Molecular marker primer for identifying genetic sex of pike fish and application of molecular marker primer
The application of molecular marker primers for sex identification in pike has solved the problem of screening pseudo-males in all-female pike breeding, enabling early and accurate screening and efficient all-female breeding, reducing breeding costs and improving breeding efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI
- Filing Date
- 2026-01-19
- Publication Date
- 2026-04-21
AI Technical Summary
Existing technologies for all-female pike breeding suffer from problems such as late screening time, high cost, and low efficiency. In particular, it is difficult to eliminate useless males during the juvenile stage in the screening of pseudo-males, and pseudo-males treated with androgens cannot be sold, leading to a surge in breeding costs and low efficiency.
Genetic sex determination of pike was achieved using molecular marker primers, including molecular marker-specific and auxiliary molecular marker primers. The genetic sex of pike was identified by PCR amplification and agarose gel electrophoresis, male individuals were eliminated, and pseudo-males were screened out early to form an all-female population.
It enables accurate and rapid screening of pseudo-male fish in the early stages of breeding, reduces breeding costs, improves the efficiency of all-female breeding, ensures the feminization rate of fry, and is suitable for all-female breeding of black-spotted pike and white-spotted pike.
Smart Images
Figure CN121896334A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of aquatic animal breeding technology, and in particular to molecular marker primers for genetic sex identification in dogfish and their applications. Background Technology
[0002] Pike are medium to large carnivorous fish, mainly divided into two species in China: the black-spotted pike (Esox reichertii) distributed in the Heilongjiang River basin in Northeast China, and the white-spotted pike (Esoxlucius) distributed in the Ertis River basin in Northwest China. As cold-water freshwater economic fish, females of both species are significantly superior to males in economic traits such as growth rate and adult size (P<0.05). In addition, pike have a high egg production, and their eggs are orange-yellow, large, and nutritious, making them a good raw material for caviar production. Therefore, the development of all-female breeding and monosex farming of black-spotted pike has great economic potential. However, since pike lacks sexual dimorphism in morphology, the sex can only be distinguished by observing the degree of abdominal swelling and whether the genital opening is red and swollen during the breeding season. Therefore, in the process of breeding an all-female population, in order to find pseudo-males (XX), that is, fish that are genetically female but physiologically male and can produce sperm, all the pike selected after androgen treatment must be raised to sexual maturity, then all of them must be dissected, and then facultative individuals with both testes and ovaries must be selected. Their testes are then ground up and the sperm is filtered out and mixed with the eggs of normal female fish (XX) to produce an all-female population (XX).
[0003] However, this traditional method of selecting pseudo-male fish has two major drawbacks. First, the selection time is too late, leading to a surge in breeding costs. Because with current technology, all the candidate pike treated with androgens must be raised to sexual maturity (generally 2-3 years) before pseudo-males can be visually identified during dissection, making it impossible to eliminate useless normal males (XY) during the juvenile stage. Furthermore, because of the androgen treatment, these sexually mature normal males cannot be legally sold and must be discarded. Second, the selection efficiency is low, making it difficult to support large-scale production. This is because the proportion of pseudo-males (XX) with both ovaries and testes is often low, and since part of the gonads in facultative individuals is the ovary, the proportion of testes is low, resulting in low sperm production, making it difficult to meet the needs of large-scale all-female breeding. Among all pseudo-male fish, the individuals with complete sex reversal (XX) account for a large proportion. They not only have high sperm production but also high sperm motility due to their fully developed testes. However, since their gonads are all testes, they cannot be distinguished from normal male fish (XY) by the naked eye and must be discarded.
[0004] Therefore, in order to improve the breeding efficiency of all-female (XX) pike populations, it is extremely important to develop convenient, rapid, and accurate genetic sex molecular markers for pike and apply them to the early screening of pseudo-males (XX), thereby forming a complete all-female pike breeding method that can effectively reduce breeding costs and greatly improve breeding efficiency. Summary of the Invention
[0005] This invention provides molecular marker primers for genetic sex identification in pike and their applications.
