing starch conversion rate, and reducing the amount of other saccharifying enzymes used, thereby increasing yield, improving equipment utilization, and reducing production costs.
[0003] Currently, only isoamylases derived from *Pseudomonas amy / oderamosa* have achieved industrial-scale production. However, enzyme production relies on fermentation of natural strains, resulting in a long production cycle and high requirements for the nutrient composition of the culture medium, leading to high production costs. Furthermore, most characterized isoamylases are thermostable enzymes with an optimum temperature of 25-55℃, while a few isoamylases from extreme thermophiles (optimum temperature 70-85℃) suffer from low heterologous expression levels and excessive inclusion bodies. Additionally, *Escherichia coli* contains endotoxins, which affects the application of recombinant isoamylases. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide a recombinant plasmid.
[0005] Another technical problem to be solved by the present invention is to provide a thermostable isoamylase genetically engineered strain containing the above-mentioned recombinant plasmid.
[0006] Another technical problem to be solved by the present invention is to provide the application of the above-mentioned thermostable isoamylase genetically engineered strain.
[0007] To solve the above-mentioned technical problems, the technical solution of the present invention is as follows:
[0008] A recombinant plasmid expressing isoamylase, wherein the nucleotide sequence of the promoter in the plasmid is shown in SEQ ID NO.1 and the nucleotide sequence of RBS is shown in SEQ ID NO.2.
[0009] Preferably, the above-mentioned recombinant plasmid is named recombinant plasmid pHT7-CoES212-IA, and its plasmid map is shown below. Figure 5 As shown.
[0010] Preferably, the recombinant plasmid expressed by the above-mentioned isoamylase is derived from extreme thermophilic bacteria.
[0011] Preferably, the recombinant plasmid expressed by the above-mentioned isoamylase is derived from an extreme thermophilic bacterium, and more preferably from a natural isoamylase derived from Sulfolobustokodaii.
[0012] Preferably, in the above recombinant plasmid, the amino acid sequence of the isoamylase is shown in SEQ ID NO.3.
[0013] Preferably, the nucleotide sequence of the isoamylase in the above recombinant plasmid is shown in SEQ ID NO.4.
[0014] Preferably, the recombinant plasmid further comprises a marker gene for screening engineered bacteria containing the recombinant plasmid.
[0015] Preferably, in the above recombinant plasmid, the marker gene is an antibiotic resistance gene.
[0016] Preferably, the above-mentioned recombinant plasmid is a free plasmid that can replicate autonomously in Bacillus subtilis.
[0017] A thermostable isoamylase genetically engineered strain containing the above-mentioned recombinant plasmid, wherein the genetically engineered strain uses Bacillus subtilis (e.g., WB800, WB600, SCK6, 1A751, ATCC6051, SCK22) as a host.
[0018] Preferably, the above-mentioned thermostable isoamylase genetically engineered strain is Bacillus subtilis SCK22, which integrates T7 RNA polymerase into its genome (Jing Ye, Yunjie Li, Yuqing Bai, et al. A facile and robust T7-promoter-based high-expression of heterologous proteins in Bacillus subtilis. Bioresources and Bioprocessing, 2022, 9(1).).
[0019] Preferably, the above-mentioned thermostable isoamylase genetically engineered strain is constructed by the following method:
[0020] (1) Preparation of competent Bacillus subtilis cells;
[0021] (2) Construct the above recombinant plasmid and transfer it into the strain obtained in step (1);
[0022] (3) Select the correct transformants based on the marker genes on the vector.
[0023] Application of the above-mentioned thermostable isoamylase genetically engineered strains in the production of soluble isoamylase.
[0024] Preferably, the application of the above-mentioned thermostable isoamylase genetically engineered strains follows these specific steps:
[0025] (1) The above-mentioned heat-resistant isoamylase genetically engineered strains were subjected to high-density fermentation to obtain Bacillus subtilis cells expressing isoamylase;
[0026] (2) The cells were homogenized under high pressure to obtain cell lysate, and then a simple heat treatment was performed to precipitate the impurities and proteins.
[0027] (3) Centrifugation to obtain isoamylase.