[0006] The molecular marker primers for sex identification of pike in this invention include molecular marker-specific primers and auxiliary molecular marker primers. The upstream primer of the molecular marker-specific primer is 5'-CAGTGATGTCCTGCCACAGT-3', and the downstream primer of the molecular marker heterosex primer is 5'-CCTCCCAGGATCCCACTACA-3'. The upstream primer of the auxiliary molecular marker is 5'-AAGGCTTGGTCCTGACCTTAC-3', and the downstream primer of the auxiliary molecular marker is 5'-GCTGGCACGAGTTTTACCG-3'.
[0007] Furthermore, the 530bp sequence obtained by molecular marker-specific primer PCR amplification is as follows:
[0008] 5'--3'.
[0009] Furthermore, the 242bp sequence obtained by marker-assisted PCR amplification is as follows:
[0010] 5'-AAGGCTTGGTCCTGACCTTACTATCAGCTTTAACTAAATTACACATGCAAGTCTCCGCACCCCTGTGAGGATGCCCTTAATCCCCTGCCCGGGGCTGAGGAGCTGGCATCAGGCACACATTGTAGCCCAAGACGCCTTGCTAAGCCACACCCCTACGGGTACTCAGCAGTGATAAATATTAAGTGATAAGCGAAAGCTTGACTTAGTTATTGTTAAAAGGGCCGGTAAA ACTCGTGCCAGC-3'.
[0011] The present invention relates to the application of molecular marker primers for genetic sex identification in pike in all-female pike breeding.
[0012] Furthermore, the method for breeding all-female pike is carried out according to the following steps:
[0013] 1. Obtaining newly hatched fry;
[0014] II. Hormone treatment of newly hatched fish larvae;
[0015] 3. After the hormone treatment is completed, select prey fish with a body length of 1 / 5 to 1 / 3 of the pike fry's body length for feeding, and then transfer them to normal breeding management to obtain pike fry (at the same time, regularly measure the size of the pike fry and dynamically adjust the size of the prey fish);
[0016] IV. When the pike fry grow to over 10 cm, anesthetize them and cut off 0.5 cm sections. 2 The caudal fins of the pike fry were preserved in anhydrous ethanol. (After preservation and numbering, disinfectant was applied to the caudal fins of the pike fry, and they were placed in clean water to revive. Then, each individual was temporarily isolated and raised in isolation cages, and each was assigned a number corresponding to its respective fin. The number of fry to be tested for genetic sex each time was determined based on testing capacity and the number of isolation and rearing facilities).
[0017] 5. Wash away the ethanol from the fin rays with purified water, and then extract their genomic DNA; perform PCR amplification using the pike genetic sex identification molecular marker primers described in this invention. The upstream primer of the molecular marker-specific primer in the PCR amplification system is 5'-CAGTGATGTCCTGCCACAGT-3', the downstream primer of the molecular marker-specific primer is 5'-CCTCCCAGGATCCCACTACA-3', the upstream primer of the auxiliary molecular marker is 5'-AAGGCTTGGTCCTGACCTTAC-3', and the downstream primer of the auxiliary molecular marker is 5'-GCTGGCACGAGTTTTACCG-3'.
[0018] 6. Perform agarose gel electrophoresis on the PCR products. Individuals showing one 242 bp band are genetically female (XX), and individuals showing two bands of 530 bp and 242 bp respectively are genetically male (XY). Eliminate all individuals genetically male (XY).
[0019] 7. Repeat steps four through six until all individuals with the genetic sex of male XY are eliminated. Then, raise the remaining pike fry with the genetic sex of female XX to sexual maturity. When artificially breeding them again, first anesthetize them, then dry their body surface and dissect them to find individuals with testes, which are 100% pseudo-male XX fish.
[0020] 8. After removing the testes of the pseudo-male fish, cut them into pieces, filter out the semen, and store them temporarily in a refrigerator at 4°C. Mix the eggs of normal female fish with the semen of pseudo-male fish at a female-to-male ratio of 1:3, and then perform artificial insemination and incubation. The resulting fry are all-female fish.