[0028] Beneficial effects:
[0029] The aforementioned recombinant plasmid is used to construct a thermostable isoamylase genetically engineered strain. This strain, using *Bacillus subtilis* with integrated T7 RNA polymerase in its genome as a host, is constructed using a suitable vector, promoter, and ribosome binding site. It can efficiently express isoamylase intracellularly. This strain has a short fermentation cycle, low production cost, does not form inclusion bodies, and is easy to purify, which is beneficial for the large-scale production of isoamylase. Specifically,
[0030] (1) The isoamylase is more likely to fold correctly in the intracellular environment of Bacillus subtilis, which can improve the expression level of soluble thermostable isoamylase and reduce the formation of inclusion bodies.
[0031] (2) Bacillus subtilis is a food-grade microorganism that is generally recognized as safe (GRAS) and does not produce endotoxins, which is beneficial for the application of isoamylase. Attached Figure Description
[0032] Figure 1 An SDS-PAGE gel image of Escherichia coli expressing isoamylase.
[0033] Figure 2 The diagram shows the expression of isoamylase by high-copy plasmids in Bacillus subtilis combined with different promoters. Among them, 1: SCK6 pMA5-PHapll-IA; 2: SCK6 pMA5-PaprE-IA; 3: SCK6 pMA5-PgroES-IA.
[0034] Figure 3 The image shows the effect of isoamylase expression in strain SCK22 pHT7-IA.
[0035] Figure 4 The image shows the effect of isoamylase expression in strain SCK22 pHT7-CoES212-IA.
[0036] Figure 5 This is the plasmid map of pHT7-CoES212-IA. Detailed Implementation
[0037] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be further described in detail below with reference to specific embodiments.
[0038] Unless otherwise stated, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods. Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0039] Comparative Example 1
[0040] Construction of engineered Escherichia coli strains expressing isoamylase
[0041] Using the genome of *Sulfolobus tokodaii* as a template, the expression plasmid pET20b was cloned into the pET20b vector using the simple cloning method (You, C., et al. (2012). "Simple Cloning via Direct Transformation of PCR Product (DNA Multimer) to *Escherichia acoli* and *Bacillus subtilis*." *Appl. Environ. Microbiol. 78(5): 1593-1595.). This plasmid was then chemically transformed into the expression host BL21(DE3) to obtain the engineered strain BL21(DE3)pET20b-IA.
[0042] One mL tube of the above-mentioned bacterial strain was inoculated into 50 mL of LB medium and cultured at 37°C until OD = 0.8-1.0. 0-100 μM IPTG was added to induce isoamylase expression, and the cells were collected after culturing at 18°C for 20 hours. SDS-PAGE was used to identify protein expression levels. Figure 1 As shown, a large number of inclusion bodies were produced in the bacterial cell lysate, and the proportion of soluble isoamylase in the total protein was less than 5%.
[0043] Comparative Example 2
[0044] The effect of different promoters (PHapll, PgroES, PaprE) on isoamylase expression in high-copy plasmids of Bacillus subtilis
[0045] Preparation of competent SCK6 cells: SCK6 strain (Zhang XZ, You C, Zhang YH. Transformation of Bacillus subtilis. Methods MolBiol. 2014; 1151: 95-101.) was activated by streaking onto LB agar plates containing 0.3 μg / mL erythromycin and incubated overnight at 37°C. The next day, single colonies were picked and inoculated into 5 mL of LB liquid medium containing 0.3 μg / mL erythromycin and incubated at 37°C and 200 rpm for 8-12 h. The absorbance at 600 nm was measured, and the culture was then diluted to A600 = ~1.0 with fresh LB liquid medium containing 0.3 μg / mL erythromycin preheated to 37°C. D-xylose was added to a final concentration of 1% (w / v), and the culture was further incubated at 37°C and 200 rpm for 2 h to obtain competent SCK6 cells.
[0046] Using pET20b-IA as a template, the isoamylase gene was cloned into the pMA5 vector using the simple cloning method. Primers hpall-VF and hpall-VR were used to clone the vector fragment, and primers hpall-lF and hpall-lR were used to clone the isoamylase fragment, resulting in the vector pMA5-PHapll-IA and the strain SCK6pMA5-PHapll-IA.
[0047] Hpall-IF:CATTTGTGCCACCTAAAAAGGAGCGATTTACATATGGTTTTTTCACACAAGGATAG
[0048] Hpall-VF: CTATCCTTGTTGGAAAAAACCATATGTAAATCGCTCCTTTTAGGTGGCACAAATG
[0049] Hpall-VR: GGTATATAGGAGGATTGAATATTAAGGATCCTCTAGAGTCGAGCTCAAGC
[0050] Hpall-IR:GCTTGAGCTCGACTCTAGAGGATCCTTAATATTCAATCCTCCTATATACC
[0051] Using pMA5-PHapll-IA as a template, the full-length plasmid was amplified by PCR using primers groES-R and groES-F. PCR conditions included denaturation at 98℃ for 2 min, followed by 30 cycles of the following parameters: 98℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 2 min, and a final extension at 72℃ for 5 min. The PCR products were analyzed by 1% agarose gel electrophoresis. After confirming the correct fragment size using a gel imaging system, the products were ligated using the Thermo Scientific Phusion site-directed mutagenesis kit. The ligation products were transformed into Bacillus subtilis competent cells SCK6 to obtain the plasmid pMA5-PgroES-IA and the strain SCK6pMA5-PgroES-IA.
[0052] groES-R: CTAAAGAGTGCTAACACAATTCTTATAATAAAGAATCTCCCTTCCAATTTCAAGTGATAAGGAGAAAAAAGAAACAAAAAAACC
[0053] groES-F: TGCTGAGTGCTAAAATTACATATTCATACTATTGAGGAGGTTATTTCAATGGTTTTTTCACACAAGG
[0054] Using pMA5-PHapll-IA as a template, the full-length plasmid was amplified by PCR using primers aprE-R and aprE-F. PCR conditions were: denaturation at 98℃ for 2 min, followed by 30 cycles of the following parameters: 98℃ denaturation for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 2 min, and final extension at 72℃ for 5 min. The PCR products were analyzed by 1% agarose gel electrophoresis. After confirming the correct fragment size using a gel imaging system, the products were ligated using the Thermo Scientific Phussion site-directed mutagenesis kit. The ligation products were transformed into Bacillus subtilis competent cells SCK6 to obtain the plasmid pMA5-PaprE-IA and the SCK6 strain pMA5-PaprE-IA.
[0055] aprE-R: CTTAAAAGACTATTCTGTGAATTTATTGTAATAGATGGAATAATATTTTAGTAGACCCATTTTTTTGAGATGATTTTGAGAAAAAAGAAACAAAAAAACC
[0056] aprE-F:TAAGTCTACTCTGAATTTTTTTAAAAGGAGAGGGTAAAGAATGGTTTTTCACACAAGGATAG
[0057] One mL tube of the above-mentioned bacterial strain was inoculated into 50 mL of SR medium and incubated at 37°C for 24 hours. The bacterial cells were then collected. SDS-PAGE was used to identify protein expression levels. Figure 2 As shown, only a small amount of IA was expressed in the cell lysate of SCK6pMA5-PHapll-IA, while no obvious IA band was observed in strains SCK6pMA5-PaprE-IA and SCK6pMA5-PgroES-IA.
[0058] Example 1
[0059] Effect of pHT7 vector on isoamylase expression in Bacillus subtilis
[0060] Preparation of competent SCK22 cells: SCK22 strain (Jing Ye, Yunjie Li, Yuqing Bai, et al. A facile and robust T7-promoter-based high-expression of heterologous proteins in Bacillus subtilis. Bioresources and Bioprocessing, 2022, 9(1)) was streaked onto LB agar plates containing 0.3 μg / mL erythromycin and cultured overnight at 37°C. The next day, single colonies were picked and inoculated into 5 mL of LB liquid medium containing 0.3 μg / mL erythromycin and cultured at 37°C and 200 rpm for 8–12 h. The absorbance at 600 nm was measured, and the culture was then diluted to A600 = ~1.0 with fresh LB liquid medium containing 0.3 μg / mL erythromycin preheated at 37°C. D-xylose was added to a final concentration of 1% (w / v), and the culture was further cultured at 37°C and 200 rpm for 2 h to obtain competent SCK22 cells.