[0021] Furthermore, in step one, during the spring pike breeding season, select fertile male and female parent fish in a 1:3 ratio for artificial insemination and incubation to obtain newly hatched fry.
[0022] Furthermore, in step two, the method of hormone treatment for newly hatched larvae is as follows: newly hatched larvae are raised in a special pond. After 50% of the newly hatched larvae float to the surface, they are overfed with newly hatched brine shrimp larvae incubated with 10-50 mg / L of 17α-methyltestosterone (to ensure that each larva can ingest enough medicated feed). They are fed 5-7 times a day for 4-8 weeks (during which time, uneaten feed, feces and dead larvae are removed in a timely manner).
[0023] The molecular markers of this invention are used to identify the genetic sex of pike, that is, pike that can amplify the target band are genetically male, and those that cannot amplify the band are female. The auxiliary molecular markers are used to confirm that the genomic DNA of the sample has been correctly added to the PCR reaction system, and to prevent the situation where individuals of genetic sex are misidentified as female due to the absence of the target band during electrophoresis caused by the absence of genomic DNA.
[0024] This invention employs molecular markers highly correlated with the genetic sex of both white-spotted and black-spotted pike. Unlike existing technologies, these markers are universally applicable for sex identification in both species, boasting an accuracy rate of 100%, significantly superior to existing techniques. Utilizing these markers, during the breeding of all-female pike populations, it is possible to completely identify and eliminate all genetically male (XY) individuals in the sex-reversed population early in the breeding process, reducing selection costs. After sexual maturity, all pseudo-males (XX) can be accurately screened simply by visually observing the presence of testes, allowing them to be used for all-female (XX) production. This method offers advantages such as high accuracy and ease of operation. It avoids the problem of misidentifying genetically male (XY) individuals as pseudo-males (XX) due to low accuracy in pseudo-male (XX) identification, leading to low feminization rates in all-female pike production. This invention has significant application value in all-female pike breeding.
[0025] This invention addresses the problem of high cost and low efficiency in all-female breeding caused by the lack of screening technology for pseudo-male pike. It provides a genetic sex identification marker for pike and uses it as the core to form an efficient and convenient all-female pike breeding method, which effectively promotes the development of the pike aquaculture industry. Attached Figure Description
[0026] Figure 1 Validation results of molecular markers for sex in pike; (M stands for Marker, with molecular weights from top to bottom being 1000, 900, 800, 700, 600, 500, 400, 300, 200, and 100 bp, respectively) Detailed Implementation
[0027] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0028] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.
[0029] Example 1: The primers and applications provided by this invention are applicable to black-spotted pike and white-spotted pike, and are used for selective breeding of black-spotted pike, as detailed below:
[0030] 1. Sex reversal treatment and breeding management
[0031] During the breeding season of the black-spotted pike, fertile male and female parent fish were selected and artificially inseminated at a ratio of 1:3 to obtain newly hatched fry. 2000 newly hatched fry were separated and raised in a dedicated pond, with water temperature controlled at 8–20℃, dissolved oxygen greater than 6 mg / L, and pH at 6.5–9.0. Once approximately 1000 fry surfaced, they were overfed with newly hatched brine shrimp larvae incubated with 35 mg / L of 17α-methyltestosterone to ensure each fry received sufficient medicated feed. Feeding was conducted six times daily for five weeks. During this period, uneaten feed, feces, dead fry, and filters at the inlet and outlet were promptly removed. After sex reversal treatment, juvenile rockfish (Pike spp.) of 1 / 5–1 / 3 the size of the black-spotted pike fry were selected for feeding and transferred to regular aquaculture management. Simultaneously, the size of the pike fry was regularly measured, and the size of the feed fish was adjusted accordingly.
[0032] 2. Sample Collection
[0033] When the black-spotted pike fry reach 10 cm in length, they are anesthetized with 500 mg / L 2-phenoxyethanol, and then 0.5 cm sections are cut using sterilized scissors. 2 The caudal fins of the pike fry were preserved in anhydrous ethanol and numbered. After disinfection of the caudal fins with gentian violet solution, the fry were placed in clean water to revive. Each reviving individual was temporarily isolated and raised separately, and assigned a number corresponding to its respective fin. Forty fry were tested each time.