[0061] Using pET20b-IA as a template, the isoamylase gene was cloned into the pHT7 vector using the simple cloning method (Jing Ye, Yunjie Li, Yuqing Bai, et al. A facile and robust T7-promoter-based high-expression of heterologous proteins in Bacillus subtilis. Bioresources and Bioprocessing, 2022, 9(1).). The primers used to clone the vector fragment were pHT7-VF and pHT7-VR, and the primers used to clone the isoamylase fragment were pHT7-1F and pHT7-IR, resulting in the vector pHT7-IA and the strain SCK22 pHT7-IA.
[0062] pHT7-IF:CTTTAAGAAAGGAGGATATACCATGGTTTTTTCACACAAGGATAGACC
[0063] pHT7-VF:GGTCTATCCTTGTGTGAAAAAAACCATGGTATATCCTCCTTTCTTAAAG
[0064] pHT7-IR: CCGCAATGGTATATAGGAGGATTGAATATTGAGATCCGGCTGCTAACAAAGC
[0065] pHT7-VR: GCTTTGTTAGCAGCCGGATCTCAATATTCAATCCTCCTATATACCATTGCGG
[0066] One mL tube of the above-mentioned bacterial strain was inoculated into 50 mL of SR medium containing 0.3 μg / mL erythromycin and 5 μg / mL chloramphenicol, and cultured at 37°C until OD = 0.8–1.0. 100 μM IPTG was added to induce isoamylase expression, and the cells were collected after 24 hours of incubation at 37°C. SDS-PAGE was used to identify protein expression levels. Figure 3 As shown, strain SCK22pHT7-IA produced significant amounts of soluble isoamylase, with intracellular soluble expression levels accounting for over 10% of the total protein, and some inclusion bodies were also produced.
[0067] Example 2
[0068] Optimized expression of isoamylase at ribosome binding sites in low-copy plasmids of Bacillus subtilis
[0069] Using pHT7-IA as a template, the full-length plasmid was amplified by PCR using primers T7-OoES212-F and T7-CoES212-R. PCR conditions included denaturation at 98℃ for 2 min, followed by 30 cycles of the following parameters: 98℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 2 min, and a final extension at 72℃ for 5 min. The PCR products were analyzed by 1% agarose gel electrophoresis. After confirming the correct fragment size using a gel imaging system, the products were ligated using the Thermo Scientific Phusion site-directed mutagenesis kit. The ligation products were transformed into Bacillus subtilis competent cells SCK22 to obtain the plasmid pHT7-CoES212-IA (nucleotide sequence shown in SEQ ID NO.2 of the sequence listing) and the strain SCK22 pHT7-CoES212-IA.
[0070] T7-CoES212-F: GAGATGTGGATTGTGAGCGGATCACAATTCCACAACCAACACCAATTAAAGGAGGAAGGATCCATGGTTTTTCACACAAG
[0071] T7-CoES212-R: CCTATAGTGAGTCGTATTAATTTCGCGGGATCGAGATCTCTGGTACCAAGC
[0072] One mL tube of the above-mentioned bacterial strain was inoculated into 50 mL of SR medium containing 0.3 μg / mL erythromycin and 5 μg / mL chloramphenicol, and cultured at 37°C until OD = 0.8–1.0. 100 μM IPTG was added to induce isoamylase expression, and the cells were collected after 24 hours of incubation at 37°C. SDS-PAGE was used to identify protein expression levels. Figure 4 As shown, all isoamylases were expressed in a soluble manner, and the intracellular soluble expression level accounted for more than 20% of the total protein.