[0034] 3. Total DNA extraction and PCR amplification
[0035] Remove the fin rays and soak them in purified water for 10 min to wash away the ethanol. Repeat the washing process twice. Then, extract total DNA from the fin rays and label them. Use the total DNA as a template for PCR amplification. The upstream primer for the molecular marker was 5'-CAGTGATGTCCTGCCACAGT-3', the downstream primer for the molecular marker was 5'-CCTCCCAGGATCCCACTACA-3', the upstream primer for the auxiliary molecular marker was 5'-AAGGCTTGGTCCTGACCTTAC-3', and the downstream primer for the auxiliary molecular marker was 5'-GCTGGCACGAGTTTTACCG-3'. Since the amplification efficiency of the molecular marker is lower than that of the auxiliary molecular marker, in order to ensure clear electrophoresis results, the concentration of the upstream and downstream primers for the molecular marker was set to 4 times that of the auxiliary molecular marker in the PCR reaction system.
[0036] The PCR amplification reaction system consisted of 30 μL: 15 μL of 2×Taq PCR mix, 2 μL of total DNA from the sample to be identified, 1.6 μL each of the upstream and downstream primers for the molecular marker, 0.4 μL each of the upstream and downstream primers for the auxiliary molecular marker, and the remainder was made up with ddH2O. The PCR reaction program was as follows: pre-denaturation at 95℃ for 3 min, followed by 30 cycles of denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s, and extension at 72℃ for 30 s. After completing 30 cycles, a final extension reaction was performed at 72℃ for 2 min, and finally, the mixture was incubated at 12℃ for an extended period.
[0037] 4. Gel electrophoresis of PCR products
[0038] Add 3 μL of 10× loading buffer to each PCR product, vortex to mix, and centrifuge briefly. Take 5 μL of the mixed PCR product and perform electrophoresis on a 1.5% agarose gel for 45 min at a voltage of 180 V. Finally, place the agarose gel in a gel imaging system to take a picture.
[0039] 5. Analysis of the identification results
[0040] The electrophoresis results showed only one 242 bp band indicating female (XX) genetic sex, and two bands of 530 bp and 242 bp in size indicating male (XY) genetic sex. Based on their numbers, the black-spotted pike individuals corresponding to the male (XY) genetic sex were discarded, and the selected female (XX) genetic sex individuals were removed from the isolation cages for centralized rearing.
[0041] 6. Continue testing
[0042] Repeat steps 2-5 until all individuals with the genetic sex of male (XY) are eliminated. Then, carefully raise the selected pike fry with the genetic sex of female (XX) to two years of age to reach sexual maturity.
[0043] 7. Preparation of all-female fish
[0044] For subsequent artificial breeding, 10 pseudo-males were randomly selected from the hormone-treated group. After anesthetizing them with 500 mg / L 2-phenoxyethanol, their bodies were dried and dissected to identify individuals with testes; these were the 100% pseudo-males (XX). This selection process was repeated rapidly until 30 pseudo-males (XX) were identified. Their testes were removed, chopped in a mortar, and the semen was filtered through clean gauze and temporarily stored at 4°C. The remaining pseudo-males (XX) could be raised for the next year's all-female breeding. Then, normal, untreated, fertile females (XX) were selected and anesthetized. Eggs were extracted and artificially inseminated using a 1:3 female-to-male ratio, combining normal eggs (X) with pseudo-male sperm (X). The resulting fry were the all-females (XX).
[0045] Figure 1 The results of molecular marker validation for sex determination in pike (M represents the marker, with molecular weights from top to bottom being 1000, 900, 800, 700, 600, 500, 400, 300, 200, and 100 bp, respectively). Figure 1 It can be seen that all female pike showed only one 242 bp band, while all male pike showed two bands of 530 bp and 242 bp respectively, indicating that the identification accuracy was 100%.