[0073] Example 3
[0074] High-density fermentation for the production of isoamylase
[0075] The constructed engineered strain SCK22pHT7-CoES212-IA was evaluated using a batch-fed fermentation method, and the steps are as follows:
[0076] First, streak the engineered bacterial strain from the glycerol cryopreservation tubes onto a plate. Pick a single colony and inoculate it into a test tube containing 5 mL of seed culture medium (LB medium). Incubate at 37°C and 200 rpm for 16–18 h. Then, transfer the culture to a shake flask (250 mL) containing 30 mL of seed culture medium (LB medium) and incubate at 37°C and 250 rpm for 16–18 h. Transfer the seed culture (1% inoculum) into a 5 L fermenter (Dibil), filling to 3.0 L. The fermentation medium consisted of yeast extract 5 g / L, magnesium sulfate 1 g / L, manganese sulfate 0.05 g / L, potassium dihydrogen phosphate 10 g / L, trace elements 1 mL / L, calcium chloride 0.5 g / L, vitamin B1 0.05 g / L, ammonium chloride 20 g / L, glucose 25 g / L, and 0.3 μg / mL erythromycin and 5 μg / mL chloramphenicol. During fermentation, the pH was controlled at 7.0 using phosphoric acid and ammonia, and the fermentation temperature was 37℃. The aeration rate was 2.0 vvm, the stirring speed was 200–800 rpm, and dissolved oxygen was maintained at 20–40%. Once the OD600 of the fermentation broth stabilized, glucose and ammonium chloride were added at a constant flow rate, maintaining a C:N ratio of 10:1. During fermentation, when the OD600 reached 40, 100 μM IPTG was added to induce isoamylase expression.
[0077] After fermentation, the cells were collected by centrifugation, and the cells were broken up by high-pressure homogenization. The cell lysate was treated at 80 degrees Celsius for 20 minutes, and the supernatant was collected by centrifugation to obtain the isoamylase solution.
[0078] After fermentation, the engineered strain SCK22 pHT7-CoES212-IA produced an isoamylase yield of 2.1 g / L.
[0079] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention. Improvements and modifications such as strain modification based on the method of the present invention or based on the method are all considered to be within the scope of protection of the present invention.
Claims
1. A recombinant plasmid expressing isoamylase, characterized in that: The nucleotide sequence of the promoter in the plasmid is shown in SEQ ID NO.1, and the nucleotide sequence of RBS is shown in SEQ ID NO.
2.
2. The recombinant plasmid according to claim 1, characterized in that: The expressed isoamylase is a natural isoamylase derived from *Sulphurella multocida*, and preferably, the amino acid sequence of the isoamylase is shown in SEQ ID NO.
3.
3. The recombinant plasmid according to claim 1 or 2, characterized in that: The nucleotide sequence of the isoamylase is shown in the sequence listing SEQ ID NO.
4.
4. The recombinant plasmid according to claim 1 or 2, characterized in that: The recombinant plasmid also contains a marker gene for screening engineered bacteria containing the recombinant plasmid.
5. The recombinant plasmid according to claim 4, characterized in that: The marker gene is an resistance gene.
6. A thermostable isoamylase genetically engineered strain comprising the recombinant plasmid according to any one of claims 1-5, characterized in that: The genetically engineered bacteria use Bacillus subtilis as the host.
7. The thermostable isoamylase genetically engineered strain according to claim 6, characterized in that: The Bacillus subtilis strain mentioned is Bacillus subtilis WB800, WB600, SCK6, 1A751, ATCC6051 or SCK22 whose genome integrates T7 RNA polymerase.
8. The thermostable isoamylase genetically engineered strain according to claim 6 or 7, characterized in that: It is constructed using the following method: (1) Preparation of competent Bacillus subtilis cells; (2) Construct the above recombinant plasmid and transfer it into the strain obtained in step (1); (3) Select the correct transformants based on the marker genes on the vector.
9. The use of the thermostable isoamylase genetically engineered strain according to any one of claims 6-8 in the production of soluble isoamylase.
10. The application of the thermostable isoamylase genetically engineered strain according to claim 9, characterized in that: The specific steps are as follows: (1) The above-mentioned heat-resistant isoamylase genetically engineered strains were subjected to high-density fermentation to obtain Bacillus subtilis cells expressing isoamylase; (2) The cells were homogenized under high pressure to obtain cell lysate, and then a simple heat treatment was performed to precipitate the impurities and proteins. (3) Centrifugation to obtain isoamylase.