Claims
1. Molecular marker primers for genetic sex determination in pike, characterized in that, The molecular marker primers for sex determination in pike include marker-specific primers and auxiliary marker primers. The upstream primer for the marker-specific primer is 5'-CAGTGATGTCCTGCCACAGT-3', and the downstream primer for the marker of opposite sex is 5'-CCTCCCAGGATCCCACTACA-3'. The upstream primer for the auxiliary marker is 5'-AAGGCTTGGTCCTGACCTTAC-3', and the downstream primer for the auxiliary marker is 5'-GCTGGCACGAGTTTTACCG-3'.
2. The molecular marker primers for pike genetic sex identification according to claim 1, characterized in that, The 530bp sequence obtained by PCR amplification using molecular marker-specific primers is as follows: 5'--3'.
3. The molecular marker primers for pike genetic sex identification according to claim 1, characterized in that, The 242bp sequence obtained by marker-assisted PCR amplification is as follows: 5'-AAGGCTTGGTCCTGACCTTACTATCAGCTTTAACTAAATTACACATGCAAGTCTCCGCACCCCTGTGAGGATGCCCTTAATCCCCTGCCCGGGGCTGAGGAGCTGGCATCAGGCACACATTGTAGCCCAAGACGCCTTGCTAAGCCACACCCCTACGGGTACTCAGCAGTGATAAATATTAAGTGATAAGCGAAAGCTTGACTTAGTTATTGTTAAAAGGGCCGGTAAA ACTCGTGCCAGC-3'.
4. The application of the pike genetic sex identification molecular marker primers as described in claim 1 in all-female pike breeding.
5. The application according to claim 4, characterized in that... The method for breeding all-female pike is as follows:
1. Obtaining newly hatched fry; II. Hormone treatment of newly hatched fish larvae; 3. After the hormone treatment is completed, select bait fish with a body length of 1 / 5 to 1 / 3 of the pike fry body length for feeding, and then transfer to the conventional breeding management state to obtain pike fry. IV. When the pike fry grow to over 10 cm, anesthetize them and cut off 0.5 cm sections. 2 The tail fin was preserved in anhydrous ethanol.
5. Wash away the ethanol from the fin rays with purified water, and then extract their genomic DNA; perform PCR amplification using the pike genetic sex identification molecular marker primers described in claim 1. In the PCR amplification system, the upstream primer of the molecular marker-specific primer is 5'-CAGTGATGTCCTGCCACAGT-3', the downstream primer of the molecular marker-specific primer is 5'-CCTCCCAGGATCCCACTACA-3', the upstream primer of the auxiliary molecular marker is 5'-AAGGCTTGGTCCTGACCTTAC-3', and the downstream primer of the auxiliary molecular marker is 5'-GCTGGCACGAGTTTTACCG-3'.
6. Perform agarose gel electrophoresis on the PCR products. Individuals showing one 242 bp band are genetically female (XX), and individuals showing two bands of 530 bp and 242 bp respectively are genetically male (XY). Eliminate all individuals genetically male (XY).
7. Repeat steps four through six until all individuals with the genetic sex of male XY are eliminated. Then, raise the remaining pike fry with the genetic sex of female XX to sexual maturity. When artificially breeding them again, first anesthetize them, then dry their body surface and dissect them to find individuals with testes, which are 100% pseudo-male XX fish.
8. After removing the testes of the pseudo-male fish, cut them into pieces, filter out the semen, and store them temporarily in a refrigerator at 4°C. Mix the eggs of normal female fish with the semen of pseudo-male fish at a female-to-male ratio of 1:3, and then perform artificial insemination and incubation. The resulting fry are all-female fish.
6. The application according to claim 4, characterized in that, In step one, during the spring pike breeding season, select fertile male and female parent fish in a 1:3 ratio for artificial insemination and incubation to obtain newly hatched fry.
7. The application according to claim 4, characterized in that, In step two, the method of hormone treatment for newly hatched larvae is as follows: newly hatched larvae are raised in a special pond. After 50% of the newly hatched larvae float to the surface, they are overfed with newly hatched brine shrimp larvae incubated with 10-50 mg / L of 17α-methyltestosterone, 5-7 times a day, for 4-8 weeks.